CN113755515A

CN113755515A - Recombinant escherichia coli for efficiently producing clavulanic acid and application thereof

Info

Publication number: CN113755515A
Application number: CN202111151501.6A
Authority: CN
Inventors: 王小元; 乔君; 詹依; 檀昕; 胡晓清
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-09-29
Filing date: 2021-09-29
Publication date: 2021-12-07
Anticipated expiration: 2041-09-29
Also published as: CN113755515B

Abstract

The invention discloses recombinant escherichia coli for efficiently producing clavulanic acid and application thereof, and belongs to the fields of genetic engineering, fermentation engineering and material science. According to the invention, by editing key genes synthesized by CA, a mutant for overproducing CA is constructed; then obtaining an optimal culture medium by a single factor and response surface method, and optimizing the fermentation conditions in the fermentation tank. The yield of CA prepared by the method reaches 19.79g/L, which is higher than the known maximum yield (10.39g/L), and is improved by 90.47%. In addition, the CA prepared by the method is characterized in properties, and the CA is proved to have excellent properties such as solid form, molecular weight, space structure, chain conformation, thermal and rheological properties and the like. The high yield of CA in the invention provides a tamping foundation for large-scale production and research on CA properties, and the disclosure of CA properties provides a solid theoretical foundation for the development and utilization of CA.

Description

Recombinant escherichia coli for efficiently producing clavulanic acid and application thereof

Technical Field

The invention relates to recombinant escherichia coli for efficiently producing clavulanic acid and application thereof, belonging to the fields of genetic engineering, fermentation engineering and material science.

Background

Natural polysaccharides, particularly polysaccharides having triple helix conformation, have unique properties and functions such as anti-tumor, immunomodulation, etc., and are receiving increasing attention in the fields of food and medicine. Therefore, the research and development of the polysaccharide have important significance in the field of high molecules. Claritanic Acid (CA) is an extracellular protective barrier polysaccharide widely existing in intestinal bacteria, and plays a crucial role in adaptation of thalli to external environment. CA in Escherichia coli K-12 strain MG1655, is composed of D-galactose, L-fucose, D-gluconic acid and D-glucose composed of repeating unit. It has been reported that the intestinal microorganisms produce CA to prolong the life of the host, thereby indicating that CA has a function of delaying aging. In addition, the high content of L-fucose (about 30%) in CA means that CA has great application potential in the aspects of anti-inflammation, anti-tumor, anti-cancer, immunity enhancement and the like. Meanwhile, the CA modified cellulose hydrogel has excellent water-retaining property, so that the CA modified cellulose hydrogel becomes an excellent choice in the cosmetic and healthcare industries.

Under extreme environmental or envelope stress conditions, E.coli can synthesize CA. In our previous work, we found that truncation of Lipopolysaccharide (LPS) could better promote CA synthesis. In addition, CA biosynthesis is regulated by the Rcs phosphate delivery system, which includes six genes, igaA, rcsF, rcsC, rcsD, rcsB, and rcsA. Among them, RcsA can activate the CA gene cluster and exert a positive regulatory effect in CA synthesis. However, RcsA can be hydrolyzed by the ATP-dependent protease Lon (encoded by the Lon gene), and therefore, the half-life of RcsA is short; furthermore, rcsA can also be silenced by histone HNS (encoded by the HNS gene) (fig. 1).

CA has a wide development prospect in multiple application fields, and the research and application of CA are promoted more widely by improving CA yield and revealing CA property. The highest yield of CA is reported to be 10.39g/L with a conversion of about 52% (see Wu, H., Chen, S., Ji, M., Chen, Q., Shi, J., & Sun, J. (2019.) the Activation of the hydrolytic acid biosynthesis linked to heterologous expression of the hydrolytic pathway in Escherichia coli. int J Biol Macromol,128, 752-. In addition, there is currently little research on CA properties, and most focus on monosaccharide composition, molecular weight, and rheological properties. Thus, obtaining a process that can produce Clavulanic Acid (CA) in high yields would facilitate widespread use of CA in industry.

Disclosure of Invention

In order to maximize the yield of clavulanic acid, the present invention first constructs a CA overproducing mutant by editing a key gene for CA synthesis. Then, an optimal culture medium is obtained by a single factor and response surface method, and fermentation conditions in a fermentation tank are optimized. The yield of CA prepared by the method reaches 19.79g/L, which is higher than the known maximum yield (10.39g/L), and is improved by 90.47%. In addition, the CA prepared by the method is characterized in properties, and the CA is proved to have excellent properties such as solid form, molecular weight, space structure, chain conformation, thermal and rheological properties and the like. The high yield of CA in the invention provides a tamping foundation for large-scale production and research on CA properties, and the disclosure of CA properties provides a solid theoretical foundation for the development and utilization of CA.

The invention provides a method for improving the yield of clavulanic acid, which is to knock out and express key genes on an escherichia coli genome to obtain a high-yield clavulanic acid strain.

The invention provides a recombinant escherichia coli, wherein a lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on a genome are knocked out, escherichia coli with a Lon protein coding gene Lon and an HNS regulatory protein coding gene HNS knocked out is taken as a host cell, and a UTP-1-phosphoglucose uridyltransferase coding gene galU and a DNA combined transcription activator RcsA coding gene rcsA are overexpressed.

In one embodiment of the invention, the lipopolysaccharide core polysaccharide synthesis gene clusters waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG, waaQ, have NCBI accession numbers 948148, 948147, 948146, 948145, 948142, 948143, 948144, 948150, 948149, 94815; the NCBI accession number for lon is 945085; the NCBI accession number of hns is 945829; the NCBI accession number of galU is 945730; the NCBI accession number for rcsA is 946467.

In one embodiment of the invention, the recombinant Escherichia coli takes Escherichia coli str.K-12MG1655 as a host cell and pRSFDuet-1 as an expression vector.

In one embodiment of the invention, the recombinant E.coli is P₂₀The strong promoter strengthens the expression of galU and rcsA genes; the P is₂₀The nucleotide sequence of the strong promoter is: AATACTTGACATATCACTGTGATTCACATATAATATGCG are provided.

In one embodiment of the present invention, the recombinant escherichia coli is constructed by the following method:

(1) construction of host cells:

knocking out lipopolysaccharide core polysaccharide synthesis gene clusters waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on the genome of an Escherichia coli str.K-12MG1655 host cell, and knocking out lon and hns genes at the same time to construct the host cell;

(2) construction of recombinant vectors:

using the promoter P₂₀After being respectively connected with key genes galU and rcsA in a CA biosynthesis pathway, the recombinant expression vector is connected with an expression vector pRSFDuet-1 to prepare a recombinant vector;

(3) construction of recombinant E.coli:

and (3) introducing the recombinant vector prepared in the step (2) into the host cell prepared in the step (1) to obtain recombinant escherichia coli.

The invention also provides a method for producing the clavulanic acid by fermenting glucose, which comprises the following steps: the recombinant escherichia coli is prepared by fermentation.

In one embodiment of the invention, the seed solution of the recombinant escherichia coli is inoculated into a fermentation medium and fermented to prepare the clavulanic acid, wherein the fermentation medium comprises: 15-30 g/L glucose, 35-45 g/L Na₂HPO₄·12H₂O，1～8g/L NH₄Cl，2～4g/L KH₂PO₄，2～4g/L NaCl，0.01～0.05g/L CaCl₂And 0.1-0.5 g/L MgSO₄。

In one embodiment of the invention, the fermentation medium comprises: 21.47g/L glucose, 40.2g/L Na₂HPO₄·12H₂O，1g/L NH₄Cl，3g/L KH₂PO₄，3g/L NaCl，0.014g/L CaCl₂And 0.24g/L MgSO₄。

In one embodiment of the invention, the seed solution of the recombinant Escherichia coli is inoculated in a fermentation medium in an amount OD₆₀₀0.04 to 0.21.

In one embodiment of the invention, the seed solution of the recombinant escherichia coli is inoculated into a fermentation medium, and the fermentation conditions are as follows: at 25-37 deg.C and 150-250 rpm.

In one embodiment of the present invention, the preparation method of the seed liquid comprises: adding the recombinant escherichia coli into an LB liquid culture medium, and culturing for 12-16 h at 35-38 ℃ and 150-250 rpm.

In one embodiment of the invention, the pH is controlled to be not less than 6.0 and the dissolved oxygen is controlled to be not less than 30% during the fermentation process of the clavulanic acid, and the inoculation amount keeps the initial bacterial density OD₆₀₀0.04 to 0.21.

The invention also provides the clavulanic acid prepared by the method.

In one embodiment of the present invention, analyzing the physical properties of the prepared clavulanic acid comprises: solid form, molecular weight, molecular conformation, thermal properties, and rheology.

In one embodiment of the invention, the clavulanic acid solid obtained by the process is in the form of a paper crumb.

In one embodiment of the invention, the clavulanic acid obtained by the process has a molecular weight of 2.0X 10⁶～4.85×10⁶And D, dalton.

In one embodiment of the invention, the clavulanic acid obtained by the method has a spherical chain conformation in an aqueous solution, and the molecular diameter is 222.7-286.4 nanometers.

In one embodiment of the invention, the clavulanic acid obtained by the method is stable within 30-102 ℃, and the glass transition temperature, the melting temperature and the decomposition temperature are 123.5 ℃, 253.9 ℃ and 291.9 ℃ respectively.

In one embodiment of the invention, the aqueous solution of clavulanic acid obtained by the process is a non-newtonian fluid whose viscosity is related to concentration, shear rate, salt, temperature and pH. Exhibit viscosity and elasticity at high concentrations of clavulanic acid.

The invention also provides application of the prepared clavulanic acid in the fields of food, medicine, materials or environmental protection.

The invention also provides application of the recombinant escherichia coli in preparation of a product containing the clavulanic acid.

In one embodiment of the invention, the product is a food, pharmaceutical or chemical.

Advantageous effects

(1) The invention takes MG1655 delta (L-Q) of a gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ with the knockout of lipopolysaccharide core polysaccharide synthesis genes on a genome as a host cell, knocks out lon and hns genes on the genome of the host cell to obtain a mutant strain WQM003, and the clavulanic acid yield of the WQM003 is improved by 2.43 times compared with that of the MG1655 delta (L-Q). Subsequently, a pRAU plasmid is constructed by expressing galU and rcsA genes, and the plasmid is introduced into WQM003 to obtain the recombinant strain WQM003/pRAU, and compared with the MG1655 delta (L-Q) strain, the yield of the clavulanic acid obtained by fermenting the recombinant strain WQM003/pRAU is improved by 4.24 times.

(2) The clavulanic acid production culture medium is optimized in a triangular flask through a single-factor experiment and a response surface method to obtain the optimal culture medium for clavulanic acid production, and the yield of the clavulanic acid of WQM003/pRAU reaches 12.47g/L by using the optimal culture medium for fermentation, and is 33.58 times higher than that of the starting strain MG1655 delta (L-Q).

(3) In order to expand the production of the clavulanic acid, the fermentation conditions are optimized in a fermentation tank, and through high-yield strain construction, fermentation culture medium and fermentation condition optimization, the yield of the clavulanic acid of WQM003/pRAU reaches 19.79g/L, which is 53.49 times higher than that of the original strain, and reaches the highest yield of the clavulanic acid at present.

(4) To expand the application of clavulanic acid, the physical properties of clavulanic acid were further investigated. The clavulanic acid solid is in the shape of paper scraps; molecular weight of 2.0X 10⁶～4.85×10⁶Dalton; the clavulanic acid is in a spherical chain conformation in an aqueous solution, and the molecular diameter is 222.7-286.4 nanometers; the clavulanic acid is stable within 30-102 ℃, and the glass transition temperature, the melting temperature and the decomposition temperature are 123.5 ℃, 253.9 ℃ and 291.9 ℃ respectively; aqueous clavulanic acid is a non-newtonian fluid whose viscosity is related to concentration, shear rate, salt, temperature and pH, exhibiting viscosity and elasticity at high concentrations of clavulanic acid.

Drawings

FIG. 1: biosynthesis and regulation of CA in Escherichia coli K-12 strain MG 1655. A is a gene and a pathway for CA biosynthesis; truncation of B, LPS, promotes CA production; c is CA biosynthesis which is regulated by RcsA, HNS and Lon proteins.

FIG. 2: starting strain and mutant strain clavulanic acid yield. A is the screening of the original strain, and B is the yield of the mutant strain clavulanic acid.

FIG. 3: and (3) constructing pRAU plasmid. The SD sequence overexpresses the rcsA and galU genes using the strong promoter P20.

FIG. 4: and E.coli cell exopolysaccharide tannin mordant dyeing.

FIG. 5: the medium for CA production was optimized for a single factor experiment based on M9 medium. A is the type of carbon source; b is the glucose concentration; c is a nitrogen source type; d isKH₂PO₄Concentration; e is Na₂HPO₄·12H₂The concentration of O; f is NaCl concentration.

FIG. 6: the culture medium and fermentation process for CA production are optimized. A is pareto chart analysis designed for PB; b is the steepest climbing experiment result; c is a 2D and 3D response surface diagram; d is the influence of the inoculum size on the CA yield in the fermentation process; e, fermentation of clavulanic acid without controlling the pH value; f, controlling the pH value to be kept to be not less than 6.0, and fermenting.

FIG. 7: morphology of CA, monosaccharide composition and molecular weight. A is the solid form of visual CA; b is the solid state of CA observed by SEM; c is monosaccharide composition of CA; d is the molecular weight of CA.

FIG. 8: advanced structure and calorimetric analysis of CA. A is Congo red determination; b is CD spectrometry; c is atomic force microscope observation; d is dynamic light scattering measurement; and E is DSC measurement.

FIG. 9: effect of CA concentration, temperature, pH and salt on the shear viscosity of CA aqueous solutions. A is the influence of different CA concentrations on a CA flow curve, and the CA concentrations are 80, 60, 40, 30, 20, 10 and 1mg/mL from top to bottom; b is the influence of temperature on the CA flow curve, and the temperature range is 25-90 ℃; c is the effect of temperature on the CA flow curve; d is NaCl, KCl, CaCl₂And MgCl₂Effect on CA shear viscosity.

FIG. 10: viscoelastic curve of CA solution. A is the concentration of CA which is 20g/L respectively; b is the concentration of CA which is 40g/L respectively; the concentration of C is 60g/L of CA; d is the concentration of CA, and the concentration is 80g/L respectively.

Detailed Description

pTargetF, Escherichia coli str K-12MG1655 referred to in the following examples were purchased from: new England Biolabs (NEB).

The strains, culture and fermentation conditions referred to in the following examples are as follows:

table 1 describes the strains used in the present invention. Coli cells used for construction of vectors and mutants were cultured in LB medium. LB, LBG and M9 media supplemented with 18g/L agarose were used to identify CA synthesis. The CA fermentation medium consists of 15-30 g/L glucose and 35-45 g/L Na₂HPO₄·12H₂O，1～8g/L NH₄Cl，2～4g/L KH₂PO₄，2～4g/L NaCl，0.01～0.05g/L CaCl₂And 0.1-0.5 g/L MgSO₄. Kanamycin, spectinomycin, ampicillin, arabinose and isopropyl-beta-D-thiogalactopyranoside (IPTG) were at concentrations of 50mg/L, 100mg/L, 10mM and 0.5mM, respectively. To optimize CA medium, the mutants were cultured in 50mL of medium (250mL shake flasks) at 30 ℃ for 72h with shaking at 200rpm, starting OD₆₀₀Is 0.02.

TABLE 1 bacterial strains and vectors used in the present invention

(2) Construction of vectors and mutants

All primers used for vector and mutant construction are listed in table 2. Deletion of hns and lon genes from MG 1655. delta. (L-Q) using the Crispr-Cas9 method produced mutant WQM 003. The upstream fragments of hns and lon were amplified with primers F1-hns/lon and R1-hns/lon, and the downstream fragments were amplified with primers F2-hns/lon and R2-hns/lon. The primers F1-hns/lon and R2-hns/lon were then used to overlap the upstream and downstream fragments to give donor DNA. pTargetF-hns/lon was amplified with primers F-sgRNA-hns/lon and R-sgRNA-hns/lon, respectively, and pTargetF-hns/lon was substituted for the original N20 sequence using pTargetF as a template, and the underlined sequence in Table 2 was the new N20 sequence. The new vector fragment was then purified by gel extraction kit and chemically transformed into E.coli DH 5a, and the correct vector was selected by sequencing with the primers T-hns/lon-F and T-sgRNA-R. Subsequently, the donor DNA and pTargetF-hns/lon were used to knock out the hns and lon genes. To construct pRSF-P₂₀-rcsA-P₂₀-galU by primer F-P₂₀-rcsA-BamHI/R-rcsA-SacI and F-P₂₀galU-SacI/R-galU-XhoI amplification of rcsA and galU genes. Thus, rcsA and gaThe lU gene has strong P₂₀Promoter (AATACTTGACATATCACTGTGATTCACATATAATATGCG), SD sequence (AAATCAGAAGAGTATTGCTA) and underlined restriction enzyme sites in Table 2, then, amplified rcsA and galU were digested with BamHI/SacI and SacI/XhoI, and pRSFDuet-1 was digested with BamHI/XhoI. Passing the three fragments through T₄DNA ligase ligation and chemical transformation into WQM003 and by primer F-P₂₀Sequencing with-rcsA-BamHI and R-galU-XhoI selected the correct vector.

TABLE 2 primers used in the present invention

The characterization of the properties of the CA involved in the following examples is as follows:

(1) solid form of CA

Images of solid CA samples were collected by high quality camera and Scanning Electron Microscope (SEM).

(2) Monosaccharide composition of CA

To resolve the monosaccharide composition of CA, 50mg of purified CA powder was added to 7.5mL of 72% H₂SO₄And left at 121 ℃ for 3 h. Then, the pH of the acidolysis solution was adjusted to 7.0 and diluted appropriately so that the final concentration of CA was 50 mg/L. The samples were analysed by high pressure ion exchange chromatography using a pulsed amperometric detector and a CarboPac PA20 column (3 mm. times.150 mm). The mobile phase elution conditions were 97.4% water and 2.6% NaOH (250mM), 0min to 21 min; 92.4% -77.4% water, 2.6% NaOH (250mM) and 5% -20% NaAc (1M) from 21.1min to 30 min; 20% water and 80% NaOH (250Mm) from 30.1min to 50min at a flow rate of 0.5 mL/min.

(3) Molecular weight of CA (MW)

The MW.CA content, sample size, column temperature, mobile phase and flow rate of purified CA were measured on a Waters 1525 size exclusion chromatograph equipped with a 2410 refractive index detector (and an Ultrahydrogel Linear column) at 50g/L, 20. mu.L, 45 ℃, 0.1M NaAc, and 0.9mL/min, respectively.

(4) Congo Red assay

The congo red method identifies polysaccharides having triple-helical structures by monitoring the red shift of the maximum absorption wavelength.

A CA solution (2mL, 20g/L) was mixed with Congo red solutions (2mL, 80. mu. mol/L) prepared with NaOH of different concentrations (2mL, 80. mu. mol/L), the concentration of NaOH was from 0mol/L to 0.5mol/L, 2mL, 80. mu. mol/L Congo red solutions were prepared using NaOH solutions of concentration gradient from 0mol/L to 0.5mol/L, and 2mL, 20g/L of CA solution was mixed with the above 2mL, 80. mu. mol/L Congo red solutions. A full wavelength scan was taken of 150. mu.L of the mixture and the maximum absorption wavelength was recorded. Distilled water was used as a control instead of CA.

(5) Circular Dichroism (CD) spectrum

The CA structure was further studied on a circular dichroism spectrum (Jasco J-1700, Tokyo, Japan). The circular dichroism spectrum of the CA aqueous solution (20g/L) is measured at 25 ℃ and 190-250 nm. The results were analyzed by dichrobe circular dichroism online analysis software.

(6) Atomic Force Microscope (AFM)

The surface morphology of the CA was observed using an atomic force microscope and a commercial RTESP antimony doped silicon probe. mu.L of aqueous CA solution (20g/L) was placed on the cut mica plates and air-dried at room temperature for 12 h. Atomic force microscope images were analyzed using the NanoScope analysis 1.9 software.

(7) Dynamic Light Scattering (DLS)

To obtain the hydrodynamic radius of CA in water, dynamic light scattering was performed at 25 ℃ on an ALV/CGS-3 compact goniometer using a He-Ne laser.

(8) Differential Scanning Calorimetry (DSC)

Pyris DSC8500 with thermal analyser for the calorimetry of CA. The freeze-dried CA was placed in an aluminum pan and another empty aluminum pan served as a control, which was heated from 50 ℃ to 300 ℃ at a heating rate of 10 ℃/min and scanned under nitrogen.

(9) Rheological Properties of CA

All rheological properties of the CA were measured on a Physica-MCR302 rheometer equipped with a double-slit cup (external diameter 26.7mm, pore diameter 24.7mm, length 40mm)Amount of the compound (A). To test the effect of CA concentration on viscosity, aqueous solutions of purified CA (5, 10, 20, 30, 40, 60, and 80g/L) were prepared at various concentrations and at 25 ℃ for 1s^-1To 1000s^-1At a shear rate of (c). Also at 100s^-1At a shear rate of 25 ℃ to 90 ℃ and a heating rate of 6 ℃/min, the viscosities of purified CA aqueous solutions of different concentrations were investigated. Effect of different pH values on CA viscosity at 25 ℃ for 1s^-1To 1000s ^-120g/L CA in water at different pH values (5.0, 6.0, 7.0, 8.0, 9.0) were tested at shear rates of (2). The MCR302 rheometer also measures NaCl, KCl and CaCl₂And MgCl₂(50g/L and 100g/L) on the viscosity of a20 g/L aqueous CA solution. The shear rate at 25 ℃ is 1 to 1000s^-1. Furthermore, the dynamic viscoelastic behavior at different CA concentrations (80, 60, 40, 20g/L) was performed at 15 ℃, 0.8% strain and an angular frequency range of 0.1rad/s to 100 rad/s.

The methods for identification, purification and quantitative detection of CA involved in the following examples are as follows:

the Escherichia coli cells are cultured for 48h at 30 ℃ or 37 ℃ in M9, LB and LBG solid agarose medium, then Escherichia coli single colonies are fixed, magenta staining, tannin mordant staining and methylene blue staining are sequentially carried out, the CA amount is identified under a bright field microscope, and the more blue in a field indicates that the more CA is synthesized. L-fucose is an important oligosaccharide component in CA, and the yield of CA can be calculated by detecting fucose by an improved Dische colorimetry. The CA medium (500. mu.L) was boiled for 20min to inactivate E.coli cells and to dissolve the CA polymer, and centrifuged at 12000rpm for 5min to remove E.coli cells. The supernatant (200. mu.L) was mixed with ethanol (800. mu.L) and CA was precipitated at 4 ℃ for 4 h. Then centrifuged at 12000rpm for 5min and baked at 55 ℃ for 2h to obtain a CA crude sample. CA aqueous solution (100. mu.L) and 450. mu.L of 87% H₂SO₄Mix and heat for 15 min. After cooling to room temperature, the absorbance of the mixture was measured at 396nm and 427nm as A₃₉₆Subtract A₄₃₀As a control, the name A_(396-430)1. Subsequently 5.45. mu.L cysteine hydrochloride was added and the absorbance was measured again at 396nm and 430nm, A₃₉₆Subtract A₄₃₀Is marked as A_(396-430)2(ii) a Record A_(396-430)2Subtract A_(396-430)1And the concentration of L-fucose was calculated using a standard curve, and the concentration of CA was derived from the level of L-fucose. In order to accurately reveal the characteristics of CA, the crude CA sample obtained in the above-mentioned method needs to be further purified by means of nuclease hydrolysis, protease hydrolysis and dialysis, and finally the purified CA is prepared by means of freeze-drying method.

The media involved in the following examples are as follows:

m9 medium: 4g/L Glucose, 17.1g/L Na2HPO4 & 12H2O, 3g/L KH2PO4, 1g/L NH4Cl, 0.24g/L MgSO4, 0.5g/L NaCl, and 0.011g/L CaCl 2.

LB medium: 5g/L yeast powder, 10g/L peptone, and 10g/L NaCl.

LBG medium: 5g/L yeast powder, 10g/L peptone, 10g/L NaCl and 4g/L glucose.

Example 1: screening of starting strains producing high yields of clavulanic acid

By knocking out the waaF gene in E.coli W3110 or the waaL-waaQ gene cluster in MG1655, CA production can be effectively promoted, resulting in truncation of LPS core polysaccharide (as shown in FIG. 1A). The invention compares the CA yield of W3110 delta waaF and MG1655 delta (L-Q), selects the strain with high CA as the initial strain to further optimize and modify. The method comprises the following specific steps:

(1) construction of MG 1655. delta. (L-Q) Strain, according to the method in SCI paper (Wang C H, Zhang H L, Wang J L, et al, analytical acid biosynthesis in Escherichia coli dependent on lipid polysaccharide structure and glucose availability, microbiological Research,2021.243.), gene knock-out was performed on Escherichia coli using CRISPR/Cas9 knock-out system, first the Escherichia coli K-12MG1655 was electroporated with pCas9 plasmid, and recombinase Gam, Bet, and Exo expression was induced by L-arabinose. The homology arm fragments (primer sequences are shown in Table 2) and pTargetF plasmid containing the specific N20 sequence were then simultaneously transfected into MG1655/pCas9 competent cells. Resistant plates were spread and cultured at 30 ℃ for 18 hours, and colonies were PCR-selected for deletion of waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG, and waaQ genes to prepare MG 1655. delta. (L-Q) strain.

(2) Construction of W3110. DELTA.waaF Strain

According to the method in the SCI paper (Ren G, Wang Z, Li Y, et al. effects of lipopolyparaccharide core specificity on microbial acid biosynthesis pathway in Escherichia coli [ J ]. Journal of Bacteriology 2016.198: 1576. 1584.), gene deletion was performed on Escherichia coli W3110 using CRISPR/Cas9 deletion system, and pCas9 plasmid was first electroporated into Escherichia coli W3110 to induce expression of recombinases Gam, Bet, and Exo by L-arabinose. The homology arm fragments (primer sequences are shown in Table 2) and pTargetF plasmid containing the specific N20 sequence were then simultaneously electroporated into W3110/pCas9 competent cells. The resistant plate was coated and cultured at 30 ℃ for 18 hours, and then the waaF gene-deleted strain was screened by colony PCR to prepare W3110. delta. waaF strain.

The CA contents of MG 1655. delta. (L-Q) and W3110. delta. waaF were measured after fermentation for 48 hours by culturing MG 1655. delta. (L-Q) and W3110. delta. waaF in M9 medium at 30 ℃ and 200rpm, respectively (FIG. 2A), and the results were: 0.371g/L and 0.248g/L, which are respectively improved by 3.48 and 2.32 times compared with the wild type, and the yield of CA of the wild type is only 0.11 g/L. The CA production of MG 1655. delta. (L-Q) in M9 medium was higher than that of W3110. delta. waaF, indicating deletion of the waaL-waaQ gene cluster, i.e.: only two heptoses remained in the core polysaccharide, which was more effective in promoting CA synthesis (fig. 1A). Therefore, MG 1655. delta. (L-Q) was selected as a starting strain to optimize and engineer for increased CA production.

Example 2: construction of high-yield clavulanic acid strain

The activator RcsA was degraded and inhibited by Lon and HNS proteins in MG1655 Δ (L-Q) (as shown in fig. 1C). Therefore, it is necessary to knock out the lon and hns genes from the MG 1655. delta. (L-Q) genome.

The method comprises the following specific steps:

1. construction of WQM001 Strain

The lon gene on the MG1655 delta (L-Q) strain genome prepared in example 1 is knocked out, the specific method is the same as example 1, the CRISPR/Cas9 knock-out system is adopted to knock out the gene of the Escherichia coli MG1655 delta (L-Q) strain, firstly, the Escherichia coli MG1655 delta (L-Q) strain is electrically transferred into pCas9 plasmid, L-arabinose is added to induce recombinase Gam, Bet and Exo to express, and the MG1655 delta (L-Q)/pCas9 strain is obtained

Respectively amplifying an upstream homology arm and a downstream homology arm of the knockout lon gene by using an Escherichia coli MG1655 genome as a template and F1-lon/R1-lon and F2-lon/R2-lon, and then carrying out overlap PCR by using the upstream and downstream homology arms as the template and F1-lon and R2-lon primers to amplify to obtain a homology arm fragment of the knockout lon.

The plasmid ptargetF-lon was used as a template, and a linear pTargetF-lon fragment was obtained by reverse PCR amplification using F-sgRNA-lon and R-sgRNA-lon primers, and then transformed into Escherichia coli JM109 to construct a circular pTargetF-lon plasmid.

The lon-knock-out homologous arm fragment (primer sequences are shown in Table 2) and pTargetF-lon plasmid were simultaneously transfected into MG 1655. delta. (L-Q)/pCas9 competent cells. Coating a kanamycin and spectinomycin double-antibody plate, culturing at 30 ℃ for 18h, then carrying out colony PCR screening on lon gene deletion strains, and carrying out sequencing verification. The correct strain was verified and the pTargetF-lon plasmid was removed by addition of IPTG followed by overnight culture at 42 ℃ to remove the pCas9 plasmid. Finally, a mutant strain WQM001 lacking the lon gene was obtained.

2. Construction of WQM003 Strain

Knocking out hns genes on the WQM001 strain genome prepared in the step 1, specifically knocking out genes of the Escherichia coli WQM001 strain by using a CRISPR/Cas9 knocking-out system in the same way as in the example 1, firstly, electrically transferring pCas9 plasmids into the Escherichia coli WQM001 strain, and inducing recombinase Gam, Bet and Exo expression by L-arabinose.

The upstream and downstream homology arms of the hns gene were knocked out by amplifying F1-hns/R1-hns and F2-hns/R2-hns respectively using the E.coli MG1655 genome as a template. Then, the upstream and downstream homology arms were used as templates, and F1-hns and R2-hns primers were used to perform overlap PCR, thereby amplifying the fragments of homology arms from which hns genes were knocked out.

A linear pTargetF-hns fragment was obtained by reverse PCR amplification using F-sgRNA-hns and R-sgRNA-hns primers using ptargetF plasmid as a template, and transformed into a circular pTargetF-hns plasmid of Escherichia coli JM 109.

The homology arm fragment and pTargetF plasmid containing the specific N20 sequence were then simultaneously electroporated into WQM001 strain/pCas 9 competent cells. And coating a resistant plate, culturing at 30 ℃ for 18h, then carrying out colony PCR screening on hns gene deletion strains, and carrying out sequencing verification. The correct strain was verified and the pTargetF-hns plasmid was removed by addition of IPTG followed by overnight culture at 42 ℃ to remove the pCas9 plasmid. Finally, the hns gene-deleted mutant WQM003 was obtained.

3. WQM001 and WQM003 were cultured in M9 medium at 30 ℃ and 200rpm, respectively, and after fermentation for 48 hours, the CA content of WQM001 and WQM003 were measured (FIG. 2B), respectively, and the results were: 0.68g/L and 0.9g/L, the CA production of WQM001 was 1.82 times that of MG1655 Δ (L-Q), and the CA production of WQM003 was 2.43 times that of MG1655 Δ (L-Q), thus demonstrating the effectiveness of increasing CA production by reducing degradation and inhibition of RcsA.

4. To further increase CA production, key genes in the CA biosynthetic pathway galU and rcsA, in P₂₀Overexpression was performed by a strong promoter, and a pRAU plasmid was constructed (FIG. 3). The method comprises the following specific steps:

(1) construction of pRAU plasmid

Use of the primer F-P₂₀Amplification with P-rcsA-BamHI and R-rcsA-SacI (primer sequences shown in Table 2)₂₀A strong promoter, Shine-Dalgarno (SD) sequence and an rcsA fragment of the cleavage site (BamHI and SacI)₂₀The strong promoter sequence is: 5'-AATACTGATCATACTGTGATCATATATATATATAGCG-3', SD the sequence is: 5'-AAATCAGAGAGAGTATTGCTA-3' are provided.

Use of the primer F-P₂₀Amplification of P-containing primers-galU-SacI and R-galU-XhoI (primer sequences shown in Table 2)₂₀A galU fragment of a strong promoter, Shine-Dalgarno (SD) sequence and cleavage sites (SacI and XhoI), the above P₂₀The strong promoter sequence is: 5'-AATACTGATCATACTGTGATCATATATATATATAGCG-3', SD the sequence is: 5'-AAATCAGAGAGAGTATTGCTA-3' are provided.

The rcsA fragment was digested with BamHI and SacI, galU with SacI and XhoI, vector pRSFDuet-1 with BamHI and XhoI, purified separately and then treated with T₄The three DNA fragments were ligated by DNA ligase to construct a recombinant vector pRAU, which was verified by sequencing using the primers F-P20-rcsA-BamHI and R-galU-XhoI.

(2) Construction of WQM003/pRAU Strain

And (2) electrotransfering the pRAU plasmid prepared in the step (1) into the WQM003 strain prepared in the step (2) to prepare a WQM003/pRAU strain.

WQM003/pRAU was added to M9 medium and cultured at 30 ℃ and 200rpm for 48 hours, and the CA content in the fermentation broth was measured, and the results were: 1.58 g/L.

The CA production of WQM003/pRAU was increased 4.24-fold as compared with that of the original strain MG 1655. delta. (L-Q) (0.371 g/L).

5. Confirmation of extracellular polysaccharide (CA) production

In order to visually show the modification effect, the invention carries out exopolysaccharide tannin mordanting and exopolysaccharide (CA) dyeing at 30 ℃ and 37 ℃ so as to verify the synthesis of CA in M9, LB and LBG culture media at 30 ℃ and 37 ℃ (the result is shown in figure 4).

Extracellular polysaccharide (CA) of WQM003/pRAU was higher than MG 1655. delta. (L-Q) at 30 ℃ or 37 ℃ in M9 medium;

in LB medium, WQM003/pRAU also synthesized small amounts of exopolysaccharide (CA) at 30 ℃ or 37 ℃ while MG 1655. delta. (L-Q) did not synthesize exopolysaccharide CA.

In LBG medium, MG 1655. delta. (L-Q) and WQM003/pRAU synthesized extracellular polysaccharide at either 30 ℃ or 37 ℃, but it was clear that WQM003/pRAU synthesized more extracellular polysaccharide.

Overall, WQM003/pRAU synthesized more exopolysaccharides at different temperatures and in different media, and most strains formed more exopolysaccharides when cultured in M9 medium at 30 ℃.

Example 3: CA medium composition and fermentation condition optimization

1. Single factor experiment to optimize media composition

As can be seen from the results of exopolysaccharide staining in step 5 of example 2, the medium composition significantly affected exopolysaccharide production, and WQM003/pRAU produced the highest amount of exopolysaccharide when cultured at 30 ℃ in M9 medium compared with LB and LBG media. Therefore, medium optimization was performed in M9 medium. Investigating carbon source, nitrogen source and phosphoric acid by adopting single-factor test methodEffect of salt and NaCl on CA production to determine approximate variable ranges. Experiment by studying 4g/L glucose, 4g/L fructose, 4g/L galactose, 4g/L mannose and 4g/L sucrose, to select the best carbon source for CA biosynthesis; likewise, the optimum nitrogen source is selected from the group consisting of 10g/L NH₄Cl, 10g/L peptone, 10g/L yeast extract and 1g/L corn steep liquor powder; wherein the glucose and KH₂PO₄、Na₂HPO₄·12H₂O, NaCl can be varied in the range of 1-50 g/L, 3-9 g/L, 17.1-51.3 g/L and 0.5-1.5 g/L. In each single factor experiment, one factor was changed and the other factors were kept constant.

The method comprises the following specific steps:

(1) selection of carbon sources

Changing the carbon source in the M9 culture medium from glucose to fructose, galactose, mannose and sucrose respectively, with constant concentration and constant other components and content, inoculating WQM003/pRAU into culture medium containing different carbon sources, and culturing at 30 deg.C and 200rpm for 48h, with the results shown in FIG. 5A;

the carbon sources (glucose, fructose, galactose, mannose and sucrose) involved in CA biosynthesis were screened for CA production by WQM003/pRAU, and the results showed that CA production was highest in M9 medium when the carbon source was glucose (fig. 5A).

The optimal concentration of glucose was 20g/L as shown in FIG. 5B, when WQM003/pRAU was inoculated into glucose-containing media of different concentrations and cultured at 30 ℃ and 200rpm for 48 hours while changing the glucose concentration in M9 medium to 1g/L, 4g/L, 10g/L, 20g/L, 30g/L, 40g/L and 50g/L, respectively, and the other components and contents were not changed.

(2) Selection of Nitrogen Source

M9 minimal medium has no organic nitrogen source, so the CA mutant grown in M9 medium must synthesize some necessary substrates, which limits cell growth and increases incubation time.

Organic nitrogen sources (10g/L peptone, 10g/L yeast extract and 10g/L corn steep liquor powder) were respectively added directly to M9 medium and cultured at 30 ℃ and 200rpm for 48 hours, and the results are shown in FIG. 5C;

no matter what organic nitrogen source is added to the M9 medium, CA production is not favored. Therefore, NH is still employed₄Cl was used as a nitrogen source, and the concentration was temporarily in accordance with that of M9 medium.

The RCS system is responsible for complex multistep phosphate cascade signaling, and the concentration of phosphate in the medium can significantly affect the regulation of the RCS system.

Respectively adding KH in M9 culture medium₂PO₄The concentrations of (A) were adjusted to 3g/L, 6g/L and 9g/L, and the other components and contents were unchanged, and it was found that the CA production gradually decreased with the increase in the concentration of potassium dihydrogen phosphate, and the optimum addition amount was 3g/L (FIG. 5D).

In KH₂PO₄Adjusting Na on the basis of the concentration of 3g/L₂HPO₄·12H₂The O concentrations were 17.1g/L, 34.2g/L, 51.2g/L, and other components and contents were unchanged, and the results showed Na₂HPO₄·12H₂The optimum concentration of O was 34.2g/L (FIG. 5E).

In KH₂PO₄The concentration is 3g/L, Na₂HPO₄·12H₂On the basis that the O concentration is 34.2g/L, the NaCl concentrations are respectively adjusted as follows: 0.5g/L, 1.0g/L, and 1.5g/L, and other components and contents were unchanged, and the results showed that the optimum concentration of NaCl was 1.5g/L (FIG. 5F).

2. Plaket-Burman (PB) design for screening for significant changes in CA production

The experimental design scheme for PB is as follows:

the PB test design is an experimental method for screening out significant influence factors from a plurality of variables according to experimental results, and can estimate main factors as accurately as possible with the minimum number of tests. Minitab19.1 (64 bit) software was used for PB design and data processing. PB from 2 replicates and 24 runs of 7 components of M9 medium was designed to screen for major media components affecting CA production (tables 3-4).

TABLE 3 real values of variables in Plackett-Burman design

TABLE 4 Plackett-Burman design and yield of CA

The PB experimental design and regression analysis results are shown in fig. 6A and table 5. A (glucose) and C (Na)₂HPO₄·12H₂O) is greater than the T limit in the normalized pareto chart (2.12) (FIG. 6A), A (glucose) and C (Na)₂HPO₄·12H₂O) was less than 0.05 (table 5), from which it can be seen that these two factors have a significant effect on CA yield. The concentrations of the other 5 non-significant factors were averaged between the level (-1) and the level (+1), NH, in Table 3₄Cl(1g/L)、KH₂PO₄(3g/L)、NaCl(3g/L)、CaCl₂(0.014g/L)、MgSO₄(0.3 g/L). From the regression results, A (glucose) negatively affected CA production and C (Na)₂HPO₄·12H₂O) had a positive effect on CA production (Table 5). This indicates that high concentrations of A (glucose) are detrimental to CA synthesis, while high concentrations of C (Na)₂HPO₄·12H₂O) has a positive effect on the synthesis of CA. In addition, glucose and Na₂HPO₄·12H₂The concentration of O will be optimized in the steepest hill climb and CCD experiments.

3. Steepest climbing experimental design

And designing a steepest climbing experiment according to the PB experiment result, and determining the central point of the central combination design. Glucose showed a negative effect, while Na₂HPO₄·12H₂O showed a positive effect on CA production (table 5). Thus, the glucose concentration decreases with a fixed gradient, Na₂HPO₄·12H₂The O concentration increases with a fixed gradient. The residual factor concentrations were determined from the PB experiments (Table 6), glucose and Na₂HPO₄·12H₂Optimum of OThe concentration range was determined by the yield of CA.

Regression results for the PB design in Table 5

Significant at P values < 0.05; significant at P value <0.01

TABLE 6 experimental design and results of steepest ascent method

As shown in FIG. 6B, CA production increased gradually with increasing or decreasing concentration of the influencing factor. When the concentration of the glucose is 20g/L or 22g/L, Na₂HPO₄·12H₂The CA production reached the highest value at an O concentration of 34g/L or 38 g/L. Subsequently, CA production decreased as the concentration of the influencing factor continued to change. Thus, the experiments were performed at an average concentration of glucose 21g/L and Na₂HPO₄·12H₂O36 g/L was the center point to optimize the CCD experiment.

4. CCD optimization of glucose and Na₂HPO₄·12H₂O concentration to maximize CA production

The response surface optimization method is a comprehensive mathematical and statistical method, and the influence of multiple factors on indexes is evaluated by using fewer experiments. As a response surface design, CCDs have been successfully applied in a multi-aspect optimization process. The invention uses glucose and Na₂HPO₄·12H₂Two significant factors of O are independent variables and the levels of each factor are shown in table 7. Table 8 lists the experimental design of a CCD with two blocks. CCD design and data processing were performed using Minitab19.1 (64 bit) software.

TABLE 7 actual values of CCD arguments

TABLE 8 Experimental design and results of CCD vs. CA production

With glucose and Na₂HPO₄·12H₂Two significant factors O are independent variables, the levels of the factors are shown in Table 7, and the experimental design and the results of the CCD are shown in Table 8; the model F value is 12.06, the P value is 0.002 (< 0.05), and the determinant coefficient (R2) is 0.9118, which indicates that the model item is significant; "mismatching F value" of 3.97 (> 0.05) means that mismatching errors are not significant relative to pure errors; therefore, the quadratic model fits well, resulting in the following regression equation:

Y＝-19.80+1.344A+0.462C-0.03123A*A-0.00572C*C-0.00014A*C。

the 2D and 3D response surface plots were plotted based on the regression equation (fig. 6C). Glucose and Na₂HPO₄·12H₂The cross contour plot of O is approximately circular, and CA production is a function of glucose and Na₂HPO₄·12H₂The increase in O concentration increases first and then decreases; glucose and Na₂HPO₄·12H₂P value for O interaction was 0.974, greater than 0.05, interaction was not significant (table 9); response surface results were consistent with analysis of variance (ANOVA) results; maximizing CA production was predicted by the response optimizer of Minitabb 19.1; when glucose and Na₂HPO₄·12H₂The predicted yield of CA was highest (12.52g/L) at O levels of 21.47g/L and 40.2g/L, respectively; the final optimized medium for CA production was 21.47g/L glucose, 1g/L NH₄Cl，40.2g/L Na₂HPO₄·12H₂O，3g/L KH₂PO₄，3g/L NaCl，0.014g/L CaCl2，0.24g/L MgSO₄。

The optimized medium was used to verify its effectiveness for CA production. The CA yield measured by the experiment is 12.47g/L, which is equivalent to the statistical predicted value of 12.52g/L, and the error range is 0.17 g/L; this demonstrates the effectiveness and accuracy of the CA media after CCD optimization. To date, CA production was 33.58-fold increased compared to E.coli MG 1655. delta. (L-Q) production (0.371g/L) without metabolic engineering and media optimization.

TABLE 9 CCD regression results analysis

*R²＝0.9122

According to the steps 1-4, the optimized culture medium formula is as follows: 15-30 g/L glucose, 35-45 g/L Na₂HPO₄·12H₂O，1～8g/L NH₄Cl，2～4g/L KH₂PO₄，2～4g/L NaCl，0.01～0.05g/L CaCl₂And 0.1-0.5 g/L MgSO₄。

Wherein the optimal culture medium is 21.47g/L glucose and 1g/L NH₄Cl，40.2g/L Na₂HPO₄·12H₂O，3g/L KH₂PO₄，3g/L NaCl，0.014g/L CaCl₂，0.24g/L MgSO₄。

5. Optimization of 2.0L fermentation tank submerged fermentation process

The submerged fermentation process was optimized in a 2.0L fermentor.

The seed culture medium involved in the step is as follows: LB culture medium;

the fermentation medium is as follows: 21.47g/L glucose, 1g/L NH₄Cl，40.2g/L Na₂HPO₄·12H₂O，3g/L KH₂PO₄，3g/L NaCl，0.014g/L CaCl2，0.24g/L MgSO₄。

(1) Optimization of inoculum size

The WQM003/pRAU strain prepared in example 2 was inoculated into the seed medium and cultured at 37 ℃ and 200rpm for 12 hours to prepare a seed solution;

respectively preparing the seed liquid according to OD₆₀₀Inoculating the strain into a fermentation culture medium according to the proportion of 0.02, 0.08, 0.14 and 0.2, culturing for 72 hours at the temperature of 30 ℃ and the pH value of 7, starting dissolved oxygen automatic control, controlling the dissolved oxygen level to be not less than 30%, and respectively detecting the content of CA in a culture solution after the fermentation is finished, wherein the results are respectively as follows: 12.55g/L, 13.79g/L, 9.57g/L and 7.51 g/L.

(2) Optimization of pH

Respectively using the seed liquid prepared in the step (1) according to OD₆₀₀Inoculating the strain into a fermentation medium according to the proportion of 0.08, culturing for 72 hours at the temperature of 30 ℃ under the conditions that the pH value is 6.0-7.0 and the pH value is not controlled, starting a dissolved oxygen self-control mode, keeping the dissolved oxygen level to be not lower than 30%, and respectively detecting the content of CA in a culture solution after the fermentation is finished, wherein the results are respectively as follows: 19.79g/L and 14.09 g/L.

The inoculum size and pH of the CA fermentations were tested in a four-way fermentor based on the optimal fermentation medium. The optimum inoculum size was 0.08 (FIG. 6D), and the pH was not lower than 6.0 (FIGS. 6E and 6F).

The results show that optimization of the fermentor greatly increased the yield of CA to 19.79 g/L.

The reason is that: on one hand, the viscosity of the fermentation liquid is increased (CA accumulation) to cause that the dissolved oxygen in the shake flask fermentation is low in the later period of the shake flask fermentation, so that the growth of low dissolved oxygen strains cannot be met, and the CA yield is low. When the culture medium is cultured in a fermentation tank, the problem of insufficient dissolved oxygen caused by viscosity rise is solved at high rotating speed, and the culture medium is more favorable for cell growth and CA production; on the other hand, the pH needs to be kept at 6.0 during CA fermentation, under which conditions glucose can be completely consumed and completely converted to CA. Otherwise, the pH at the end of the fermentation may drop to 5.4, while glucose is still present, resulting in low CA production.

In conclusion, the invention enables the CA yield to reach 19.79g/L and the conversion rate to reach 92 percent by a series of effective measures such as constructing a mutant strain with high CA yield, optimizing a culture medium, optimizing a fermentation process and the like, and the CA yield is improved by 53.25 times compared with the CA yield (0.37g/L) of the original strain MG1655 delta (L-Q). The CA yields of the present invention are currently the highest compared to the known literature.

Example 4: CA characterization

1. Identification, structural and thermal Properties of CA

After the CA supernatant is purified and freeze-dried, a CA solid sample of 18.18 +/-0.57 g/L is obtained, and the recovery rate is 91.86 +/-2.88%. Upon visual inspection, the lyophilized CA resembled a napkin shred (FIG. 7A). SEM observations showed that the CA solid samples aggregated into bundles (wires) and existed in filamentous or broad fiber shapes (fig. 7B).

It is reported that CA is composed of repeating polymeric units consisting of D-galactose, L-fucose, D-gluconic acid and D-glucose. To verify that the purified polymer of the present invention is indeed CA, the monosaccharide composition of the polymer was examined. As shown in fig. 5C, the purified polymer is composed of four monosaccharides, all of which are strongly correlated with the composition of CA. Furthermore, the average MW of CA is about 485X 10⁶Daltons (fig. 7D), much larger than most reported exopolysaccharides.

In addition, the present invention also analyzes the high-level structure of CA. Congo red is an acidic high molecular dye, and can form a stable complex with polysaccharide with triple helix conformation under the action of strong hydrogen bond or hydrophobic effect under the action of sodium hydroxide with a certain concentration, then the maximum absorption wavelength of the complex moves to long wavelength, and when the concentration of the sodium hydroxide is continuously increased, the hydrogen bond between molecules is broken, and the maximum absorption wavelength is rapidly reduced. As shown in FIG. 8A, the maximum absorption wavelength increased at a sodium hydroxide concentration of 0-0.05mol/L, indicating that CA can form a complex with Congo red and has a triple helix conformation. Then, the maximum absorption wavelength sharply decreased with the increase of the NaOH concentration, indicating that the CA helix structure was broken down into single strands, failed to form a complex with congo red, and became an irregular helix group form. Briefly, CA was initially judged to have an ordered triple-helical conformation.

In addition, the high-level structure was further explored using circular dichroism spectroscopy (fig. 8B). It can be seen that the negative effects of CA in aqueous solution at 200-221nm indicate that CA has chiral and triple helical conformation in aqueous solution. The triple helix conformation of CA was analyzed by dichroweb to be 15.15 ± 0.15%. The triple helix conformation is usually biologically active and the pharmacological activity of CA is therefore to be studied further. In addition, different chain conformations of polysaccharides in solution often exhibit different biological activities. The chain conformation of CA in aqueous solution was further investigated by atomic force microscopy and dynamic light scattering. As shown in the atomic force microscope image (fig. 8C), CA exhibited a spherical chain conformation in an aqueous solution, and the average particle diameter was 286.44 nm. The dynamic light scattering results showed that the average particle size of CA in the aqueous solution was 0.094nm and 222.7nm, accounting for 0.13% and 99.87%, respectively (fig. 8D). The average particle size of 0.094nm may be due to the single-stranded triple-helix conformation of a small amount of CA present in aqueous solution.

Thermal analysis is widely used to characterize the thermal, physical and stability properties of materials and is very important for quality control in material development and production. In this study, DSC was performed to reveal the thermal properties of CA (fig. 8E). The heat flux does not change much from 30 ℃ to 102 ℃, indicating that the CA is in a solid-solid transition or bound water loss stage. When CA is continuously heated, the heat flux curve rises, the CA generates glass transition, which shows that the CA structure is changed, and the glass transition temperature Tg is 123.52 ℃. With increasing temperature, the heat flux curve shows an endothermic peak, when the energy gained in the CA molecule is too much to maintain an ordered structure, the CA begins to melt, and the melting temperature Tm is 253.89 ℃. When the temperature was raised to 291.94 ℃, an endothermic peak appeared and CA began to decompose and gasify.

2. Rheological Properties of CA

CA is a natural high molecular polymer whose viscosity and associated rheological properties can have a significant impact on the development, stability, and design and selection of process equipment for new products. The rheological properties of carbohydrate polymers are influenced by a number of factors. In this study, the rheological properties of CA were studied.

FIG. 7A shows the effect of CA concentration on viscosity at 25 ℃. In 1 to 1000s^-1Within the shear rate range, the viscosity increases with increasing CA concentration. As the shear rate increases, the viscosity of the CA gradually decreases, indicating the shear-thinning flow behavior of the non-Newtonian fluid. The viscosity of the CA solutions of different concentrations gradually decreased, showing the shear thinning behavior of the non-Newtonian fluid. The viscosity curves of CA were fitted by Carreau model

Wherein eta is the shear viscosity of the polymer,

is the shear rate, λ is the relaxation time, η_∞Is the ultimate shear viscosity, η₀Is zero shear viscosity, n is the pseudoplasticity index, pseudoThe n-value of the plastic fluid is between 0 and 1 (spark J, Holland C. analysis of the pressure requirements for a bulk lubricating treated process J]Nature Communications, 2017.8.). Carreau model parameters are shown in Table 10, CA aqueous solution 0<n<1 is presumed to be a pseudoplastic fluid. Further, as the CA concentration increases, λ and η₀The higher the value, the lower the value of n, indicating that the higher the CA concentration, the higher the shear-thinning ability. This is probably because the orientation of the polymer molecular chains tends to converge with an increase in the shear rate, resulting in a decrease in the solution viscosity. Similar results have been reported (Xu J L, Zhang J C, Liu Y, et al, Rheological properties of a polysaccharide from flow polysaccharides in Huanggshan mountain [ J].Carbohydrate Polymers,2016.139:43-49.)。

TABLE 10 fitting parameters of Carreau model

Fig. 9B reveals the effect of temperature on the rheological properties of CA. The viscosity of the CA decreases rapidly with increasing temperature and the solution viscosity decreases more with increasing CA concentration. This may be due to reduced intermolecular interactions and reduced flow resistance. Therefore, the viscosity of CA can be reduced by properly increasing the temperature in industrial production, thereby effectively reducing the energy consumption of liquid pipeline transportation. Fig. 9C investigates the effect of pH on CA rheology, with CA viscosity being highest in a neutral environment (pH 7.0), and acidic or basic solutions decreasing CA viscosity. This is probably due to a change in electrostatic repulsion of the CA molecules, resulting in a conformational transition of CA with a corresponding decrease in viscosity. Therefore, the effect of pH on its viscosity and stability should be considered in CA applications. Figure 9D shows the effect of salt ion on CA rheology. The viscosity of the CA solution is dependent on NaCl, KCl, CaCl₂And MgCl₂Slightly increased and as the salt solution concentration increased, there was little change in the viscosity of the CA. The results show that CA has good tolerance to salt ions.

Studying the viscoelastic effect of polysaccharide solutions to determine whether the solution is viscous or elastic under given conditions can effectively control the viscoelastic effect of the solution in polysaccharide production and application. The viscoelastic strength of the polysaccharide solution can be reflected by the storage modulus G' and the loss modulus G ″. G 'may reflect the solid-like nature of the viscoelastic material and G' may reflect the liquid-like nature of the viscoelastic material. The loss factor tan δ G ″/G' more intuitively reflects the dynamic viscoelastic characteristics of the fluid. When tan δ >1, the sample is shown to behave as a viscous liquid; conversely, the sample tends to behave more as an elastic solid.

As shown in fig. 10, both the storage modulus and loss modulus of the CA solution increased with increasing CA concentration. When the CA concentration was 20G/L, G 'was always greater than G', tan. delta. >1, the CA solution was fluid (FIG. 10A); when the angular frequency was less than 1.98rad/s, G "> G', tan. delta. >1, 40G/L (FIG. 10B), 60G/L (FIG. 10C) and 80G/L of CA solution L (FIG. 10D) exhibited mainly gel characteristics. As the angular frequency continues to rise, G '< G', tan delta < 1, viscoelastic fluid properties are exhibited. When the CA concentrations were 40G/L, 60G/L, and 80G/L, respectively, G "and G" crossed, and the angular frequencies at the crossing points were 1.98rad/s, 8.02rad/s, and 29.7rad/s, respectively. This is probably due to the fact that the smaller the angular frequency, the longer the requirements on vibrational shear, and the more time the macromolecule has to change conformation, get rid of entanglement, and overtake each other. At this time, the elastic extension of the branched chain can be gradually recovered in the flow, so that the viscosity of the solution is dominant, and the elasticity is not significant. Although the angular frequency is high and the vibration shearing force action time is short, the elastic deformation energy is mostly stored in the system, so the elasticity is dominant.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. A recombinant Escherichia coli, wherein the recombinant Escherichia coli is characterized in that a lipopolysaccharide core polysaccharide synthesis gene cluster waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG and waaQ on a genome are knocked out, Escherichia coli with a Lon protein coding gene Lon and an HNS regulatory protein coding gene HNS knocked out is taken as a host cell, and a UTP-1-phosphoglucose uridyltransferase coding gene galU and a DNA binding transcription activator RcsA coding gene rcsA are overexpressed.

2. The recombinant escherichia coli of claim 1, wherein the NCBI accession numbers of the lipopolysaccharide core polysaccharide synthesis gene clusters waaL, waaU, waaZ, waaY, waaR, waaO, waaB, waaP, waaG, waaQ are, in order, 948148, 948147, 948146, 948145, 948142, 948143, 948144, 948150, 948149, 948155; the NCBI accession number for lon is 945085; the NCBI accession number of hns is 945829; the NCBI accession number of galU is 945730; the NCBI accession number for rcsA is 946467.

3. The recombinant Escherichia coli of claim 1 or 2, wherein the recombinant Escherichia coli has Escherichia coli str K-12MG1655 as a host cell.

4. The recombinant Escherichia coli of any one of claims 1 to 3, wherein pRSFDuet-1 is used as an expression vector.

5. A method for producing clavulanic acid by glucose fermentation is characterized by comprising the following steps: the recombinant Escherichia coli is prepared by fermentation of the recombinant Escherichia coli of any one of claims 1 to 4.

6. The method of claim 5, wherein the seed solution of the recombinant Escherichia coli is inoculated into a fermentation medium and fermented to produce clavulanic acid; wherein the fermentation medium comprises: 15-30 g/L glucose, 35-45 g/L Na₂HPO₄·12H₂O，1～8g/L NH₄Cl，2～4g/L KH₂PO₄，2～4g/L NaCl，0.01～0.05g/L CaCl₂And 0.1-0.5 g/L MgSO₄。

7. The method of claim 5 or 6, wherein the recombinant E.coli seed solution is inoculated in the fermentation medium at OD₆₀₀0.04 to 0.21.

8. The method according to any one of claims 5 to 7, wherein the seed solution of the recombinant Escherichia coli is inoculated into a fermentation medium under the following conditions: at 25-37 deg.C and 150-250 rpm.

9. Claritanic acid prepared by the process of any one of claims 5 to 8.

10. Use of the recombinant Escherichia coli of any one of claims 1 to 4 in the preparation of a product containing clavulanic acid.