CN113736793B

CN113736793B - NAC transcription factor gene VaNAC08 and application thereof

Info

Publication number: CN113736793B
Application number: CN202110791138.8A
Authority: CN
Inventors: 王泽民; 晋昕; 杨江伟; 司怀军; 梁振昌
Original assignee: Gansu Agricultural University
Current assignee: Gansu Agricultural University
Priority date: 2021-07-13
Filing date: 2021-07-13
Publication date: 2023-12-12
Anticipated expiration: 2041-07-13
Also published as: CN113736793A

Abstract

The application provides a grape NAC transcription factor gene VaNAC08 and application thereof. Specifically provides NAC08 sequence of NAC transcription factor gene of wild grape seed and cultivated grape seed 'rose scent', NAC08 cloning method of NAC transcription factor gene and verifies the function of the gene, further determines the application of the gene in regulating soluble glucose of grape cells, improving low temperature tolerance of grape cell membranes and finally improving cold resistance of grape.

Description

NAC transcription factor gene VaNAC08 and application thereof

Technical Field

The application belongs to the fields of germplasm resource cultivation and molecular biology, and particularly relates to an NAC transcription factor gene VaNAC08 and application thereof.

Background

Grape (grape vinifera l.) is a perennial deciduous vine of the genus Vitis of the family vitiaceae, which is the earliest domesticated fruit crop for humans, and has a long cultivation history in our country, and the lengthy domestication process has started as early as 8000 years ago. Grape is the second largest fruit tree crop in the world, is widely used for fresh food, brewing, drying and the like, and has important economic value. Data from the international grape wine bureau (OIV) in 2019 shows that China currently has a plantation area of 847 kilohectares for vineyards, and grape yield reaches 1366.7 kilotons. The grape industry in China has an important role internationally, and in recent years, the cultivation area and the yield are increased year by year.

The transcription factor interacts with DNA sequence to regulate gene expression and regulation at transcription level, and is one key step in gene expression and regulation, and its structural diversity determines the diversity of expression and regulation functions. Plays an important role in regulating the growth and development of plants and responding to biotic or abiotic stress. At the same time, this is also a signaling network, with some crossovers between signaling pathways, forming multiple combinations of regulatory factors. About 7% of the genes encoding plants are transcription factors, and studies have found that most of these genes respond early in biotic and abiotic stress. NAC transcription factors are a family of proteins that have a variety of biological functions during plant growth and development. NAC family transcription factors not only regulate the growth and development of plants, but also play an important role in the processes of plant adversity stress (biotic or abiotic stress) response and the like, and cold resistance of NAC transcription factors in grapes is reported.

Problems of the prior art: the application aims to provide theoretical and technical basis for excavating and utilizing gene resources and promoting cold-resistant cultivation of grapes.

Disclosure of Invention

The key technical problem to be solved by the application is to provide an NAC transcription factor gene VaNAC08 and application thereof. In order to solve the technical problems, the application adopts the following technical scheme:

1. grape NAC transcription factor gene NAC08, and the CDS sequence of NAC transcription factor gene NAC08 is shown in sequence table SEQ ID NO. 1.

2. Application of grape NAC transcription factor gene NAC08 in regulating cold resistance of grape is provided.

3. The application of grape NAC transcription factor gene NAC08 in raising grape cold resistance is realized through over expression of the NAC08 gene.

Application of NAC transcription factor VaNAC08 in improving soluble glucose of grape cells

Under normal conditions, the content of soluble sugar in the over-expression cell line and the content of soluble sugar in the wild type cell line are not significantly different; after low temperature (4 ℃ C., 4 h) treatment, the soluble sugar of the VaNAC08 (OE-VaNAC 08) over-expressed transgenic cell line is significantly increased, while the NAC08-ED mutant transgenic cell is significantly decreased. The results indicate that VaNAC08 is positively correlated with glucose soluble sugar content.

Application of NAC transcription factor VaNAC08 in reducing relative conductivity of grape cells

The OE-VaNAC08, NAC08-ED and wild-type cell lines were subjected to low temperature treatment and samples were collected for relative conductivity measurements. Low temperatures can significantly increase the relative conductivity of wild-type and NAC08-ED mutant cell lines. Further analysis found that the relative conductivity of the OE-VaNAC08 cell line was significantly lower than that of wild-type plants after 4h of low temperature (4 ℃). The results suggest that upregulation of the VaNAC08 gene protects cells to some extent, preventing ion leakage due to osmotic stress, as the OE-VaNAC08 cell line is more tolerant and reduces the extent of cell damage.

6. A vector contains a gene shown in a sequence table SEQ ID NO. 1.

NAC transcription factor gene VaNAC08 and its cloning process includes the following steps: (1) total RNA extraction and cDNA synthesis; (2) primer design and gene cloning; (3) cloning vector construction and gene sequencing.

The functional verification method of NAC transcription factor VaNAC08 includes the following steps: (1) VaNAC08 plant over-expression vector construction; (2) NAC08-ED (CRISPR/Cas 9 mediated gene mutation) vector construction; 3) Genetic transformation of grape; (4) detecting the expression quantity of the exogenous gene; (5) And (5) determining physiological and biochemical indexes of the transgenic material and evaluating cold resistance.

The beneficial effects are that: the application provides NAC08 sequence of NAC transcription factor gene of wild grape seed and cultivated grape seed 'rose' NAC, NAC08 cloning method and verification of the gene function, further determines the application of the gene in regulating soluble glucose of grape cells, improving low temperature tolerance of grape cell membranes and finally improving cold resistance of grape.

Drawings

FIG. 1 shows NAC08 amplification electrophoresis results.

FIG. 2 is a NAC08 sequence alignment.

FIG. 3 is an identification of NAC08 overexpression. VaNAC08 and NPTII insertion detection; vaNAC08 expression detection, taking action and MDH as internal references. Each data is the average of 9 replicates and error bars are standard deviations. * Indicating that there was a significant difference of P <0.05 from EV (t-test).

FIG. 4 shows the cold resistance and physiological index measurement of VaNAC08 overexpressed grape cells under low temperature stress. A. Freezing point (LTE) of over-expressed VaNAC08 cells, phenotype identification of over-expressed cell lines (OE-VaNAC 08) and control (empty). Each data is the average of 9 replicates and error bars are standard deviations. * Indicating that there was a significant difference of P <0.05 from EV (t-test). B. Electrolyte leaching rate; C. soluble sugar content. Each data is the average of 6 replicates and error bars are standard deviations. The differences represent significant differences at P <0.05 (Duncan's multiple range detection).

FIG. 5 is a CRISPR/Cas9 mediated identification of mutant material NAC 08-ED.

FIG. 6 is a mutation analysis of CRISPR/Cas9 mediated mutant material NAC 08-ED. Schematic representation of editing sites in NAC08 gene. Blue boxes represent exons and green lines represent introns. T is the target sequence position. SP-F and SP-R are primers used for PCR amplification. B. Two editorial m3 and m4 sequencing peak plots are shown. Ev material edit sequencing identification. Sequencing results of 30 cloned amplicons. Homologous nucleotides are shaded and different colors indicate different levels of homology. Nucleotides with 100% homology are indicated in blue and nucleotides with 75% homology are indicated in red. The red numbers on the right indicate the number of clones detected with the same mutation type. E. Editing the amino acid mutation of the corresponding mutant sequence in the result (D).

FIG. 7 shows the cold resistance and physiological index measurement of NAC08-ED material. LTE of NAC08-ED grape callus. Data are mean ± SE of 9 biological replicates. Electrolyte leakage rate (B) and soluble sugar content (C) of NAC08-ED grape callus and empty vector callus under cold stress (P <0.05,Duncan's multiple range detection).

Detailed description of the preferred embodiments

The methods and apparatus used in the following examples of the present application are conventional methods and apparatus unless otherwise specified; the equipment and the reagent are conventional equipment and reagents purchased by reagent companies. In order to make the objects, technical solutions and advantages of the present patent more apparent, the following detailed description of the present patent refers to the field of 'electric digital data processing'. Examples of these preferred embodiments are illustrated in the specific examples. It should be noted that, in order to avoid obscuring the technical solutions of the present application due to unnecessary details, only the technical solutions and/or processing steps closely related to the solutions according to the present application are shown in the embodiments, and other details having little relation are omitted.

Example 1

The embodiment provides a grape NAC transcription factor gene NAC08 sequence, wherein the CDS sequence of the NAC transcription factor gene NAC08 is shown in a sequence table SEQ NO. 1.

Example 2

The embodiment provides a grape NAC transcription factor gene NAC08 and a cloning method thereof, and specifically comprises the following steps:

1. total RNA extraction and cDNA Synthesis

(1) Grinding 100mg of Amur grape and tissue culture Miao Miaoyou leaf of 'roses' into powder in liquid nitrogen, extracting total RNA of grape according to the method described in appendix I, measuring the purity and concentration of RNA by using an ultra-micro ultraviolet spectrophotometer, and taking an RNA sample with OD260/280 between 1.9 and 2.1 for reverse transcription reaction.

(2) The RNA sample is slowly thawed in an ice box, and the 1st Strand cDNA Synthesis kit is placed on ice for thawing, then is uniformly mixed by vortex, and is placed in crushed ice.

(3) Adding 1 μg of RNA (corresponding volume calculated from concentration) into the microcentrifuge tube (RNase Free), RNase Free ddH ₂ Supplementing O to 8 mu L, heating at 65deg.C for 5min, rapidly standing on ice for 2min; the centrifuge tube was removed, and 5 XgDNA B μffer 2 μL was added. Placing the sample on a PCR instrument for reaction at 42 ℃ for 2min to fully degrade DNA in the sample.

(4) Taking outThe centrifuge tube was filled with 10 XRT Mix 2. Mu.L, hiScript III Enzyme Mix 2. Mu. L, oligo (dT) 20VN 1. Mu. L, RNase-free ddH ₂ O and 5. Mu.L of RNase Free ddH20 were made up to 20. Mu.L. The mixture was allowed to react at 37℃for 45min and 85℃for 5sec on a PCR instrument. The cDNA obtained by reverse transcription was taken out and diluted 10-fold for subsequent PCR amplification.

2. Primer design and Gene cloning

The transcript sequence of NAC08 (GSVIVG 01008839001) was downloaded from the grape genome database (https:// phytozome. Jgi. Doe. Gov/pz/portal. Html) and primer F was designed at 5'-UTR and 3' -UTR, respectively, using Primer5.0 software: 5'-CCGGGAACCAAACATAGCCT-3', R:5'-CGTCGGATGGAACCTGAAGC-3' the primers were synthesized by Beijing Optimaceae.

The first strand of grape cDNA is used as a template, and an I5 DNA high-fidelity polymerase is used for carrying out PCR amplification on the NAC08 gene coding region, and the reaction system is as follows: cDNA sample 1. Mu.L, 2×I5mix 25. Mu.L, forward primer (10. Mu.M) 2. Mu.L, reverse primer (10. Mu.M) 2. Mu.L, ddH ₂ O was supplemented to 50. Mu.L and ddH2O was supplemented to 50. Mu.L. The reaction procedure is: denaturation at 98℃for 2min,35 cycles (denaturation at 98℃for 10s, annealing at 60℃for 30s, extension at 72℃for 1 min) and extension at 72℃for 6min, and specificity of the product was detected by agarose electrophoresis, the results are shown in FIG. 1.

3. Cloning vector construction and Gene sequencing

(1) The agarose gel with clear bands was taken, NAC08 gene fragment was recovered by the method described in appendix II, and purity and concentration were determined by ultra-micro UV spectrophotometry.

(2) The PCR product was ligated into pLB-T Easy vector as follows: 1.5. Mu.L, 2X Rapid Ligation Buffer 2.5.5. Mu.L, pLB-T Easy Vector 0.5. Mu.L, and T4 DNA library 0.5. Mu.L of the PCR product after A tail addition were added to the microcentrifuge tube, and the tube was left at 4℃overnight and the product was stored at-20℃for use.

(3) LB plates were prepared. Adding an appropriate amount of ampicillin (Amp, 100 mg/mL) into 100mL of LB solid medium sterilized at a proper temperature, uniformly mixing the medium and antibiotics, and pouring the mixture into a sterile culture dish for cooling;

(4) Slowly thawing E.coli 5 alpha competent cells on ice, adding the connected product, gently mixing with a pipette, and standing on ice for 30min;

(5) Water bath at 42 ℃ for 60sec, then ice bath for 2min immediately;

(6) Adding 700 mu L of LB liquid medium without antibiotics into each experimental tube, and carrying out shaking culture at 37 ℃ and 220rpm for 45-60 min;

(7) Absorbing a proper amount of bacterial liquid, adding the bacterial liquid onto a selective culture medium, and uniformly spreading the bacterial liquid by a coater;

(8) After the bacterial liquid on the surface of the culture medium is dried, the culture medium is placed in a constant temperature incubator at 37 ℃ in a pouring way, and is cultured for 12-16 hours;

(9) Normal growth clones were picked from LB plates, inoculated into 1mL of LB liquid medium containing Amp (100 mg L-1), shake-cultured at 220rpm for 6h at 37℃and then 1. Mu.L of bacterial liquid was taken for PCR detection;

(10) Picking a white single colony by using a sterile gun head, adding the white single colony into 1mL of LB culture medium (containing 50ng/mL Amp), and carrying out shaking culture at 37 ℃ and 220r/min for 16h;

(11) Taking 1 mu L of bacterial liquid, carrying out bacterial liquid PCR identification by adopting the PCR reaction condition of 5.2.3, and detecting the amplification specificity by agarose electrophoresis.

(12) And (3) sending the bacterial liquid containing the target fragment identified by PCR to Beijing engine family organism sequencing (the sequencing adopts a universal primer PLB-F/R), further identifying the integrity of the gene sequence, and comparing the sequence result with the corresponding sequence of the grape database Heibuo genome. NAC08 sequences are shown in FIG. 2 and the accompanying tables. The positive clones detected correctly were then sent to the company for sequencing, the results are shown in FIG. 2.

Example 3

The present example provides for the use of the VaNAC08 gene, specifically comprising:

1. construction of plant expression vector p2300-VaNAC08

(1) The cloning vector plasmid (with VaNAC08 attached) is used as a template, the primer NAC08-F/NAC08-R is used for amplification to obtain the ORF region of the VaNAC08 gene, and the obtained PCR product is purified for later use.

(2) The pCAMBIA2300 vector plasmid is subjected to single enzyme digestion by KpnI, electrophoresis detection and large vector fragment recovery. Single enzyme digestion was performed with KpnI to prepare the following reaction: pCAMBIA2300 1. Mu.g, kpnI 1. Mu.L, 10 XCutSmart Buffer 5. Mu.L, ddH2O to 50. Mu.L. And (3) placing at 37 ℃ for 8 hours, then detecting by electrophoresis, and recovering and purifying to obtain the linear plasmid.

(3) The recovered VaNAC08 fragment was ligated into pCAMBIA2300 vector using homologous recombination, and 3. Mu.L of the VaNAC08 fragment, 1. Mu.L of pCAMBIA2300, 1. Mu.L of 2×Soso mix, and 5. Mu.L of ddH2O were added to a microcentrifuge tube. The reaction solution was allowed to stand at 50℃for 30min.

(4) E.coli DH5 alpha is transformed from the connection product by a heat shock method, bacterial liquid is coated on a corresponding resistance screening LB culture medium, and the culture is inverted and carried out at 37 ℃ overnight.

(5) After PCR and sequencing verification, the constructed expression vector is named as p2300-VaNAC08.

2. CRISPR/cas9 gene editing vector construction

(1) The NAC08 gene gDNA sequence of the target gene is input into a targetDesign on-line tool (http:// skl. Scau. Edu. Cn/targetdiesig /), a potential Cas9 target site is searched, and the target site design target sgRNAs are selected according to the position of the target gene and the possibility of off-target. The 20bp sgRNA sequence was ligated into p1C.4 (Ji Rui organism) vector as follows: (1) target site primer design GCGGAGTTGCAGTTACCTCCAGG; the forward universal primer sequence is as follows: u6p.4-F: 5'_ CAGGAAACAGCTATGACCATATTCATTCGGAGTTTTTG TATC _3', reverse primer NAC08cas9-R: NAC08cas9-R:5'_ GCTATTTCTAGCTCTAAAAC- (GGAGGTAACTGCAACTCCGC) -AATCACTACTTCGACTCT _3', the designed sequences were sent to the company for synthesis, and the purification grade was PAGE.

(2) The pP1C.4 vector was digested with restriction enzymes EcoRI and XbaI, and the digested product was subjected to gel electrophoresis and then subjected to gel cutting recovery.

(3) And constructing and verifying a vector. The recombinant product was transformed into E.coli competent by heat shock method, see 2.1.12 for transformation experimental procedure. The screening is divided into two steps: first, PCR detection is performed by using a universal primer U6p.4-F/gRNA-R, and the size of the target fragment is recovered by gel electrophoresis to be about 400 bp. The restriction enzyme XbaI of the recovered fragment was subjected to cleavage detection, and the fragment was not cleaved by the enzyme to be a positive clone. The positive clones were then sent to the company for sequencing to verify the correctness of the sequence. The sequencing primer was M13F (-47), and the sequencing of the fragment of interest was reversed. After positive cloning verification is finished, the primer Hygjc2-F/R and the primer related to Cas9 are used for carrying out PCR detection on the other two elements in the vector, and the final vector is the positive detection.

3. Agrobacterium-mediated transformation of grape callus

After positive cloning vectors were determined, the corresponding vectors were transferred into grape 41B suspension-cultured cells, respectively, and the transformed empty vector was used as a control. The specific operation method is as follows:

preparation of agrobacterium suspension:

(1) Activation 1st time. Activating agrobacterium liquid preserved at-20 ℃: 5mL of LB liquid (5 mL of LB pH 7.2+25. Mu.L of 1M MgSO) was taken ₄ +10μL 50g L ^-1 Rif+2.5μL 100g L ^-1 Kan), inoculating 200-500 mu L of bacterial liquid, culturing at 28 ℃ and 200rpm for overnight until the liquid becomes turbid;

(2) Activation for the 2 nd time. Adding 300-500 μl of the activated bacterial liquid of the 1st time into 25mL of fresh LB liquid (25mL LB pH 7.2+125 μl 1M MgSO) ₄ +50μL 50g L ^-1 Rif+12.5μL 100g L ^-1 Kan), 28 ℃, and 200rpm, until the thalli are shaken up again to an OD600 of 0.6-0.8;

(3) Centrifuging at 4 ℃ and 5000rpm for 10min, discarding the supernatant, and collecting thalli;

(4) With 25mL of LB medium (pH 5.6, plus 125. Mu.L of 1M MgSO) ₄ ) Resuspension, adding 25 μl of 100mM AS, at 28deg.C, and shaking at 200rpm for more than 3 hr;

(5) Centrifugation is carried out at 5000rpm at 4 ℃ for 10min to collect thalli, 25mL of GM is added for 2 times of washing; ( Note that: when washing and resuspending thallus, it needs to be gently shaken by hand, and repeatedly blown and sucked without using gun head )

(6) Adding 10mL of GM to resuspend the thallus, and sucking 1mL of bacterial liquid after resuspension to measure OD value x;

(7) The volume of the cell suspension to be added during infection is as follows: (0.2/x) mL.

Preparation of an infection system:

(8) Adding 10mL of GM culture medium into a sterile triangular flask;

(9) Adding 0.5-1mL of suspension culture grape cells;

(10) Finally, adding the agrobacterium suspension cells (calculated in volume 7);

infection and co-cultivation:

(11) The flask was placed at 28℃and gently shaken at 120rpm for 30min;

(12) Sucking out all cells in the triangular flask by using a pipette, and transferring the cells into a sterile culture dish;

(13) Sucking out the redundant liquid and drying the liquid as much as possible;

(14) Transferring the cells to filter paper;

(15) Gently spreading the cells to make each cell contact with the culture medium as much as possible, but not excessively dispersing;

(16) Co-culturing the culture dish in a constant temperature incubator at 28 ℃ for 2-3 days (according to the specific case of co-culture);

washing and screening agrobacterium:

(17) Eluting the cells on the filter paper into a 100mL triangular flask by using 25mL of GM culture medium, and gently shaking by hand for 1-2 min;

(18) Washing was repeated 1 time with 25mL GM;

(19) Cells were transferred to new Erlenmeyer flasks with a 5mL pipette and 50mL GM (containing the corresponding antibiotic) was added

(20) Culturing at 25deg.C under 120rpm in dark condition, and changing culture solution 1 time every 7 days until new cells grow out;

(21) A NAC08 ORF fragment, a pCAMBIA2300 vector neomycin (NPTII/Kan) resistance gene and a p1C.4 hygromycin (Hyg) resistance gene sequence are selected, and a Primer design software Primer5.0 is used for designing and identifying primers (NAC 08-ORF-F:5'-ATGACAGCGGAGTTGCAGTTA-3', NAC-ORF-R: 5'-GAAGGGCTT CTGCAGGTACA-3', NPTII-F: 5'-ATTACCTTATCCGCAACTTCTTTACC-3', hyg-R: 5'-AGCCCCTGATGCTCTTCGTC-3', HPTII-F:5'-CTTCTGCGGGCGATTTGT-3' and Hyg-R: 5'-GCCGTGGTTGGCTTGTATG-3'), and the optimal primers are selected and synthesized by Beijing brand new biological company.

(22) The method is characterized in that the DNA of the transgenic cells is extracted according to the method described in the appendix III, and PCR detection is carried out by adopting an identification primer, wherein the reaction procedure is as follows: pre-denaturation at 98℃for 2min,30 cycles (98℃for 10sec,60℃for 30sec,72℃for 1min, 72℃for 6 min) and finally detection analysis by 1% agarose gel electrophoresis were carried out, and the results are shown in FIGS. 3 and 5.

4. Analysis of Gene expression level

(1) The NAC08 ORF fragment was intercepted to avoid NAM conserved domain, and qRT-PCR primers (qNAC 08-F:5'-GAGCCCAAGTGGAAGGAGTG-3', qNAC-R: 5'-GATTATTC GGGAACTGAGACAAAA-3') were designed and synthesized using Primer design software Primer 5.0. Meanwhile, primer sequences of an Action gene (GenBank accession NO. EC969944, action-F: 5'-CTTGCATCCCTCAGCACCTT-3', action-R: 5'-TCCTGTGGACAATGGATGGA-3') of a reference gene grape reference gene and a reference gene MDH (GenBank accession NO.EC921711, MDH-F:5'-CCATGCATCATCACCCACAA-3', MDH-R: 5'-GTCAACCATGCTAC TGTCAAAACC-3') of the grape reference gene are designed and synthesized.

(2) The method for extracting the RNA of the transgenic cells according to the annex I adopts a Norpran quantitative kit, and is carried out according to a reverse transcription reagent q-RT Supermix special for reverse transcription real-time fluorescence quantitative, and comprises the following specific operation steps: genomic DNA is first removed: 4 XgDNA wind Mix 2. Mu.L, RNA 1. Mu.g, RNase-free ddH ₂ Supplementing O to 16 mu L, and standing at 42 ℃ for 2min; then 5X HiScript II qRT SuperMix II. Mu.L of the mixture in the last step is added, the mixture is placed at 50 ℃ for 15min, and the product is stored at 85 ℃ for 5sec at-20 ℃ for standby.

(3) cDNA for fluorescent quantitative PCR detection was added ddH at 1:10 ₂ O is diluted for standby, and a fluorescent quantitative PCR reaction system is established for reaction as follows: 2X SYBR Green I Master Mix. Mu.L, primer mix 0.8. Mu.L, cDNA 1.0. Mu.L, ddH ₂ O8.2. Mu.L. The experimental apparatus used a CF96 fluorescent quantitative PCR apparatus from BIORAD company, and the reaction conditions used a standard mode, and the reaction procedure was: pre-denaturation at 95℃for 10min,39 cycles (10 sec at 95 ℃,30 sec at 60 ℃ for annealing, 30sec at 72 ℃ for 30 sec). The Ct values of the reactions were collected using 2 ^-△△Ct The relative expression level of the genes was analyzed by the method. The results are shown in FIG. 3.

5. Determination of physiological index of transgenic cell line and evaluation of cold resistance

(1) Three cell lines with the largest over-expression relative expression change and three cell lines with the highest Cas gene relative expression amount in the gene mutation are respectively selected (a wild type cell line and an empty control cell line are simultaneously cultured, the analysis result of the editing of the gene mutation line is shown in fig. 6), 3 bottles of each cell line are used for carrying out subculture for 7 days, and a differential thermal analysis system (DTA) is used for evaluating the cold resistance of the grape suspension cells. The Keithley Data Acquisition System (DAS) (model 2700-DAQ-40) was connected to a programmable freezer (Tenney environmental test chamber (model T2℃)) for measuring and collecting voltage output, calli were placed directly on thermoelectric modules (TEMs), with Empty Vector (EV) as a control, refrigerator programmed after 30min down to 4℃, 1h at 4℃,10 h (2℃ h-1) cooling down to-16℃, maintained at-16℃ for 1h, and then returned to 4℃ within 45 minutes.

(2) Three cell lines with the largest over-expression relative expression change and three cell lines with the highest Cas gene relative expression amount in the gene mutation (simultaneously culturing a wild type cell line and an empty control cell line) are respectively selected, each cell line is subjected to 3 bottles of culture for 7d, and after treatment under normal growth conditions and low temperature (4 ℃ for 4 hours), the materials are collected for relative conductivity measurement, and the results are shown in fig. 4B and 7B; the results of the soluble sugar measurement are shown in FIGS. 4C and 7C. Wherein the relative conductivity was determined using a soak method and the soluble sugar content was performed using the solebao soluble sugar determination kit (BC 0030).

The foregoing is merely illustrative of the embodiments of this application and it will be appreciated by those skilled in the art that variations and modifications may be made without departing from the principles of the application, and it is intended to cover all modifications and variations as fall within the scope of the application.

Appendix I: method for extracting total RNA of plant

The method is operated according to the instruction book of the TIANGEN RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit (with deletion), and comprises the following specific steps:

about 1.100mg of plant material is rapidly ground into powder in liquid nitrogen, 500 mu L of lysate SL is added, and immediately vortex shaking and mixing are carried out.

Centrifuge at 2.12,000rpm for 2min.

3. The supernatant was transferred to a filter column CS and centrifuged at 12,000rpm for 2min, and the supernatant in the collection tube was pipetted into a new RNase-Free centrifuge tube.

4. Slowly adding 0.4 times of absolute ethyl alcohol with the supernatant volume, uniformly mixing, transferring the obtained solution and the precipitate into CR3, centrifuging at 12,000rpm for 15sec, pouring out waste liquid, and placing the adsorption column CR3 back into a collecting pipe.

5. Deproteinized liquid RW1, 350. Mu.L, and 12,000rpm were added to the adsorption column CR3, centrifuged for 15sec, and the waste liquid was discarded, and the adsorption column CR3 was returned to the collection tube.

6. Preparing DNase I working solution: the DNase I stock solution was placed in a new centrifuge tube (RNase-Free), and 70. Mu.L of buffer RDD was added to 10. Mu.L of the fresh centrifuge tube, followed by gentle mixing.

7. To the column CR3, 80. Mu.L of DNase I working solution was added, and the mixture was left at room temperature for 15 minutes.

8. Deproteinized liquid RW1, 350. Mu.L, and 12,000rpm were added to the adsorption column CR3, centrifuged for 15sec, and the waste liquid was discarded, and the adsorption column CR3 was returned to the collection tube.

9. To the adsorption column CR3, 500. Mu.L of the rinse solution RW was added, and the mixture was centrifuged at 12,000rpm for 15sec, and the waste liquid was poured off, and the adsorption column CR3 was returned to the collection tube. Repeating once.

Centrifuging at 10.12,000rpm for 2min, placing the adsorption column CR3 into a new centrifuge tube (RNase-Free), suspending and dripping 30-50 μl RNase-Free ddH2O into the middle part of the adsorption membrane, standing at room temperature for 2-3min, and centrifuging at 12,000rpm for 2min to obtain RNA solution.

11. And (3) measuring the concentration of RNA, detecting the quality of the RNA by electrophoresis, and preserving the RNA in an ultralow temperature refrigerator at the temperature of-70 ℃ for standby after the detection is qualified.

Appendix II: recovery of target DNA fragment by agarose gel electrophoresis

The preparation method is operated according to the specification of Beijing Zhuang Mengwei column concentration agarose gel recovery kit (with deletion), and comprises the following specific steps:

1. cut out on agarose gel containing target fragment and put into 1.5mL centrifuge tube;

2. weighing the glue block, adding 300 mu L of sol liquid according to 0.l g, and carrying out water bath at 55 ℃ for 10min, and uniformly mixing the glue block for several times in an upside down way to ensure that the glue block is fully dissolved;

3. adding the gum solution into an adsorption column, standing at room temperature for 2min, centrifuging at 12000rpm for 30-60sec, and discarding the filtrate;

4. 600. Mu.L of the rinse PW was added to the column, centrifuged at 12000rpm for 30-60sec, and the filtrate was discarded. Repeating the process once;

5. placing the adsorption column back into the collecting tube, and centrifuging at 12000rpm for 2min;

6. placing the adsorption column into a new centrifuge tube, standing at room temperature for 5min, then dripping 10 μL of ddH2O preheated at 65 ℃ into the middle position of the adsorption film, standing at room temperature for 2-3min, centrifuging at 12000rpm for 2min, collecting DNA solution, and storing at-20 ℃ for later use.

Appendix III: plant genome DNA extraction method

The method is carried out according to the specification of the Edley DNA extraction kit (with deletion), and comprises the following specific operation steps:

1. taking about 100mg of fresh leaves of transgenic arabidopsis thaliana, taking a wild type and an empty load as a control, adding 700 mu L of buffer GP1, and fully grinding;

2. transferring the ground homogenate into a 1.5mL centrifuge tube, carrying out water bath at 65 ℃ for 20min, and reversing and mixing for a plurality of times in the water bath process.

3. Adding 700 μl of chloroform, shaking vigorously to mix thoroughly, centrifuging 13523g for 5min;

4. taking the supernatant, then adding 700 mu L of buffer solution GP2, and fully and uniformly mixing;

5. transferring the mixed solution into an adsorption column CB3, centrifuging 13523g for 30sec, and discarding the filtrate;

6. 500. Mu.L of buffer GD was added to the adsorption column CB3, and 13523g was centrifuged for 30sec to discard the filtrate;

7. 600 μl of the rinse solution PW was added to the adsorption column CB3, 13523g was centrifuged for 30sec, and the filtrate was discarded and repeated once;

8. placing the adsorption column CB3 back into a collecting pipe, centrifuging 13523g for 2min, pouring out filtrate, and then placing the adsorption column CB3 at room temperature for airing;

9. transferring the adsorption column CB3 into a new centrifuge tube, dripping 100 mu L of sterile water into the middle part of the adsorption film, standing for 2min at room temperature, centrifuging for 2min at 13523g, and collecting the DNA solution into the centrifuge tube;

and detecting the quality of DNA by electrophoresis, and performing PCR verification by taking the quality as a template after the quality is qualified.

Appendix IV: determination of soluble sugar content

The method is operated according to the specification of a Soxhaust plant soluble sugar content detection kit (BC 0030) (with deletion), and comprises the following specific steps:

1. extraction of soluble sugars in samples: weighing about 0.1-0.2 g of sample, adding 1mL of distilled water, grinding into homogenate, pouring into a covered centrifuge tube, bathing with boiling water for 10min (tightly covered to prevent water loss), cooling, centrifuging at normal temperature for 10min at 8000g, collecting supernatant, placing into a 15mL centrifuge tube, fixing volume to 10mL with distilled water, and shaking for later use.

2. Measurement preparation: a. preheating the spectrophotometer for more than 30min, adjusting the wavelength to 620nm, and zeroing the distilled water. b. The water bath was adjusted to 95 ℃. c. Preparing a working solution: and adding 5mL of the second reagent into the first reagent, fully dissolving the second reagent, and using the mixture, wherein if the second reagent is difficult to dissolve, the mixture can be heated and stirred.

3. And (3) adding samples according to a sample adding table, uniformly mixing, covering a tube cover, placing in a water bath at 95 ℃ for 10min, cooling to room temperature, and respectively reading the absorbance values of a blank tube and a measuring tube at 620nm, wherein DeltaA=A is the measuring tube-A blank tube. Establishment of a standard curve: 620 Distilled water at nm was zeroed and the absorbance of standard tube was read, a=a standard tube-a blank tube. A standard curve is established with the concentration (y) on the ordinate and the absorbance a (x) on the abscissa. Note that: a. the blank tube is only one tube. b. If ΔA is greater than 1, the sample is diluted with distilled water and the formula is calculated by multiplying the corresponding dilution times. c. Concentrated sulfuric acid is highly corrosive and should be carefully handled.

Soluble sugar content calculation: a. according to the standard curve, bringing delta A into a formula (x) to calculate the concentration y (mg/mL) of the sample; b. Calculating according to the fresh weight of the sample: soluble sugar (mg/g fresh weight) = (y×v1) = (w×v1/(V2) = 10×y/(W).

<110> Gansu agricultural university

<120> NAC transcription factor gene VaNAC08 and use thereof

<160> 1

<210> 1

<211> 899

<212> DNA

<213> grape (Vitis vinifera)

<400> 1

1 atgacagcgg agttgcagtt acctccaggc ttcaggttcc atccgacgga tgaggagctt

61 gtgatgcact atctgtgccg taaatgtgca tcgcaatcga tctctgtgcc gatcattgcc

121 gaaattgatc tctacaaatt cgatccctgg cagcttcctg agatggcctt gtacggagag

181 aaagagtggt acttcttttc gccgagagat cggaaatatc cgaacggttc aaggccgaac

241 cgggcagcgg gaacagggta ctggaaggcc accggagcgg ataagcctat tgggcatccg

301 aagccggttg ggattaagaa ggctttggtt ttttatgccg gaaaagcccc caggggagag

361 aagacaaatt ggattatgca tgaataccgg ctggcagacg tggaccggtc ggctcgcaag

421 aagaataata gcttaaggtt ggacgattgg gttctgtgcc gcatatacaa caagaagggg

481 attgtcgaga aacaacacac cgctgcccgg aaatcagatt gctccgatgt tgaggatcaa

541 aagcctggac ctcttgctct aagcaggaag gcaggtgcga tgcctccacc tccgccgccg

601 tcgtcctcta cggcaccaac tgcgacagcg gcactggacg atttggtgta cttcgactca

661 tcggattcgg tgccgcgcct ccacaccgac tcgagctgtt cggagcacgt ggtgtcgccg

721 gagttcacgt gcgagaggga ggtgcagagc gagcccaagt ggaaggagtg ggaaaatccc

781 atggactttt cgtacaatta catggatgcc acagttgaca acgcattttt gtctcagttc

841 ccgaataatc agatgtcgcc attgcaggac atgtttatgt acctgcagaa gcccttctg

Claims

1. The application of grape NAC transcription factor gene NAC08 in reducing the relative conductivity of grape cells is characterized in that the CDS sequence of NAC08 is shown in a sequence table SEQ No.1, and the application is realized by over-expressing NAC08 gene.