CN113736775B - Application of xanthan gum pretreated by using expansin to reduce viscosity of xanthan gum - Google Patents

Abstract

The invention discloses an application method for reducing viscosity of xanthan gum by pretreatment of the xanthan gum through expansin, and belongs to the technical field of pretreatment for reducing viscosity of the xanthan gum. The invention uses the expansin to pretreat the xanthan gum for depolymerization, so as to promote the viscosity of the xanthan gum to be reduced. The method of the invention overcomes the defects of high equipment requirement, poor product quality and the like in the prior art when a large amount of alkali solution is used for treating xanthan gum by the traditional chemical method. Saving the cost, not causing environmental pollution and conforming to the environment-friendly type. Meanwhile, the method is simple and feasible, and is beneficial to industrial popularization and application.

Description

Application of xanthan gum pretreated by using expansin to reduce viscosity of xanthan gum

Technical Field

The invention belongs to the technical field of pretreatment for reducing viscosity of xanthan gum, and particularly relates to an application method for reducing viscosity of xanthan gum by pretreatment of expansin.

Background

Xanthan gum is a microbial polysaccharide, and is a polysaccharide substance which takes beta- (1, 4) glucan as a main chain, and a side chain formed by beta-D-mannose, beta-D-glucuronic acid and alpha-D-mannose is contained on a glucose group at intervals as a basic structural unit. The xanthan gum which is not subjected to any treatment has abundant hydrogen bonds among molecules to form a complex secondary structure, so that the aqueous solution of the xanthan gum has very high viscosity. The viscosity reduction of xanthan gum can be promoted only by pretreatment of the xanthan gum with strong alkali, ionic liquid or high temperature, and then the xanthan gum is degraded by hydrolase to generate xanthan gum oligosaccharide. The product xanthan gum oligosaccharide has the universality of bioactive oligosaccharides such as chitosan oligosaccharide, trehalose oligosaccharide and the like, and has the potential of scavenging in-vitro free radicals and inhibiting the growth of pathogenic bacteria. Has greater application value in the fields of medicine, food health care products, planting and the like. This makes reducing the viscosity of xanthan gum an important key step in improving its hydrolysis efficiency.

The main method for reducing the viscosity of the xanthan gum at present is to dissolve the xanthan gum with a strong alkali solvent under the high temperature condition, reduce the viscosity of the xanthan gum, and then need to adjust the pH value of the xanthan gum solution to be neutral for enzymolysis to generate the xanthan gum oligosaccharide. The method requires high temperature in the production process, and uses a strong alkali solvent in the production process, so that the method has high requirements on production equipment and is easy to cause environmental pollution. Therefore, it is becoming more and more important to find a green and efficient method for pretreating xanthan gum to reduce its viscosity.

The expansin is derived from bacteria and plants, is a non-hydrolytic auxiliary protein, has a destructive effect on substrates with polysaccharide network structures, breaks hydrogen bonds between polysaccharides in the process of not hydrolyzing the same, and opens the compact crystal structure of the polysaccharide substrates. Thus allowing water molecules or hydrolytic enzymes to enter the polysaccharide substrate and to be brought into a water-soluble form.

Disclosure of Invention

The invention aims to provide an application method for depolymerizing xanthan gum by pretreatment of expansin; aims to overcome the defects in the prior art that the chemical reagent pollutes the environment and the product quality is poor when the xanthan gum is hydrolyzed by the traditional chemical method, and provides an economic, efficient and environment-friendly application of the enzyme pretreatment of the xanthan gum.

A gene has a nucleotide sequence shown in SEQ ID NO. 1.

The amino acid sequence of the expansin coded by the gene is shown as SEQ ID NO. 2.

A recombinant expression bacterium of the above expansin.

The viscosity of xanthan gum can be reduced by adding the expansin into the xanthan gum for pretreatment.

Further, the optimum temperature for pretreatment of xanthan gum was 50℃and the reaction time was 72 hours.

Compared with the reported method for reducing the viscosity of the xanthan gum, the application method for reducing the viscosity of the xanthan gum by pretreating the depolymerization of the xanthan gum by using the expansin adopts a biological method to efficiently hydrolyze hydrogen bonds in the xanthan gum, and damages a dense grid structure of the xanthan gum to pretreat the depolymerization of the xanthan gum so as to reduce the viscosity of the xanthan gum. The method of the invention overcomes the defects of high equipment requirement, poor product quality and the like in the prior art when a large amount of alkali solution is used for treating xanthan gum by the traditional chemical method. Saving the cost, not causing environmental pollution and conforming to the environment-friendly type. Meanwhile, the method is simple and feasible, and is beneficial to industrial popularization and application.

Drawings

FIG. 1 is an SDS-PAGE electrophoresis of pure protein purified from expansin of the present invention; in the figure, the first lane: protein markers; second lane: empty bacterium pET-28a/BL21 whole thallus; third lane: empty bacterium pET-28a/BL21 expression supernatant; fourth lane: recombinant bacterium pET-28a-HcEX/BL21 expresses supernatant.

FIG. 2 shows the depolymerization optimum temperature of the xanthan gum pretreated with the expansin of the present invention.

FIG. 3 shows the optimal reaction time for depolymerizing xanthan gum by pretreatment with expansin according to the present invention.

Fig. 4 is a viscosity comparison of untreated xanthan gum versus depolymerized xanthan gum pretreated with the expansin of the present invention.

Detailed Description

The method of the present invention is further illustrated by the following specific examples.

The present invention is further described by the following examples, which are given by way of illustration only and are not intended to limit the scope of the invention, and the experimental methods in the examples, unless otherwise specified, are conventional. The reagents used in the present invention are commercially available unless otherwise specified.

EXAMPLE 1 recombinant bacterium construction of expansin

According to the nucleotide sequence shown in SEQ ID NO.1, third party company is entrusted to synthesize, namely the sequence of the expansin gene is shown in SEQ ID NO.1, and the coding region length is 660bp. The amino acid sequence coded by the expansin gene is shown as SEQ ID NO. 2. The synthesized SEQ ID NO.1 gene sequence was ligated to plasmid pET-28a to obtain recombinant pET-28a-HcEX plasmid (Jilin Kyoto Biotechnology Co., ltd.). Coli BL21 was prepared, recombinant pET-28a-HcEX plasmid was electrotransferred to BL21, spread on LB plate containing 30. Mu.g/ml kanamycin, screened, multiple single colonies were picked up and cultured in LB liquid medium containing 30. Mu.g/ml kanamycin at 30℃and 200rpm for 12 hours, colony PCR was verified with T7 universal primer, and as a result, amplification product of correct size was obtained, confirming correctly constructed recombinant expression bacterium, and the recombinant bacterium was named pET-28a-HcEX/BL21.

SEQ ID NO.1

GAAAACCGTGTTTCTGCGACTCACACCTCCGCCGCGCTGCATGAGGGTGAAGGTACTTACTACTTCTACAACGGCGGCGGCCATTGCAGCGTTCCGGTGCCGGCGATGTTCACTGCAGCGATGAACCAGACCGACTATAACGGTTCCCAGGCTTGTGGCGGTTGCGTTAAGGTGACCAACCGCAACAACGGCAAGTCCGTGGTGGCGCGCGTTGACGACTCTTGTCCGGGCTGCAACCCGGGTGACGTGGATCTGACCGACGCCGCCTTCGCGCAGATTTCTCCACTGGAGGCGGGTCGCATTCCGATCAGCTGGGATTATGTTCCGTGCGATTATCCGTCTGTGCTGCTGTACTTCATGGAAGGTTCTAGCCAGTGGTGGACCGCCGTGCAAGTACGCGAACAGCGTTATCCGGTAAGCTCTCTGGCGTACCGTGAATCTGGTTCTACCGGCTCCTATCAGGAGATCGCCCGTGAAGACTACAACTACTTTGTTGAACGTTCCGGCATGGGTACCGGCCCGTTTGATTTTCGCATCACCGACATCTATGGTCATGTGCTGGAAGCAGGTAACATCACCCTGCAGTCTGGCGTTCCGATCAACACCCAGCAACAGTTTCCGTCTATGGGTACCTCCGGCGTTATTAACCAGGCAGACAAA

SEQ ID NO.2

/>

Example 2 expression of expansins in recombinant bacteria

The correct recombinant lines identified in example 1 were streaked pET-28a-HcEX/BL21 on LB plates of 30. Mu.g/ml kanamycin; single colonies were picked in 5mL of LB liquid at 30. Mu.g/mL kanamycin, and cultured for 12h as seed liquid; the culture was carried out in LB liquid medium at a ratio of 1:50 (volume ratio) with 30. Mu.g/ml kanamycin until OD600 = 1, and 0.6mM of IPTG was added to the culture medium, followed by culturing at 16℃for 20 hours at 200 rpm. The expression of the expansin was detected by polyacrylamide gel electrophoresis, and the result is shown in FIG. 1, in which the expansin was significantly expressed under the induction of IPTG.

EXAMPLE 3 investigation of depolymerization conditions of expansin pretreatment xanthan gum

Measurement of depolymerization conditions of pretreated xanthan gum, including optimal temperature and reaction time, was performed on the expansin pET-28a-HcEX/BL21 obtained in example 1 using xanthan gum as a substrate

(1) Determination of optimum temperature

The experimental group was that using 0.5wt% xanthan gum as a substrate, the expansin was reacted at 200rpm under different temperature conditions (40 ℃,50 ℃, 60 ℃) for 72 hours, the viscosity of the xanthan gum was measured with an NDJ-79A rotational viscometer (Shanghai chang geological instruments ltd.) and 0.5wt% xanthan gum was a control group, and as a result, as shown in fig. 2, at a reaction temperature of 50 ℃, the viscosity of the xanthan gum was decreased from 214mpa.s to 150mpa.s, the viscosity decrease was most remarkable, and thus the optimum temperature of the expansin was 50 ℃.

(2) Determination of the optimal reaction time

Under the condition of the optimal temperature, the same system reacts at different times (12 h, 24h, 36h, 48h and 72 h), and the viscosity of the xanthan gum is measured by using an NDJ-79A rotary viscometer. As a result, as shown in FIG. 3, the viscosity of xanthan gum was not changed at 84 hours, and the optimal reaction time of the extended protein-acting xanthan gum was 72 hours in consideration of the stability of the protein.

Example 4 pretreatment of xanthan gum with expansin to reduce viscosity

15mg of the expansin pET-28a-HcEX/BL21 obtained in example 1 was reacted with 20ml of 0.5wt% xanthan gum, the viscosity change of the xanthan gum was measured by using an NDJ-79A rotary viscometer at 50℃for 72 hours, the viscosity change of the xanthan gum was measured by using an NDJ-79A rotary viscometer in a control group of 20ml of 0.5wt% xanthan gum, and the viscosity change of the xanthan gum was measured by using an NDJ-79A rotary viscometer at 50℃for 72 hours. The relative viscosity ratio was obtained as the relative ratio of the viscosity of xanthan gum after reaction to that of xanthan gum before reaction, as shown in fig. 4, the relative viscosity ratio of xanthan gum of the control group was unchanged, and the viscosity of xanthan gum after the pretreatment of expansin was reduced by 30%.

SEQUENCE LISTING

<110> university of Dalian industry

<120> application of xanthan gum pretreated by expansin to reduce viscosity thereof

<130> 2021

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 660

<212> DNA

<213> Artificial sequence (Artifical Sequence)

<400> 1

gaaaaccgtg tttctgcgac tcacacctcc gccgcgctgc atgagggtga aggtacttac 60

tacttctaca acggcggcgg ccattgcagc gttccggtgc cggcgatgtt cactgcagcg 120

atgaaccaga ccgactataa cggttcccag gcttgtggcg gttgcgttaa ggtgaccaac 180

cgcaacaacg gcaagtccgt ggtggcgcgc gttgacgact cttgtccggg ctgcaacccg 240

ggtgacgtgg atctgaccga cgccgccttc gcgcagattt ctccactgga ggcgggtcgc 300

attccgatca gctgggatta tgttccgtgc gattatccgt ctgtgctgct gtacttcatg 360

gaaggttcta gccagtggtg gaccgccgtg caagtacgcg aacagcgtta tccggtaagc 420

tctctggcgt accgtgaatc tggttctacc ggctcctatc aggagatcgc ccgtgaagac 480

tacaactact ttgttgaacg ttccggcatg ggtaccggcc cgtttgattt tcgcatcacc 540

gacatctatg gtcatgtgct ggaagcaggt aacatcaccc tgcagtctgg cgttccgatc 600

aacacccagc aacagtttcc gtctatgggt acctccggcg ttattaacca ggcagacaaa 660

<210> 2

<211> 220

<212> PRT

<213> Artificial sequence (Artifical Sequence)

<400> 2

Glu Asn Arg Val Ser Ala Thr His Thr Ser Ala Ala Leu His Glu Gly

1 5 10 15

Glu Gly Thr Tyr Tyr Phe Tyr Asn Gly Gly Gly His Cys Ser Val Pro

20 25 30

Val Pro Ala Met Phe Thr Ala Ala Met Asn Gln Thr Asp Tyr Asn Gly

35 40 45

Ser Gln Ala Cys Gly Gly Cys Val Lys Val Thr Asn Arg Asn Asn Gly

50 55 60

Lys Ser Val Val Ala Arg Val Asp Asp Ser Cys Pro Gly Cys Asn Pro

65 70 75 80

Gly Asp Val Asp Leu Thr Asp Ala Ala Phe Ala Gln Ile Ser Pro Leu

85 90 95

Glu Ala Gly Arg Ile Pro Ile Ser Trp Asp Tyr Val Pro Cys Asp Tyr

100 105 110

Pro Ser Val Leu Leu Tyr Phe Met Glu Gly Ser Ser Gln Trp Trp Thr

115 120 125

Ala Val Gln Val Arg Glu Gln Arg Tyr Pro Val Ser Ser Leu Ala Tyr

130 135 140

Arg Glu Ser Gly Ser Thr Gly Ser Tyr Gln Glu Ile Ala Arg Glu Asp

145 150 155 160

Tyr Asn Tyr Phe Val Glu Arg Ser Gly Met Gly Thr Gly Pro Phe Asp

165 170 175

Phe Arg Ile Thr Asp Ile Tyr Gly His Val Leu Glu Ala Gly Asn Ile

180 185 190

Thr Leu Gln Ser Gly Val Pro Ile Asn Thr Gln Gln Gln Phe Pro Ser

195 200 205

Met Gly Thr Ser Gly Val Ile Asn Gln Ala Asp Lys

210 215 220

Claims (2)

1. The application of the xanthan gum pretreated by the expansin to reduce the viscosity of the xanthan gum is characterized in that the viscosity of the xanthan gum can be reduced by adding the expansin into the xanthan gum for pretreatment;

the amino acid sequence of the expansin is shown as SEQ ID NO. 2.

2. The use according to claim 1, wherein the optimal temperature for pretreating xanthan gum is 50 ℃ and the reaction time is 72 hours.

Images