CN113730383A

CN113730383A - Application of honokiol in preparation of medicine for inhibiting expression of PD-L1

Info

Publication number: CN113730383A
Application number: CN202111036551.XA
Authority: CN
Inventors: 罗连响; 罗辉; 黄芳芳; 许广香; 李晓玲
Original assignee: Guangdong Zhanjiang Institute Of Marine Medicine; Southern Marine Science and Engineering Guangdong Laboratory Zhanjiang
Current assignee: Guangdong Zhanjiang Institute Of Marine Medicine; Southern Marine Science and Engineering Guangdong Laboratory Zhanjiang
Priority date: 2021-09-06
Filing date: 2021-09-06
Publication date: 2021-12-03

Abstract

The invention belongs to the technical field of medicines, and discloses application of honokiol in preparation of a medicine for inhibiting expression of PD-L1. The invention provides a natural small molecular compound honokiol or pharmaceutically acceptable salt thereof, which can inhibit the expression level of PD-L1 protein and the RNA transcription level of PD-L1 in a dosage manner; the honokiol or the pharmaceutically acceptable salt thereof provided by the invention can also inhibit the proliferation of tumor cells and obviously increase CD4 in tumor infiltrating lymphocytes⁺T cells and CD8⁺The number of T cells can effectively inhibit the increase of the volume of the transplanted tumor of the nude mouse.

Description

Application of honokiol in preparation of medicine for inhibiting expression of PD-L1

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to application of honokiol in preparation of a medicine for inhibiting expression of PD-L1.

Background

Lung cancer is one of the highest worldwide morbidity and mortality malignancies. Non-small cell lung cancer accounts for about 80-85% of primary lung cancer, and lung adenocarcinoma is one of the most common subtypes of non-small cell lung cancer. In recent years, therapeutic measures for lung adenocarcinoma have been advanced, but the overall 5-year survival rate of lung adenocarcinoma patients has not been significantly improved. Most lung adenocarcinoma patients are diagnosed at an advanced stage, and are insensitive to conservative treatment modes such as radiotherapy, chemotherapy and the like, and molecular target treatment is easy to generate drug resistance, so that the operation chance is lost. The research on the molecular mechanism of the development of lung adenocarcinoma and the search for new molecular targets remain the key points of the treatment of lung adenocarcinoma.

In recent years, the emergence of tumor immunotherapy, and in particular immune checkpoint inhibitors, has brought new promise for patients with advanced lung adenocarcinoma. PD-1 (programmed death receptor 1) is mainly expressed on the surface of activated T cells, PD-L1 (programmed death ligand 1) is a ligand of PD-1, and PD-L1 is combined with PD-1 on the surface of the T cells under the normal condition, so that the activation of the T cells is inhibited, and the autoimmune disease caused by over activation of the T cells is avoided. Thus, the PD-1/PD-L1 pathway is critical for maintaining a balance of protective immunity and immune tolerance in the body. However, tumor cells selectively express PD-L1 in high degree in the process of evolution, and the PD-L1 induces an inhibitory signal by combining with PD-1 infiltrated on the surface of activated T cells in tumors, so that the anti-tumor activity of the T cells is lost, and the tumor immune escape is realized. The PD-1 and PD-L1 antibody medicaments can specifically block the binding of PD-1 and PD-L1 and reactivate T cells so as to restore the tumor killing effect of the T cells. FDA approved marketing of various mAbs to PD-1 and PD-L1 has had great success in tumor immunotherapy. However, the PD-1 and PD-L1 antibodies are not effective for every patient, and clinical trial results show that only 10% to 30% of patients can benefit from treatment with PD-1 and PD-L1 monoclonal antibodies, and the treatment cost is high, the treatment period is long, and if the treatment is ineffective, the patients lose the opportunity to receive other treatments in time, and more importantly, adverse reactions caused by immunotherapy cannot be ignored.

The micromolecule compound from the traditional Chinese medicine has the characteristics of various varieties, novel structure, multiple targets, small toxic and side effects, diversified biological activities and the like, has wide effects on treating diseases, and is an important source for developing new medicines. At present, the reports of the literature show that honokiol obviously up-regulates the expression of the cancer suppressor gene Sirt3 and inhibits EGFR mutation, thereby inhibiting the proliferation of lung cancer cells. However, honokiol has been studied less in terms of immunity, and no study has been reported in terms of regulation of tumor immune escape mediated by PD-L1.

Disclosure of Invention

The first aspect of the invention aims to provide application of honokiol or pharmaceutically acceptable salts thereof in preparing PD-L1 inhibitors.

The second aspect of the present invention is to provide an application of honokiol or pharmaceutically acceptable salts thereof in preparing a medicament for inhibiting tumor cell proliferation.

The third aspect of the invention aims to provide honokiol or pharmaceutically acceptable salt thereof for preparing a medicine for increasing CD4 in tumor infiltrating lymphocytes⁺T cells and CD8⁺Use in medicine for T cell numbers.

The fourth aspect of the invention aims to provide the application of honokiol or pharmaceutically acceptable salts thereof in preparing medicines for inhibiting tumor volume increase.

The fifth aspect of the invention aims to provide the application of honokiol or pharmaceutically acceptable salts thereof in preparing antitumor drugs.

The sixth aspect of the present invention is directed to a drug that inhibits the expression of PD-L1.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the invention, there is provided the use of honokiol, or a pharmaceutically acceptable salt thereof, in the preparation of a PD-L1 inhibitor.

Preferably, the PD-L1 inhibitor is an agent that inhibits tumor PD-L1 expression.

Further preferably, the PD-L1 inhibitor is an agent that inhibits tumor PD-L1 protein expression.

Further preferably, the PD-L1 inhibitor is an agent that inhibits tumor PD-L1 gene expression.

Preferably, the PD-L1 inhibitor is an agent that inhibits the upregulation of interferon-induced tumor PD-L1 expression.

Preferably, the interferon is at least one of IFN-alpha, IFN-beta and IFN-gamma.

Preferably, the tumor is selected from at least one of breast cancer, lung cancer and liver cancer.

Further preferably, the tumor is selected from lung cancer.

Still further preferably, the tumor is selected from non-small cell lung cancer.

Preferably, the concentration of the honokiol or the pharmaceutically acceptable salt thereof is 5-40 μ M.

Further preferably, the concentration of the honokiol or the pharmaceutically acceptable salt thereof is 10-40 μ M.

Still more preferably, the concentration of the honokiol or the pharmaceutically acceptable salt thereof is 20 to 30 μ M.

In a second aspect of the invention, there is provided the use of honokiol, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for inhibiting tumor cell proliferation.

Further preferably, the tumor is selected from lung cancer.

In a third aspect of the invention, there is provided use of honokiol or a pharmaceutically acceptable salt thereof in the preparation of a medicament for increasing CD4 in tumor infiltrating lymphocytes⁺T cells and CD8⁺Use in medicine for T cell numbers.

Further preferably, the tumor is selected from lung cancer.

In a fourth aspect of the present invention, there is provided the use of honokiol, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for inhibiting tumor volume increase.

Further preferably, the tumor is selected from lung cancer.

In a fifth aspect of the present invention, there is provided an application of honokiol or a pharmaceutically acceptable salt thereof in preparing an antitumor drug.

Further preferably, the tumor is selected from lung cancer.

In a sixth aspect of the invention, there is provided a medicament for inhibiting the expression of PD-L1, comprising honokiol or a pharmaceutically acceptable salt thereof.

Preferably, the drug is a drug that inhibits expression of PD-L1 protein.

Preferably, the drug is a drug that inhibits the expression of the PD-L1 gene.

Preferably, the dosage form of the drug comprises at least one of liquid preparation, granules, sustained release agent, granules, tablets and capsules.

The invention has the beneficial effects that: the natural small molecule compound honokiol or pharmaceutically acceptable salt thereof provided by the invention can inhibit the expression level of PD-L1 protein in a dosage manner and inhibit the RNA transcription level of PD-L1; the honokiol or the pharmaceutically acceptable salt thereof provided by the invention can also inhibit the proliferation of tumor cells and obviously increase CD4 in tumor infiltrating lymphocytes⁺T cells and CD8⁺The number of T cells can effectively inhibit the increase of the volume of the nude mouse transplanted tumor; the honokiol provided by the invention can be used as a small molecule drug to be applied to the treatment of non-small cell lung cancer.

Drawings

FIG. 1 is a diagram showing the molecular docking results of honokiol and PD-L1; wherein A is 2D structural formula of honokiol; b is a docking mode display diagram of honokiol and PD-L1; c is an interaction result graph of honokiol and part of amino acid residues in the PD-L1 protein; d is a binding curve of honokiol and immobilized PD-L1 protein with different concentrations; e is a steady state analysis result graph of the binding curve; f is a graph of the binding affinity determination result of PD-L1 and honokiol.

FIG. 2 is a graph showing the results of Western blotting; wherein A is a graph of the expression result of PD-L1 protein of each cell in a control group; b is a result graph of the effect of honokiol on the expression of PD-L1 protein of H358 and H460 cells; c is a graph of the effect of 30. mu.M magnolol on the expression of PD-L1 mRNA in H358 and H460 cells; in the figure, p < 0.001.

FIG. 3 is a graph of the effect of honokiol on the expression of PD-L1 in H1975 cells; wherein A is a flow cytogram of the effect of different doses of honokiol on the expression of PD-L1 in H1975 cells; b is a graph of the statistical results of the effect of different doses of honokiol on the expression of PD-L1 in H1975 cells; in the figure, p <0.01 and p < 0.001.

FIG. 4 is a graph of the effect of honokiol on PD-L1 expression in H358 cells; wherein, A is a flow cytogram of the effect of different doses of honokiol on the expression of PD-L1 in H358 cells; b is a graph of the statistical results of the effect of different doses of honokiol on the expression of PD-L1 in H358 cells; in the figure, p < 0.001.

FIG. 5 is a graph of the effect of honokiol on the upregulation of expression of PD-L1 in IFN- γ stimulated H1975 cells; wherein A is a flow cytogram of the effect of honokiol on the up-regulation of IFN-gamma stimulation H1975 cell PD-L1 expression; b is a statistical result chart of the effect of honokiol on the up-regulation of IFN-gamma stimulation H1975 cell PD-L1 expression; in the figure, p < 0.001.

FIG. 6 is a graph of the effect of honokiol on IFN- γ stimulation of the upregulation of PD-L1 expression in H358 cells; wherein A is a flow cytogram of the effect of honokiol on the up-regulation of IFN-gamma stimulation H358 cell PD-L1 expression; b is a statistical result chart of the effect of honokiol on the up-regulation of IFN-gamma stimulated H358 cell PD-L1 expression; in the figure, p < 0.0001.

FIG. 7 is a graph showing the results of a nude mouse xenograft model; wherein A is a result graph of the change of the tumor volume of a mouse along with time in a nude mouse xenograft experiment; b is a mouse tumor living body imaging graph in a nude mouse xenograft experiment; c is a mouse tumor volume real-time image in a nude mouse xenograft experiment; d is a weight result graph of the mouse tumor in a nude mouse xenograft experiment; in the figure, p < 0.01.

FIG. 8 is a graph showing HE staining and immunohistochemistry results of mouse tumor in a nude mouse xenograft experiment.

FIG. 9 is a graph showing immunofluorescence results of mouse tumor tissues in a nude mouse xenograft experiment.

FIG. 10 is a diagram showing the results of flow sorting of mouse tumor cells in a nude mouse xenograft experiment; wherein A is a flow sorting result graph of mouse tumor infiltrating lymphocytes; b is a statistical result graph of flow sorting of mouse tumor infiltrating lymphocytes; in the figure, p <0.05 and p < 0.01.

Detailed Description

The present invention will now be described in detail with reference to specific examples, but the scope of the present invention is not limited thereto.

The materials, reagents and the like used in the present examples are commercially available materials and reagents unless otherwise specified. Wherein, the common RIPA lysate (tissue/cell) is purchased from Solarbio with the product number of R0020; 5 xSDS loading buffer purchased from Beyotime Biotechnology under Cat P0286; GAPDH is purchased from Sangon Biotech under the catalog number D110016; Anti-rabbitIgG, HRP-linked Antibody (Anti-rabbit secondary Antibody, HRP-labeled) was purchased from Cell Signaling Technology with a cat # 7074S; ECL luminescence kits were purchased from Beyotime Biotechnology under cat No. P0018 FS; the RNA extraction kit is purchased from Tiangen Biochemical technology (Beijing) Co., Ltd, and has a commodity number DP 430; the reverse transcription kit is purchased from Nanjing Novozan Biotechnology GmbH with the product number of R123-01; 2 × One Step

Green Mix was purchased from Nanjing Nodezam Biotechnology Inc., having a product number of Q221-01; LLC-LUC is purchased from Hu nan fenghui biotechnology Limited, and has a cargo number of CL 0720; paraformaldehyde, available from Sangon Biotech under the cat number a 500684; the sodium citrate antigen retrieval solution is purchased from Solarbio, and the cargo number is C1032; HRP-labeled anti-rabbit mice were purchased from Sangon Biotech under the cat number D601037; diaminobenzidine color developers are available from Sangon Biotech under the trade designation D601037; fluorescent secondary antibody was purchased fromThermo Fisher Scientific, cat # 35552; CD4 was purchased from Abcam under cat number ab 183685; CD8 was purchased from Abcam under cat number ab 217344; collagenase IV was purchased from Invitrogen under cat number 17104019; DNase I was purchased from Invitrogen under cat number 18047019; FITC anti-mouse CD4 was purchased from BioLegend under Cat number 100203; PE anti-mouse CD8 was purchased from BioLegend under the cat number 100707.

Example 1 molecular docking and biofilm interference techniques

1. Molecular docking

The 3D crystal structure of PD-L1(PDB ID:4ZQK) was taken from the RCSB PDB database (https:// www1.RCSB. org /), next the structural documentation of honokiol was taken from the Pubchem database (https:// PubChem. ncbi. nlm. nih. gov /), the water molecules and ligands originally in PD-L1 were removed by pymol2.3, the magnolol energy was minimized with ChemDraw19.0 software, finally docking was performed using Autodock based on Tyr56, Met115, Ala121, Tyr123, Gln66, Arg125, Lys124 of PD-L1, and finally the pattern of the docked complex and the interaction of the honokiol and PD-L1 residues was demonstrated using pymol 2.3.

The 2D structural formula of honokiol is shown in fig. 1 a, and the docking pattern of honokiol with PD-L1 is shown in fig. 1B, where the hydroxyl group of honokiol forms hydrogen-bond interactions with Met-115, the other bulk moieties are located in hydrophobic pockets, the hydrogen-bond interaction bond formed by honokiol with Met-115 is 2.85A long, while hydrophobic interactions (C in fig. 1) are formed with other residues of Asp-122, Ala-121, Tyr-56, etc. of the site, indicating that the interaction of honokiol with PD-L1 protein is dominated by hydrogen-bond interactions and locked in binding orientation by hydrophobic interactions.

2. Biofilm interference technique

Molecular interaction between honokiol and PD-L1 was detected using a biofilm interference technique (BLI), an Octet RED96 system manufactured by Pall ForteBio corporation. The specific experimental process is as follows: 10 μ g of PD-L1 protein (purchased from R & D Systems, cat # 156-B7-100) was immobilized on the SA sensor through four steps of equilibration (300s), binding (600s), dissociation (180s) and equilibration (300 s); the honokiol was formulated into 200 μ M stock solution using PBS pH6.5, and the stock solution was diluted with PBS to 200 μ M, 100 μ M, 50 μ M, 25 μ M concentration gradients, different concentrations of honokiol were bound to a sensor labeled with PD-L1, response values were obtained similarly through four steps of equilibration (300s), binding (600s), dissociation (180s) and equilibration (300s), data were collected in real time, data Analysis was performed using ForteBio Date Analysis software, and KD values were calculated.

By detecting the interaction of honokiol and PD-L1 by utilizing a biomembrane interference technology, the binding curve of honokiol and immobilized PD-L1 protein with different concentrations (200 muM, 100 muM, 50 muM and 25 muM) is shown as D in FIG. 1, the binding signal is gradually reduced along with the increase of the concentration of the honokiol, and the binding signal has concentration gradient dependence, thereby indicating the inhibition effect under different honokiol concentrations. In FIG. 1, E is a steady state analysis of a binding curve of honokiol and immobilized PD-L1 protein, and F is a binding affinity (KD) determination result of PD-L1 and honokiol in FIG. 1, which shows that the binding affinity constant (KD) of PD-L1 and honokiol is 60 μ M.

Example 2 Effect of honokiol on expression of PD-L1 in Lung cancer tumor cells

1. Cell culture

6 stable human non-small cell lung cancer cell strains H1975 (cell line number: CRL-5908), H1650 (cell line number: CRL-5883), H460 (cell line number: HTB-177), H1299 (cell line number: CRL-5803), H358 (cell line number: CRL-5807) and A549 (cell line number: CCL-185) and 1 human normal lung epithelial cell BEAS-2B (cell line number: CRL-9609) (all cell lines are purchased from American culture Collection) are selected and cultured respectively, after the cells enter logarithmic growth phase, the cells are digested by 0.25% pancreatin the number of 5 multiplied by 10⁴The density was evenly distributed into 6cm diameter cell culture dishes, 3mL of RPMI-1640 medium (containing 10% inactivated calf serum, 100U/L of penicillin-streptomycin) was added to each dish, and the mixture was placed in a constant temperature incubator (37 ℃ C., 5% CO)₂) Culturing in medium. After the cells are completely attached to the wall, the cell strains are divided into a control group (without Honokiol) and a Honokiol (Honokiol) treatment group (the acting doses of Honokiol are respectively 0 mu M, 10 mu M, 20 mu M, respectively,30 μ M), 3 replicates, and incubation continued for 24h until use.

2. Western blot

1) Preparation of protein samples: collecting the cells of the control group cultured for 24h, adding a common RIPA lysate (tissue/cell) to lyse each cell strain, and extracting the total protein of each cell strain;

2) protein denaturation: adding 20 μ L of total protein sample into centrifuge tube, adding 5 μ L of 5 xSDS buffer, boiling for 5 min;

3) 20 μ g of boiled total protein sample and 1 μ of LMaker (purchased from Sangon Biotech, cat. No. C510010, molecular weight 10-180 KD) were subjected to SDS-PAGE gel electrophoresis (separation gel 10%, concentrated gel 5%);

4) transferring the protein sample on the gel to a PVDF membrane soaked in methanol after the electrophoresis is stopped;

5) immersing the transferred PVDF membrane into 5% BSA for sealing for 1h at room temperature;

6) primary antibody hybridization: the blocked PVDF membrane was immersed in a primary antibody (PD-L1 or GAPDH, GAPDH being an internal reference protein, PD-L1 purchased from ABClonal, cat # A1645) working solution (prepared with 5% BSA 1: 1000), incubated at 4 ℃ for 12 hours, taken out, washed 3 times in TBST, each time for 5 min;

(7) and (3) secondary antibody incubation: immersing the PVDF membrane into an enzyme-labeled secondary Antibody (Anti-rabbit IgG, HRP-linked Antibody) solution (prepared by 5% BSA 1: 2000), incubating for 1 hour at room temperature, and washing in TBST for 5min for 3 times;

8) and detecting by using an ECL luminescence kit.

By detecting the expression of the PD-L1 protein in human non-small cell lung cancer cells H1975, H1650, H460, H1299, H358, A549 and human normal lung epithelial cell BESA-2B, the result is shown in A in figure 2, and compared with the expression of the PD-L1 protein in human normal lung epithelial cell BEAS-2B, the H1975, H460 and H358 cells show strong expression of the PD-L1 protein, while the H1299 cells and A549 cells show weak expression of the PD-L1 protein.

The above experiment (western blotting) was repeated by selecting cells of a honokiol treatment group (the dose of honokiol is 30 μ M) of cell strains (H358 cells and H460 cells) with strong expression of PD-L1 protein, and the effect of honokiol on tumor cell PD-L1 expression was tested, and the results are shown in B in fig. 2, where the expression of PD-L1 in the H358 cells and H460 cells of the treatment group was down-regulated, indicating that honokiol can inhibit the expression of PD-L1 in H358 cells and H460 cells, and especially has strong inhibitory effect on the expression of PD-L1 in H460 cells.

qPCR assay

The influence of honokiol on the gene transcription of PD-L1 of H460 cells and H358 cells is determined by utilizing qPCR, and the specific steps are as follows:

1) total RNA extraction (according to the RNA extraction kit instructions)

Washing H460 cells and H358 cells of H460 cells, H358 cells and honokiol treated group (the dose of honokiol is 30 μ M) with PBS three times, adding 1mL of Tdizol, and repeatedly blowing to lyse all cells; add 200. mu.L CCl₄The solution was allowed to separate into layers and centrifuged at 12000rpm at 4 ℃ for 15 min. Taking the upper layer liquid into a centrifuge tube, adding 500 mu L of isopropanol, uniformly mixing, and centrifuging at 4 ℃ and 12000rpm for 10 min; discarding the supernatant, adding 1mL of 75% ethanol, shaking, centrifuging at 4 deg.C and 12000rpm for 5min, discarding the supernatant, and placing on a super clean bench for ventilation drying; after complete drying, adding 30 mu L DEPC-DDW to completely dissolve the DEPC-DDW, and measuring the RNA concentration of each cell strain by using a Biotek Take 3 micro-detection plate;

2) reverse transcription of tumor cell RNA into cDNA by reverse transcription kit

a. Removal of genomic DNA:

taking 1 μ g of RNA obtained in step 1), adding 4 μ L of 4 Xg DNA wiper Mix, and supplementing RNase-free ddH₂O till the total volume of the system is 16 mu L, mixing uniformly, and incubating for 2min at 42 ℃;

reverse transcription of RNA into cDNA:

adding 4 mu L of 5 xqqRTSupermix II into the reaction system in the step a, mixing uniformly, and carrying out reverse transcription according to the following RT-PCR program: 15min at 50 ℃ and 2min at 85 ℃, diluting the cDNA product by 10 times after the reaction is finished, and storing at-80 ℃.

3) Detection of transcriptional levels of PD-L1 and internal reference GAPDH by qPCR

Detection was performed with a fluorescent quantitative PCR instrument (Roche) according to the following reaction system and procedure:

PD-L1 primer:

an upstream primer F: GCTGCACTAATTGTCTATTGGGA (SEQ ID NO: 1);

a downstream primer R: AATTCGCTTGTAGTCGGCACC (SEQ ID NO: 2).

GAPDH primer:

an upstream primer F: GGAGCGAGATCCCTCCAAAAT (SEQ ID NO: 3);

a downstream primer R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 4).

qPCR reaction system: 2 × One Step

5 mu L of Green Mix, 0.5 mu L of upstream primer (with the concentration of 5 mu M), 0.5 mu L of downstream primer (with the concentration of 5 mu M), 4 mu L of cDNA and 10 mu L of total volume;

qPCR reaction procedure: 5min at 95 ℃; 30s at 94 ℃, 30s at 58 ℃ and 30s at 72 ℃, and N cycles; 65 ℃ for 1min, 40 ℃ for 30s, wherein, when amplifying PD-L1, N is 38, and when amplifying GAPDH, N is 30.

The results of qPCR are shown in fig. 2C, and the expression of mRNA of PD-L1 was significantly reduced (p <0.001) in H358 cells and H460 cells after honokiol treatment compared to H358 cells and H460 cells without honokiol treatment, indicating that honokiol has a significant inhibitory effect on mRNA expression in PD-L1 in H358 cells and H460 cells.

4. Flow cytometry

The method for determining the influence of honokiol on the expression of PD-L1 in human non-small cell lung cancer cell strains H1975 and H358 by using flow cytometry comprises the following specific steps:

1) h358 cells and H1975 cells (not treated with honokiol) were separately harvested at the logarithmic growth phase and plated in 12-well plates, 1X 10 cells per well⁵Cells in an incubator (37 ℃, 5% CO)₂) Culturing for 12 h;

2) the experiments were divided into two major groups: the first major group: dividing H1975 cells and H358 cells into four groups, respectively, and treating with honokiol 0 μ M, 10 μ M, 20 μ M, and 30 μ M; the second major group: dividing H1975 cells and H358 cells into three groups, namely a control group (without honokiol and IFN-gamma), a 20ng IFN-gamma treatment group, a 20ng IFN-gamma and a 30 mu M honokiol co-treatment group;

3) continuously culturing for 24h, digesting the cells with pancreatin, collecting the cells, uniformly mixing the cells with PBS, and collecting the cells into a 1.5mL centrifuge tube;

4) centrifuging at 4 deg.C and 1000rpm for 5min, resuspending the cells with PBS to a cell concentration of 1X 10⁶Per mL;

5) 2 μ L of PD-L1 antibody (purchased from BioLegend, cat # 393606) was added to each sample and incubated on ice for 30min in the absence of light;

6) centrifugation was carried out at 1000rpm at 4 ℃ for 5min, the supernatant was discarded, and the cells were washed twice with PBS and resuspended in 500. mu.L of PBS (cell concentration: 2X 10)⁵one/mL) were detected on a flow cytometer (Beckman Coulter, CytoFLEX S).

Human non-small cell lung cancer H1975 cells and H358 cells were treated with 4 concentration gradients of honokiol of 0 μ M, 10 μ M, 20 μ M and 30 μ M, and the results are shown in fig. 3 and 4, and the expression level of PD-L1 in H1975 cells and H358 cells was more significantly down-regulated with increasing dose of honokiol, indicating that honokiol can inhibit the expression of PD-L1 in H1975 cells and H358 cells and is dose-dependent; compared with the control group, the expression level of PD-L1 in H1975 cells and H358 cells is obviously increased under IFN-gamma stimulation, while the expression level of PD-L1 in H1975 cells and H358 cells is reduced under IFN-gamma honokiol co-treatment (FIG. 5 and FIG. 6), which indicates that the honokiol obviously inhibits IFN-gamma-induced up-regulation of PD-L1 expression in H1975 cells and H358 cells (p < 0.001).

Example 3 nude mouse graft tumor model

1. Mouse transplantation tumor experiment

The mice transplantation tumor experiments involved animal experiments conducted according to protocols approved by the animal ethics committee and committee of the university of medical Guangdong. Resuspending mouse lung carcinoma cell-luciferase labelled (LLC-LUC) cells in FBS-free medium (cell concentration 1X 10)⁶one/mL) and injected subcutaneously at 100 μ L into 6-week-old athymic nude mice to establish a nude mouse transplantation tumor model. Tumor graft growth to about 60mm³Thereafter, the mice were administered with the solvent (control group: 2% DMSO, Ab. RTM.). sup40% PEG400 and 2% Tween 80 in saline, 0.2 mL/day; administration group: honokiol 20 mg/kg/day, honokiol dissolved in 2% DMSO, 40% PEG400 and 2% Tween 80 in normal saline solution), each group of 4 mice, continuous injection for 14 days. The length and width of the tumor of the mouse were measured every 3 days using a digital caliper, and the tumor volume (mm) was calculated using the following formula³): volume (mm)³) Length (mm) × width (mm)²×π÷6。

In a nude mouse transplantation tumor model, within 0-6 days, the change conditions of the tumor volumes of a control group mouse and an administration group mouse are approximately the same, after more than 6 days, the growth of the tumor of the control group mouse is gradually accelerated, the tumor volume is gradually increased, and the growth of the tumor of the administration group mouse is relatively smooth (A in figure 7); after 14 days of continuous treatment, the tumors were imaged in vivo using a live imager, and the volume of the tumors in the control mice was significantly greater than the volume of the tumors in the mice of the administered group (B in FIG. 7). The tumor in each mouse was removed, and the results are shown in fig. 7, C and D, where the volume and weight of the tumor in the mice of the administration group were significantly greater than those of the tumors in the mice of the control group, indicating that honokiol could significantly inhibit the increase in the volume of the transplanted tumor in nude mice.

HE staining and immunohistochemistry

HE (hematoxylin-eosin) staining: tumor tissues of a control group mouse and a dosing group mouse are respectively washed 3 times by PBS, soaked in 4% Paraformaldehyde (PFA) for fixation for 48 hours, and after fixation is finished, the tumor tissues are embedded by paraffin and then sliced, and the slices are stained by an HE staining method, and finally, images are photographed by a microscope.

Immunohistochemistry: washing tumor tissues of a control group mouse and an administration group mouse with PBS for 3 times respectively, soaking the tumor tissues in 4% PFA for fixation for 48h, preparing a paraffin section, transferring the paraffin section onto a glass slide, baking the section in a constant temperature box at 60 ℃ for 1h before dewaxing, taking out the section, and placing the section in xylene and gradient ethanol for gradual dewaxing and hydration (the specific flow is that the section is sequentially soaked in xylene for 20 min-absolute ethanol for 1 min-95% ethanol for 1 min-85% ethanol for 1 min-75% ethanol for 1 min-50% ethanol for 1 min-distilled water for 5 min); hydrating and slicingPlacing in boiling sodium citrate antigen repairing solution (1 ×) for 10 min; cooling the section to room temperature after antigen retrieval, then soaking and washing the section for 2 times with PBS (5 min each time), placing the section in a wet box after the soaking and washing of the PBS, and dripping 3% H (completely covering the section) on the section tissue₂O₂Incubating the solution at room temperature in dark for 15 min; soaking and washing with PBS for 3 times, each for 5min, placing the slices in a wet box, adding dropwise (completely covering the slices) goat serum onto the slice tissues, sealing for 30min, removing goat serum after 30min, adding 100 μ L of primary antibody working solution CD4 and CD8 (both prepared with PBS 1: 200) onto the slices, and incubating at 4 deg.C overnight; taking out the wet box, rewarming at room temperature for 40min the next day, washing the section in PBS for 3 times, 5min each time, adding 25 μ L secondary antibody (HRP-labeled mouse anti-rabbit), and incubating at 37 deg.C for 30 min; washing the slices with PBS for 3 times, each time for 5min, adding diaminobenzidine (3, 3' -DAB) color-developing agent dropwise (covering the slices completely), acting for 10min, adding hematoxylin dropwise for counterstaining for 5min, dehydrating and transparentizing the stained slices with gradient ethanol and dibenzyl (the specific process is that the slices are sequentially immersed in 50% ethanol for 1 min-75% ethanol for 1 min-85% ethanol for 1 min-95% ethanol for 1 min-absolute ethanol for 1 min-xylene for 2min), sealing the stained slices with neutral gum, and taking images under microscope.

By HE staining the tumor tissue, the result is shown in figure 8, the tumor cells in the tumor tissue of the control group are crowded and overlapped compared with the tumor cells in the tumor tissue of the mice of the administration group, and the result shows that honokiol has obvious inhibition effect on the proliferation of the tumor cells of the nude mice; the expression levels of CD4 and CD8 in tumor tissues of mice in the administration group and the control group were compared by using immunohistochemistry (fig. 8), in which the tan reaction product was the distribution of antigen, i.e., the tan fraction was CD4⁺T cells and CD8⁺T cells, as can be seen, CD4 in the tumor of mice in the administration group⁺T cells and CD8⁺The number of T cells is obviously increased compared with that of a control group, and the fact that honokiol can obviously increase CD4 in mouse tumor tissues is shown⁺T cells and CD8⁺The number of T cells.

3. Tissue immunofluorescence

Tumor tissues of the control group mouse and the administration group mouse were washed 3 times with PBS, respectively, soaked in 4% PFA for fixation for 48h, and paraffin sections were prepared and transferred onto glass slides. Placing the slices in a constant temperature oven at 60 deg.C for 1h before dewaxing, taking out the slices, placing in xylene and gradient ethanol for gradually dewaxing and hydrating (the specific flow is that the slices are sequentially immersed in xylene for 20 min-absolute ethanol for 1 min-95% ethanol for 1 min-85% ethanol for 1 min-75% ethanol for 1 min-50% ethanol for 1 min-distilled water for 5 min); placing the slices into a sodium citrate antigen repairing solution which is heated to boiling after hydration, wherein the repairing time is 10 min; cooling the section to room temperature after antigen retrieval, then rinsing 3 times with 0.1% PBST for 5min each, then placing the section in a wet box, dropping goat serum on the section tissue for sealing for 30min, removing the goat serum after 30min, dropping 100 μ L PD-L1 antibody (purchased from BioLegend, Cat. No. 393606) working solution (prepared with 5% BSA 1: 300) on the section, and placing in a wet box for overnight incubation at 4 ℃; washing the slices with PBS for 5min for 3 times, adding 50 μ L of fluorescent secondary antibody diluent (prepared with PBS 1: 1000), incubating at room temperature in dark for 1 hr, and washing with PBS for 5min for 3 times; finally, 50. mu.L of anti-quenching mounting solution (prepared from PBS and glycerol 1: 1) is added on each section, a cover glass is covered on the mounting solution, the section is stored at 4 ℃ in a dark place, observed under a laser confocal microscope, and photographed to record the result.

By carrying out immunofluorescence staining on the tumor tissues of the control group mice and the tumor tissues of the administration group mice, the result shows that the expression of PD-L1 in the tumor tissues of the administration group mice is obviously reduced compared with the expression of PD-L1 in the tumor tissues of the control group mice (figure 9), and the result shows that the expression of PD-L1 in the tumor tissues of the mice can be obviously reduced by honokiol.

4. Flow cytometric sorting of tumor infiltrating lymphocytes

Soaking tumor tissues of control mice and administration mice in PBS, removing peripheral blood clot, fat and necrotic tissue, cleaning with PBS, and cutting into 1mm³Size, immersed in RPMI-1640 serum-free medium solution containing collagenase IV (200U/mL) and DNase I (40U/mL), water at 37 ℃Bath for digestion for 45 min. After digestion, filtering the supernatant with a cell screen with a pore size of 70 μm, washing the screen with RPMI-1640 medium (containing 2mmol/L EDTA) solution, centrifuging the filtrate at 1500rpm for 5min, discarding the supernatant to obtain tumor-infiltrating lymphocytes, and suspending in FACS buffer (PBS containing 2% FBS and 2mM EDTA); each flow-type detection tube was filled with 100. mu.L of cell suspension (5X 10)⁵～10×10⁵One/tube), 2 μ L of fluorescence labeled antibody FITC anti-mouse CD4 and 2 μ L of fluorescence labeled antibody PE anti-mouse CD8 were added for double staining, incubated on ice for 15min, cells were washed with PBS, repeated 2 times, 500 μ L FACS buffer was added to resuspend the cells, and detection was performed in a flow cytometer (Beckman Coulter, CytoFLEX S).

The flow-sorting of the tumor-infiltrating lymphocytes by the flow cytometry technique was carried out, and the results are shown in FIG. 10, in which CD4 was present in the tumor-infiltrating lymphocytes of the mice of the administration group⁺T cells and CD8⁺The number of T cells is obviously higher than that of CD4 in tumor infiltrating lymphocytes of a control group⁺T cells and CD8⁺The number of T cells is large, and the results show that honokiol can effectively increase CD4 in tumor infiltrating lymphocytes of mice⁺T cells and CD8⁺T cell number.

The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

SEQUENCE LISTING

<110> southern China laboratory of Guangdong province in ocean science and engineering (Zhanjiang)

Guangdong Zhanjiang Institute of marine medicine

Application of <120> honokiol in preparation of medicine for inhibiting expression of PD-L1

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence

<400> 1

gctgcactaa ttgtctattg gga 23

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<400> 2

aattcgcttg tagtcggcac c 21

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

ggagcgagat ccctccaaaa t 21

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<400> 4

ggctgttgtc atacttctca tgg 23

Claims

1. Application of honokiol or pharmaceutically acceptable salt thereof in preparing PD-L1 inhibitor is provided.

2. The use of claim 1, wherein the PD-L1 inhibitor is an agent that inhibits tumor PD-L1 expression.

3. The use of claim 1, wherein the PD-L1 inhibitor is an agent that inhibits the upregulation of interferon-induced tumor PD-L1 expression.

4. Application of honokiol or pharmaceutically acceptable salt thereof in preparing medicine for inhibiting tumor cell proliferation is provided.

5. Application of honokiol or pharmaceutically acceptable salt thereof in preparing medicine for increasing CD4 in tumor infiltrating lymphocytes⁺T cells and CD8⁺Use in medicine for T cell numbers.

6. Application of honokiol or pharmaceutically acceptable salt thereof in preparing medicine for inhibiting tumor volume increase is provided.

7. Application of honokiol or pharmaceutically acceptable salt thereof in preparing antitumor drugs is provided.

8. The use according to any one of claims 2 to 7, wherein the tumour is selected from at least one of breast cancer, lung cancer and liver cancer.

9. A medicament for inhibiting PD-L1 expression comprising honokiol or a pharmaceutically acceptable salt thereof.

10. The medicament according to claim 9, wherein the concentration of honokiol or the pharmaceutically acceptable salt thereof is 5 to 40 μ M.