CN113718048A

CN113718048A - Reagent and kit for detecting toxoplasma gondii through isothermal amplification and application of reagent and kit

Info

Publication number: CN113718048A
Application number: CN202111141668.4A
Authority: CN
Inventors: 张仁利; 陈木新; 黄达娜; 张岩; 艾琳; 陈燕旌; 唐屹君; 边素莹; 邓少玉; 林梓丹; 张倩; 陈家旭; 朱兴全; 苏川; 周晓农
Original assignee: Shenzhen Center For Disease Control And Prevention (shenzhen Health Inspection Center Shenzhen Institute Of Preventive Medicine); National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Current assignee: Shenzhen Center For Disease Control And Prevention (shenzhen Health Inspection Center Shenzhen Institute Of Preventive Medicine); National Institute of Parasitic Diseases of Chinese Center for Disease Control and Prevention
Priority date: 2021-09-28
Filing date: 2021-09-28
Publication date: 2021-11-30

Abstract

The application relates to the technical field of molecular biological detection, and provides a reagent and a kit for detecting toxoplasma gondii through isothermal amplification and application of the reagent and the kit. The reagent for detecting toxoplasma gondii by isothermal amplification comprises a loop-mediated isothermal nucleic acid amplification primer group for detecting toxoplasma gondii: the loop-mediated isothermal nucleic acid amplification primer group has strong specificity and can effectively distinguish other plasmodium species in plasmodium, so that the reagent has high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when used for detecting toxoplasma gondii.

Description

Reagent and kit for detecting toxoplasma gondii through isothermal amplification and application of reagent and kit

Technical Field

The application belongs to the technical field of molecular biology detection, and particularly relates to a reagent and a kit for detecting toxoplasma gondii through isothermal amplification and application of the reagent and the kit.

Background

Toxoplasma gondii is an intracellular parasite with a wide range of parasitism, including almost all warm-blooded vertebrates. Toxoplasmosis is a parasitic disease caused by toxoplasma gondii which is suffered from human and livestock together, and is susceptible to domestic animals such as pigs, cats, dogs, cattle and sheep, the infection rate can reach 10% -50%, and the development of animal husbandry is seriously influenced. As human beings can infect Toxoplasma gondii through contaminated food and water, closely contact with felines and the like, about 10 hundred million people are reported to infect Toxoplasma gondii all over the world, the positive rate of human antibody is 25% -50%, most people are recessive infection, after people with normal immunity are infected with Toxoplasma gondii, under the action of the body immune system, a host does not show obvious clinical symptoms, however, for patients with low immune function, such as organ transplantation patients, AIDS patients and the like, the Toxoplasma gondii is infected with high risk, even leads to the death of the host, and seriously affects the human health.

Currently, a variety of different Polymerase Chain Reaction (PCR) tests are available for detecting toxoplasma gondii DNA, and this particular method can detect toxoplasma gondii with very low parasite content, however PCR requires fluorescent dyes and detection requires professional operation and expensive instruments. In addition, the existing method for extracting nucleic acid of a sample to be detected needs expensive and inconvenient-to-carry instruments such as a pipettor, a gun head, a centrifuge, a constant-temperature metal bath and a PCR instrument, and the extraction needs professional operation by professional personnel.

Therefore, the existing extraction of nucleic acid from a sample to be detected and PCR have the problems of needing professional operation, high cost and inconvenient detection.

Disclosure of Invention

The application aims to provide a reagent and a kit for detecting toxoplasma gondii by isothermal amplification and application thereof, and aims to solve the problems that the nucleic acid extraction and the fluorescence PCR detection of a sample to be detected in the prior art need to be operated by professional personnel, the cost is high and the detection is inconvenient.

In order to achieve the purpose of the application, the technical scheme adopted by the application is as follows:

in a first aspect, the present application provides a reagent for isothermal amplification detection of toxoplasma gondii, which comprises the following loop-mediated isothermal nucleic acid amplification primer sets for detecting toxoplasma gondii:

a first outer primer SEQ ID No.1, a second outer primer SEQ ID No.2, a first inner primer SEQ ID No.3, a second inner primer SEQ ID No.4, a first loop primer SEQ ID No.5 and a second loop primer SEQ ID No. 6.

In a second aspect, the present application provides a kit for isothermal amplification detection of toxoplasma gondii, which comprises the reagent for isothermal amplification detection of toxoplasma gondii of the present application.

In a third aspect, the present application provides a method of detecting Toxoplasma gondii, comprising the steps of:

obtaining nucleic acid of a sample to be detected;

mixing the nucleic acid of the sample to be detected with the reagent or the isothermal amplification reagent provided by the kit and performing loop-mediated isothermal nucleic acid amplification treatment;

and (3) displaying the color according to the pH dye contained in the mixed solution subjected to the loop-mediated isothermal nucleic acid amplification treatment, and directly judging the result by naked eyes.

The loop-mediated isothermal nucleic acid amplification primer group contained in the reagent for detecting toxoplasma gondii through isothermal amplification has strong specificity, and can effectively distinguish other plasmodium species in plasmodium, so that the reagent has high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when used for detecting toxoplasma gondii. Meanwhile, the loop-mediated isothermal nucleic acid amplification primer group has isothermal nucleic acid amplification characteristics, and a visual isothermal amplification reagent of a pH dye can be directly added into the reagent to form a loop-mediated isothermal nucleic acid amplification system, so that the reagent can directly judge the result by observing the color change with naked eyes, and therefore toxoplasma gondii can be simply and rapidly detected, the detection has a wider performance scene, and the in-situ detection capability is better.

According to the kit for detecting toxoplasma gondii through isothermal amplification provided by the second aspect of the application, the kit comprises the reagent for detecting toxoplasma gondii through isothermal amplification, so that the kit has the advantages of high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when being used for detecting toxoplasma gondii; meanwhile, the loop-mediated isothermal nucleic acid amplification primer group has isothermal nucleic acid amplification characteristics, so that the reagent can be used for simply and rapidly detecting toxoplasma gondii; when the kit contains the visual constant-temperature amplification reagent, the kit can also realize direct result judgment by observing color change with naked eyes, so that professionals and professional instruments are not needed when the kit is used for detecting the toxoplasma gondii, the detection has a wider play scene, and the in-situ detection capability is better.

According to the method for detecting Toxoplasma gondii provided by the third aspect of the application, the nucleic acid of the sample to be detected is obtained, the nucleic acid of the sample to be detected is mixed with the reagent provided by the application or the isothermal amplification reagent provided by the kit, loop-mediated isothermal nucleic acid amplification treatment is carried out, the color is displayed according to the pH dye contained in the mixed solution of the loop-mediated isothermal nucleic acid amplification treatment, and the result is directly judged by naked eyes. The method for detecting the Toxoplasma gondii has the advantages that the kit is used for detection, so that the method for detecting the Toxoplasma gondii is high in sensitivity, good in repeatability, low in false negative and false positive, and high in detection accuracy, and can directly carry out result judgment by observing the color change of a PCR amplification reaction system through naked eyes, and therefore, the method for detecting the Toxoplasma gondii does not need to depend on professionals and professional instruments, and the method for detecting the Toxoplasma gondii has a wider performance scene and better on-site detection capability.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a color photograph of LAMP amplification result of Toxoplasma gondii positive quality control (concentration is 1000 copies/. mu.L) and nuclease-free water negative quality control provided in the examples of the present application; no.1 to No.3 are final color development photographs of the toxoplasma gondii positive quality control product amplification system; no.4 is a final color development picture of the nuclease-free water negative quality control product amplification system;

FIG. 2 is a LAMP amplification result of concentration gradient at 1000 copies/. mu.L (copies/. mu.L), 500 copies/. mu.L (copies/. mu.L), 50 copies/. mu.L (copies/. mu.L) of Toxoplasma gondii positive quality control material provided in the embodiment of the present application and a LAMP amplification result color developing photograph of a detection primer set of Toxoplasma gondii without nuclease water negative quality control material; no.1 is a final color development picture of an amplification system with the concentration of 1000 copies/. mu.L; no.2 is the final color developing picture of the amplification system with the concentration of 500 copies/. mu.L; 3, a final color developing photo of an amplification system with the concentration of 50 copies/. mu.L; no.4 is a final color development picture of the nuclease-free water negative quality control product amplification system;

FIG. 3 is a chromogenic photograph showing the result of LAMP primer amplification of "positive quality control" of Toxoplasma gondii provided in the examples of the present application; the number 1 is the final chromogenic photograph of the LAMP primer LAMP amplification system of Toxoplasma gondii;

FIG. 4 is a color photograph showing the result of LAMP primer amplification "nuclease-free water" of Toxoplasma gondii provided in the examples of the present application; no.1 is a final chromogenic photograph of an LAMP primer LAMP amplification system of Toxoplasma gondii.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present application more clearly apparent, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present application and are not intended to limit the present application.

In this application, the term "and/or" describes an association relationship of associated objects, meaning that there may be three relationships, e.g., a and/or B, which may mean: a is present alone, A and B are present simultaneously, and B is present alone. Wherein A and B can be singular or plural. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.

In the present application, "at least one" means one or more, "a plurality" means two or more. "at least one of the following" or similar expressions refer to any combination of these items, including any combination of the singular or plural items. For example, "at least one (a), b, or c", or "at least one (a), b, and c", may each represent: a, b, c, a-b (i.e., a and b), a-c, b-c, or a-b-c, wherein a, b, and c may be single or plural, respectively.

It should be understood that, in various embodiments of the present application, the sequence numbers of the above-mentioned processes do not mean the execution sequence, some or all of the steps may be executed in parallel or executed sequentially, and the execution sequence of each process should be determined by its function and inherent logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.

The terminology used in the embodiments of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. As used in the examples of this application and the appended claims, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

The weight of the related components mentioned in the description of the embodiments of the present application may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, the content of the related components is scaled up or down within the scope disclosed in the description of the embodiments of the present application as long as it is scaled up or down according to the description of the embodiments of the present application. Specifically, the mass described in the specification of the embodiments of the present application may be a mass unit known in the chemical industry field such as μ g, mg, g, kg, etc.

The terms "first" and "second" are used for descriptive purposes only and are used for distinguishing purposes such as substances from one another, and are not to be construed as indicating or implying relative importance or implying any number of technical features indicated. For example, a first XX may also be referred to as a second XX, and similarly, a second XX may also be referred to as a first XX, without departing from the scope of embodiments of the present application. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature.

Description of the technical nomenclature to which this application relates:

loop-mediated isothermal nucleic acid amplification technique: (Loop-mediated isothermal amplification, LAMP) is an isothermal nucleic acid amplification method, which utilizes a strand displacement DNA polymerase (Bst DNA polymerase) and a plurality of pairs of specific primers to specifically recognize 6 independent regions on a target sequence and complete a nucleic acid amplification reaction under isothermal conditions.

According to a first aspect of the embodiments of the present application, a reagent for detecting toxoplasma gondii by isothermal amplification (hereinafter, referred to as a reagent for short) is provided. The reagent comprises a primer sequence designed according to the toxoplasma gondii target gene, and therefore, the reagent comprises a loop-mediated isothermal nucleic acid amplification primer set for detecting toxoplasma gondii.

The loop-mediated isothermal nucleic acid amplification primer group for detecting Toxoplasma gondii comprises the following primers:

a first outer primer SEQ ID No.1, a second outer primer SEQ ID No.2, a first inner primer SEQ ID No.3, a second inner primer SEQ ID No.4, a first loop primer SEQ ID No.5 and a second loop primer SEQ ID No. 6. Wherein, the sequence of the first outer primer is SEQ ID No.1 and is gtgtcacgttttttgtcaga; the sequence of the second outer primer is SEQ ID No.2 and is agagttcgtcggtgtttg; the sequence of the first inner primer is SEQ ID No.3 and is tggagacgaacacgctagagcacttcactttgtgcagaagca; the sequence of the second inner primer is SEQ ID No.4 and is tacaaaagagaacattccagcaactaaagataggagggaggcg; the sequence of the first loop primer is SEQ ID No.5 and is tgttgcagtttggacgggc; the sequence of the second loop primer is SEQ ID No.6 and is tctgcctttgttcttttagcct.

Therefore, the reagent disclosed by the embodiment of the application contains the loop-mediated isothermal nucleic acid amplification primer group of the Toxoplasma gondii, and the primer group does not produce nonspecific amplification and has strong specificity, so that the reagent disclosed by the embodiment of the application has high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when being used for detecting the Toxoplasma gondii. Meanwhile, the loop-mediated isothermal nucleic acid amplification primer group has isothermal nucleic acid amplification characteristics, and a visual isothermal amplification reagent of a pH dye can be directly added into the reagent to form a loop-mediated isothermal nucleic acid amplification system, so that the reagent can directly judge the result by observing color change with naked eyes to simply and rapidly detect toxoplasma gondii, and the detection has a wider play scene and better in-situ detection capability.

In some embodiments, specific sequences of the sequences SEQ ID No.1 of the first outer primer to SEQ ID No.6 of the second loop primer are shown in table 1 below. The loop-mediated isothermal nucleic acid amplification primer group for detecting the Toxoplasma gondii is designed according to Toxoplasma gondii target genes, and the Toxoplasma gondii target genes can be obtained according to gene resources. The Toxoplasma gondii target gene is B1 gene, the full length of B1 gene is about 2100bp, and the Toxoplasma gondii target gene can be directly obtained from GenBank. Wherein the Toxoplasma gondii primer design region is between 1200-1600bp of the B1 gene. Specifically, the primer design region sequence of the Toxoplasma gondii target sequence B1 gene is SEQ ID No. 7.

Specifically, the specific sequences of SEQ ID nos. 1 to 7 described above are shown in table 1 below:

TABLE 1

In some embodiments, the first outer primer SEQ ID No.1 and the second outer primer SEQ ID No.2 are used in a concentration range of 1.0 to 2.5. mu.M; the using concentration ranges of the first inner primer SEQ ID No.3 and the second inner primer SEQ ID No.4 are both 45-70 mu M; the first loop primer SEQ ID No.5 and the second loop primer SEQ ID No.6 were used in a concentration range of 10-30. mu.M. In a specific embodiment, the first outer primer SEQ ID No.1 and the second outer primer SEQ ID No.2 are used in a concentration of 1.8. mu.M; the using concentration of the first inner primer SEQ ID No.3 and the second inner primer SEQ ID No.4 is 57.6 mu M; the first loop primer SEQ ID No.5 and the second loop primer SEQ ID No.6 were used at a concentration of 20. mu.M each. In the embodiment, the proper concentration range of the primers is set, so that the toxoplasma gondii gene sequence can be quickly subjected to amplification reaction, the reaction efficiency is enhanced, and the identification efficiency is further improved.

In a further embodiment, the reagent of the embodiment of the present application further includes a visual isothermal amplification reagent, where the visual isothermal amplification reagent includes the following components:

polymerase, pH dye, isothermal amplification buffer.

Specifically, the polymerase is Bst polymerase, and the concentration of Bst polymerase is in the range of 0.3-0.4U/. mu.L, and in one embodiment, the concentration of Bst polymerase may be 0.4U/. mu.L. The Bst polymerase can effectively promote LAMP amplification of the loop-mediated isothermal nucleic acid amplification primer groups from SEQ ID No.1 to SEQ ID No.6, and enables a pH dye to rapidly and flexibly generate a color reaction, so that the result can be directly judged by naked eyes.

Specifically, the pH dye is m-cresol purple; the concentration of m-cresol purple can range from 0.1 to 0.5mmol/L, and in one embodiment, the concentration of m-cresol purple can be 0.4 mmol/L. The m-cresol purple can flexibly change color according to the change of the pH value of a PCR amplification reaction system as a result display agent, so that the detection accuracy and sensitivity are improved, and the convenience and rapidness of result judgment are improved.

Specifically, the isothermal amplification buffer comprises components required by LAMP amplification, wherein the isothermal amplification buffer comprises KCL and MgSO₄Tween 20, dNTPs and nuclease-free water (such as sterile water), wherein the concentration range of KCL is 50-80mmol/L, MgSO₄In the concentration range of 0.4-0.8mmol/L, dNTPs in the concentration range of 0.4-1.6mmol/L, Tween 20 in the concentration range of 0.1% -0.6%, KCL in one embodiment in the concentration of 65mmol/L, MgSO₄The concentration of (3) can be 0.6mmol/L, the concentration of dNTPs can be 1mmol/L, and the concentration of Tween 20 can be 0.35%. The isothermal amplification buffer solution, polymerase, pH dye and other components form a visual isothermal amplification reagent, which effectively improves the LAMP amplification stability of the loop-mediated isothermal nucleic acid amplification primer groups SEQ ID No.1 to SEQ ID No.6 contained in the reagent of the embodiment of the application。

The reagent of the embodiment of the application contains the loop-mediated isothermal nucleic acid amplification primer group of Toxoplasma gondii, so that nonspecific amplification cannot be generated between the primer groups, and the specificity is strong. When the kit further contains a visual constant-temperature amplification reagent, the kit has the advantages of high sensitivity, good repeatability, low false negative and false positive, and direct result judgment by observing color change with naked eyes on the basis of high detection accuracy, so that the kit does not depend on professionals and professional instruments, and further the method for detecting the Toxoplasma gondii has a wider play scene and better on-site detection capability. The problems of poor on-site detection performance and high cost caused by the fact that a fluorescence probe and a fluorescent dye are needed in the traditional PCR detection and professional personnel and professional instruments are needed are effectively solved.

In a second aspect, the present embodiments provide a kit for isothermal amplification detection of toxoplasma gondii (hereinafter collectively referred to as kit), which comprises the above reagents of the present embodiments. Specifically, the kit comprises the loop-mediated isothermal nucleic acid amplification primer group for detecting toxoplasma gondii.

In some embodiments, the kit further comprises a visualized isothermal amplification reagent consisting of a polymerase, a pH dye, and an isothermal amplification buffer. Therefore, the reagent kit for detecting the toxoplasma gondii by adopting the isothermal amplification has the advantages of high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when being used for detecting the toxoplasma gondii. Specifically, when the kit contains the visual constant-temperature amplification reagent, the kit can also realize direct result judgment by observing color change with naked eyes, so that professionals and professional instruments are not needed when the kit is used for detecting Toxoplasma gondii, and the kit is further enabled to have wider play scenes and better in-situ detection capability.

In some embodiments, the kits of the embodiments further comprise at least one of a nucleic acid extraction consumable, a positive quality control, and a negative quality control.

Specifically, the nucleic acid extraction consumable is used for matching with a loop-mediated isothermal nucleic acid amplification primer group contained in the kit of the embodiment of the application or a visual isothermal amplification reagent further contained in the kit of the embodiment of the application, so that the convenience in operation of the kit of the embodiment of the application is improved. In one embodiment, the nucleic acid extraction consumable includes a nucleic acid extraction solution and/or a device for nucleic acid extraction; wherein the nucleic acid extracting solution comprises at least one of a treating solution, a lysis solution, a cleaning solution and an eluent; the nucleic acid extraction device comprises at least one of a liquid extractor, a nucleic acid lysis container and a nucleic acid enricher.

In some embodiments, the nucleic acid enricher comprises a silica gel membrane and an enricher housing, wherein the enricher housing is provided with a liquid inlet, a groove is arranged in the enricher housing and on the liquid inlet channel, and the silica gel membrane is filled in the groove. When the nucleic acid enricher is used, a liquid inlet is arranged on the shell of the enricher and is connected with a liquid outlet of the liquid taking device.

Specifically, the eluent can be nuclease-free water, the nucleic acid cracking container can be a cracking tube, and the liquid taking device can be a screw-mouth piston injector.

Through set up nucleic acid extraction consumptive material in this application embodiment kit, reduced the professional requirement of nucleic acid extraction, realized the convenience of this application embodiment kit operation, under the condition of no professional and no professional equipment, can realize the on-the-spot completion and draw the nucleic acid of sample.

In some embodiments, the positive quality control can be a toxoplasma gondii nucleic acid sample, a template for loop-mediated isothermal amplification (LAMP). The negative quality control material can be nuclease-free water, and can also be sterile water, such as DEPC water. The washing solution may be a commonly used nucleic acid washing solution.

Therefore, in one embodiment, the kit of the present application can be prepared with the reagents according to the specifications of tables 2 to 7.

Therefore, the reagent kit in the embodiment of the above application adopts the reagent in the embodiment of the application or is further provided with a visual isothermal amplification reagent, so that the reagent kit has high sensitivity, good repeatability, low false negative and false positive and high detection accuracy when being used for detecting toxoplasma gondii. When the kit further contains a visual constant-temperature amplification reagent, the kit can also realize direct result judgment by observing color change through naked eyes, and effectively avoids the need of a fluorescent probe and a fluorescent dye in the traditional PCR detection, so that professionals and professional instruments are not needed when the kit is used for detecting Toxoplasma gondii, and the kit has wider development scenes and better in-situ detection capability.

Based on the reagents and kits of the embodiments of the present application described above, a third aspect of the embodiments of the present application provides a method for detecting Toxoplasma gondii. The method for detecting Toxoplasma gondii comprises the following steps:

s01: extracting nucleic acid of a sample to be detected;

s02: mixing the nucleic acid of the sample to be detected with the reagent provided by the kit in the embodiment of the application and performing LAMP treatment;

s03: and displaying the color according to the pH dye contained in the mixed solution treated by LAMP, and directly judging the result by naked eyes.

In the above step S01, the nucleic acid extraction consumables attached to the kit of the embodiment of the present application may be used as they are. Specifically, the method for extracting nucleic acid by using the nucleic acid extraction consumable attached to the kit of the embodiment of the application is self-extracting. Therefore, the rapid extraction of the nucleic acid of the sample to be detected can be realized under the conditions of non-professional personnel and non-professional equipment.

In step S02, the sample nucleic acid to be detected is mixed with the reagent provided in the kit of the embodiment of the present application to form a LAMP amplification system. Specifically, the LAMP amplification system can be prepared according to the LAMP amplification reagents in the above Table 2.

In some embodiments, the temperature of the LAMP treatment is preferably set to 60 ℃ to 70 ℃, particularly 65 ℃, and the time should be sufficient, such as 50 min. Since the LAMP treatment is isothermal amplification, the temperature of the LAMP treatment can be provided by equipment which can be maintained for a period of time within a certain temperature range, such as a thermos cup or a water bath, so that the requirements of professional detection personnel and professional equipment of the toxoplasma gondii detection method are remarkably reduced.

In step S03, since the LAMP amplification system contains a visible pH dye in step S02, the LAMP amplification system will have a color that is constant after the LAMP treatment. Therefore, the color displayed by the final LAMP amplification system of the nucleic acid of the sample to be detected can be compared with the color displayed by the final LAMP amplification system of the nucleic acid containing the quality control product, so that whether the sample to be detected contains toxoplasma gondii nucleic acid or not can be directly judged by naked eyes.

Therefore, the toxoplasma gondii detection method utilizes the kit to carry out detection, so that the toxoplasma gondii detection method has the advantages of high sensitivity, good repeatability, low false negative and false positive and high detection accuracy. And the method for detecting Toxoplasma gondii does not need to depend on professional personnel and professional instruments, and the result judgment is directly carried out by directly observing the color change of the LAMP amplification reaction system with naked eyes, so that the method for detecting Toxoplasma gondii has wider application prospect and can be better suitable for the detection of clinical samples.

The following description will be given with reference to specific examples.

1. Reagent example for detecting Toxoplasma gondii by isothermal amplification

Example A1

The present embodiment provides a reagent for detecting toxoplasma gondii by isothermal amplification, which comprises: first outer primer SEQ ID No.1, second outer primer SEQ ID No.2, first inner primer SEQ ID No.3, second inner primer SEQ ID No.4, first loop primer SEQ ID No.5, second loop primer SEQ ID No.6, Bst polymerase, m-cresol purple, KCL, MgSO₄Tween 20, dNTPs and nuclease-free water, the concentrations of each component are as follows in table 2:

TABLE 2

Example A2

The embodiment provides a reagent for detecting toxoplasma gondii by isothermal amplification, which comprises the following components: first outer primer SEQ ID No.1, second outer primer SEQ ID No.2, first inner primer SEQ ID No.3, second inner primer SEQ ID No.4, first loop primer SEQ ID No.5, second loop primer SEQ ID No.6, Bst polymerase, m-cresol purple, KCL, MgSO₄Tween 20, dNTPs and nuclease-free water, the concentrations of each component are as follows in table 3:

TABLE 3

Components	Initial concentration	Concentration of use	Specification (mu L)
				First outer primer	0.3mM	1μM	0.12μL
Second outer primer	0.3mM	1μM	0.12μL
				First inner primer	2.4mM	45μM	0.48μL
Second inner primer	2.4mM	45μM	0.48μL
				First Loop primer	1mM	10μM	0.4μL
Second loop primer	0.3mM	10μM	0.12μL
				Bst polymerase	8U/μl	0.3U/μl	1μL
M-cresol purple	50mM	0.1mM	0.16μL
				KCL	1M	50mM	0.2μL
MgSO₄	0.4M	0.4mM	0.4μL
				Tween 20	10％	0.1％	0.2μL
dNTPs	25mM	0.4mM	1.12μL
				Nuclease-free water	/	/	5.52μL

Example A3

The embodiment provides a reagent for detecting toxoplasma gondii by isothermal amplification, which comprises the following components: first outer primer SEQ ID No.1, second outer primer SEQ ID No.2, first inner primer SEQ ID No.3, second inner primer SEQ ID No.4, first loop primer SEQ ID No.5, second loop primer SEQ ID No.6, Bst polymerase, m-cresol purple, KCL, MgSO₄Tween 20, dNTPs and nuclease-free water, the concentrations of each component are as follows in table 4:

TABLE 4

Components	Initial concentration	Concentration of use	Specification (mu L)
				First outer primer	0.3mM	2.5μM	0.12μL
Second outer primer	0.3mM	2.5μM	0.12μL
				First inner primer	2.4mM	70μM	0.48μL
Second inner primer	2.4mM	70μM	0.48μL
				First Loop primer	1mM	30μM	0.4μL
Second loop primer	0.3mM	30μM	0.12μL
				Bst polymerase	8U/μl	0.4U/μl	1μL
M-cresol purple	50mM	0.5mM	0.16μL
				KCL	1M	80mM	0.2μL
MgSO₄	0.4M	0.8mM	0.4μL
				Tween 20	10％	0.6％	0.2μL
dNTPs	25mM	1.6mM	1.12μL
				Nuclease-free water	/	/	5.52μL

2. Kit embodiment for detecting Toxoplasma gondii by isothermal amplification

Example B1

This example provides a kit for isothermal amplification detection of Toxoplasma gondii. The kit of the embodiment comprises the following reagents:

(1) visualization LAMP amplification reagent and loop-mediated isothermal nucleic acid amplification primer group. The visualized LAMP amplification reagent and the loop-mediated isothermal amplification primer group comprise the reagent for detecting toxoplasma gondii through isothermal amplification in the embodiment A1.

(2) Nucleic acid extraction consumables. The nucleic acid extraction consumable includes: sample processing liquid, nucleic acid cracking liquid, cleaning liquid, a spiral-opening piston injector and a nucleic acid enricher.

(3) And (5) positive quality control products. The positive quality control product is toxoplasma gondii nucleic acid sample.

(4) And (5) negative quality control products. The negative quality control material is nuclease-free water.

The concentrations of the visual LAMP amplification reagent and the LAMP primer set in the kit of this example were the concentrations of the components in example A1, and the concentrations of the components in the remaining reagents were as follows in Table 5: .

TABLE 5

Example B2

(1) visualization LAMP amplification reagent and loop-mediated isothermal nucleic acid amplification primer group. The visualized LAMP amplification reagent and the loop-mediated isothermal amplification primer group comprise the reagent for detecting toxoplasma gondii through isothermal amplification in the embodiment A2.

The concentrations of the visual LAMP amplification reagent and the LAMP primer set in the kit of this example were the concentrations of the components in example A2, and the concentrations of the components in the remaining reagents were as follows in Table 5: .

TABLE 6

Example B3

(1) visualization LAMP amplification reagent and loop-mediated isothermal nucleic acid amplification primer group. The visualized LAMP amplification reagent and the loop-mediated isothermal amplification primer group comprise the reagent for detecting toxoplasma gondii through isothermal amplification in the embodiment A3.

The concentrations of the visual LAMP amplification reagent and the LAMP primer set in the kit of this example were the concentrations of the components in example A3, and the concentrations of the components in the remaining reagents were as follows in Table 5: .

TABLE 7

3. Examples of methods for detecting Toxoplasma gondii

This example provides a method for detecting Toxoplasma gondii by isothermal amplification. The detection method of the embodiment comprises the following steps:

example C1

S1, extraction of sample nucleic acid

Taking a sample to be detected: human and cat whole blood 3 parts each; 3 parts of mouse pleuroperitoneal cavity exudate; 3 parts of pork; 3 parts of cat excrement.

Sample pretreatment: weighing 1g solid sample to be detected (such as pork and feces), or sucking 200 μ L liquid sample to be detected with 1mL pipette into the processing tube (containing the processing solution), mixing well, standing at room temperature for 5min, and performing first lysis.

Sample lysis: the treated human whole blood, cat whole blood, mouse pleuroperitoneal cavity exudate, pork and excrement samples are transferred into a cracking tube filled with cracking solution, mixed evenly (the volume of the cracking solution is 0.6mL), incubated at 56 ℃ for 10min to 15min and fully cracked.

Nucleic acid adsorption and washing: respectively cooling the samples to be detected after the cracking treatment to the room temperature, respectively adding 1.4mL of 95% ethanol, uniformly mixing, slowly sucking the cracked whole blood sample by using a disposable nucleic acid extraction device, completely sucking the whole blood sample into a 5mL syringe, and slowly discarding (not repeatedly pushing and sucking); it should be noted that the nucleic acid concentrator was not removable from the front end of the 5ml syringe before use; 2ml of cleaning solution is taken into a 2ml centrifuge tube, all the liquid is slowly absorbed by a disposable nucleic acid extraction device, and then the liquid is slowly discarded (the liquid is not repeatedly pushed and absorbed); it should be noted that, before the operation, it is confirmed that the cleaning solution has been added with 95% ethanol in a corresponding volume; slowly pushing the piston of the syringe for 5 times to fully remove the residual liquid;

nucleic acid elution: the 5mL syringe connected to the nucleic acid concentrator was removed and replaced with a 1mL syringe. Slowly absorbing the eluent by using a 1ml syringe; and (3) slowly pushing and sucking for 1 time, standing the 1mL syringe for 1 minute, pushing the eluted nucleic acid out to a detection tube, or pushing the eluted nucleic acid out to a 0.6mL centrifugal tube for preservation at the temperature of-20 ℃, and respectively obtaining human whole blood, cat whole blood, mouse pleuroperitoneal cavity exudate, pork meat and excrement sample nucleic acid for subsequent detection.

And S2, establishing a visual detection system.

(1) Visual LAMP amplification reagents were prepared according to the concentrations of the components of example A1, as shown in Table 2, and nuclease-free water was added to a 10. mu.L system;

(2) the concentration of each primer was adjusted according to the concentration of each component of the primer set in example a1, as shown in table 2, and mixed with the visual LAMP amplification reagent, and then sterilized and purified water was added to 20 μ L to constitute a visual LAMP amplification system;

(3) respectively mixing the nucleic acid of a sample to be detected, the positive quality control product of the DNA of the Toxoplasma gondii nucleic acid and the negative quality control product of the nuclease-free water with a visual LAMP amplification system, reacting for 50min at 65 ℃ in a water bath, and observing the color change after the reaction is finished.

(4) Judging the result of the loop-mediated isothermal amplification reaction according to the principle:

a. if the LAMP amplification system finally appears yellow green, the test result is judged to be positive;

b. if purple color (unchanged color) appears, the test result is judged to be negative.

c. For other species, no detection (color change) was detected within 50min of the reaction, indicating a negative reaction.

(5) LAMP amplification results:

LAMP amplification results of positive quality control products of Toxoplasma gondii nucleic acid DNA and negative quality control products without nuclease are shown in the following Table 8.

TABLE 8

Wherein, the LAMP amplification results of the positive quality control product (the concentration is 1000 copies/mu L) of the Toxoplasma gondii nucleic acid DNA and the nuclease-free water negative quality control product are shown in figure 1, and the final color of the amplification system of the positive quality control product of the Toxoplasma gondii nucleic acid DNA of the No. 1-3 hole in the figure 1 is yellow green; the final color of the amplification system of the nuclease-free water negative quality control product in the hole No.4 is purple.

The LAMP amplification results of concentration gradients (LAMP primers used are the detection primer set of Toxoplasma gondii) at the setting of 1000 copies/. mu.L (copies/. mu.L), 500 copies/. mu.L (copies/. mu.L), and 50 copies/. mu.L (copies/. mu.L) of positive quality control of Toxoplasma gondii nucleic acid DNA and the LAMP amplification results of nuclease-free water negative quality control are shown in FIG. 2. The final color of the amplification system with the concentration of 1000 copies/. mu.L in the well No.1 in FIG. 2 is yellow-green; the final color of the amplification system with the No.2 hole of 500 copies/mu L concentration is yellow green; the final color of the amplification system with the No.3 hole concentration of 50 copies/. mu.L is light purple; the final color of the amplification system of the nuclease-free water negative quality control product in the hole No.4 is purple.

The result of amplifying the "toxoplasma gondii nucleic acid DNA" by the LAMP primer of toxoplasma gondii is shown in FIG. 3, and the final color of the LAMP primer LAMP amplification system for toxoplasma gondii in the well No.1 in FIG. 3 is yellow-green.

The result of the LAMP primer amplification of Toxoplasma gondii "nuclease-free water" is shown in FIG. 4, and the final color of the LAMP primer LAMP amplification system of the Toxoplasma gondii in the well No.1 in FIG. 4 is purple.

The results of LAMP amplification of "human whole blood, cat whole blood, mouse pleuroperitoneal exudate, pork meat and cat fecal nucleic acid samples to be tested" with respect to the LAMP primers of Toxoplasma gondii are shown in Table 9 below. The detection result shows that the cat whole blood, the excrement (cat) and the transperitoneal exudate (mouse) in 3 samples to be detected can be 100% positive. Only 1 part of human whole blood and pork in 3 samples to be tested shows positive results.

TABLE 9

The above description is only exemplary of the present application and should not be taken as limiting the present application, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

<110> Shenzhen disease prevention and control center (Shenzhen health inspection center, Shenzhen prevention and medical research institute), and China disease prevention and control center parasitic disease prevention and control institute (national tropical disease research center)

<120> reagent and kit for detecting toxoplasma gondii through isothermal amplification and application of reagent and kit

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Tog333-F3

gtgtcacgtt ttttgtcaga 20

<400> 1

<210> 2

<211> 18

<212> DNA

<213> Tog333-B3

agagttcgtc ggtgtttg 18

<400> 2

<210> 3

<211> 42

<212> DNA

<213> Tog333-FIP

tggagacgaa cacgctagag cacttcactt tgtgcagaag ca 42

<400> 3

<210> 4

<211> 43

<212> DNA

<213> Tog333-BIP

tacaaaagag aacattccag caactaaaga taggagggag gcg 43

<400> 4

<210> 5

<211> 19

<212> DNA

<213> Tog333-LF-2

tgttgcagtt tggacgggc 19

<400> 5

<210> 6

<211> 22

<212> DNA

<213> Tog333-LB

tctgcctttg ttcttttagc ct 22

<400> 6

<210> 7

<211> 864

<212> DNA

<213> primer design region sequence of Toxoplasma gondii target sequence B1 gene

gatcagaaag gaactgcatc cgttcatgag tataagaaaa aaatgtggga atgaaagaga

cgctaatgtg tttgcatagg ttgcagtcac tgacgagctc ccctctgctg gcgaaaagtg

aaattcatga gtatctgtgc aactttggtg tattcgcaga ttggtcgcct gcaatcgata

gttgaccacg aacgctttaa agaacaggag aagaagatcg tgaaagaata cgagaagagg

tacacagaga tagaagtcgc tgcggagaca gcgaagactg cggatgactt cactcccgtc

gcaccagcag cagaggagtg ccgggcaaga aaatgagatg cctagaggag acacagcgtg

ttatgaacaa atctattgag gtttcgcgaa gaggagggaa catattatat acagaagaag

aacaagagac gtgccgcatg tcgctaagcc atcggaaggg atgctcagaa aatggcacag

tatcacatta cagttccgtt gattcgtctg atggtgacga aaggggaaga atagttgtcg

caccaaaact ggctagttgt tattttgaag aagacgagag atggagtgaa ccaccaaaaa

tcggagaaaa tcgatggtgt cacgtttttt gtcagacttc actttgtgca gaagcattgc

ccgtccaaac tgcaacaact gctctagcgt gttcgtctcc attccgtaca gtcttcaaaa

atacaaaaga gaacattcca gcaacttctg cctttgttct tttagcctca atagcaggat

gacgcctccc tcctatcttt cagccaaccc agcaaacacc gacgaactct ctgtagagta

acaaagagaa ggcaaaacgc gcca 864

<400> 7

Claims

1. A reagent for detecting toxoplasma gondii through isothermal amplification, which is characterized by comprising the following loop-mediated isothermal nucleic acid amplification primer sets for detecting toxoplasma gondii:

2. The reagent for detecting toxoplasma gondii through isothermal amplification according to claim 1, wherein the concentrations of the first outer primer SEQ ID No.1 and the second outer primer SEQ ID No.2 are both 1.0-2.5 μ M;

the using concentration ranges of the first inner primer SEQ ID No.3 and the second inner primer SEQ ID No.4 are both 45-70 mu M;

the concentration ranges of the first loop primer SEQ ID No.5 and the second loop primer SEQ ID No.6 are both 10-30 mu M.

3. The reagent for isothermal amplification detection of Toxoplasma gondii according to claim 1 or 2, wherein the reagent further comprises a visualized isothermal amplification reagent comprising the following components:

polymerase, pH dye, isothermal amplification buffer.

4. The reagent for isothermal amplification detection of Toxoplasma gondii according to claim 3, wherein said polymerase is Bst polymerase; and/or

The pH dye is m-cresol purple; and/or

The isothermal amplification buffer solution comprises KCL and MgSO₄Tween 20, dNTPs and nuclease-free water.

5. A kit for detecting Toxoplasma gondii by isothermal amplification, which comprises the reagent according to any one of claims 1 to 4.

6. The kit of claim 5, further comprising at least one of a nucleic acid extraction consumable, a positive quality control, and a negative quality control.

7. The kit of claim 6, wherein: the nucleic acid extraction consumable comprises a nucleic acid extraction solution and/or a device for nucleic acid extraction; wherein the content of the first and second substances,

the nucleic acid extracting solution comprises at least one of a treating solution, a lysis solution, a cleaning solution and an eluent;

the device comprises at least one of a liquid extractor, a nucleic acid lysis container and a nucleic acid enricher;

the positive quality control product is a nucleic acid template of Toxoplasma gondii;

the negative quality control product is nuclease-free water.

8. A method of detecting toxoplasma gondii, comprising the steps of:

obtaining nucleic acid of a sample to be detected;

mixing the nucleic acid of the sample to be tested with the reagent according to any one of claims 1 to 4 or the isothermal amplification reagent provided by the kit according to any one of claims 5 to 7, and carrying out loop-mediated isothermal nucleic acid amplification treatment;

9. The method according to claim 8, wherein the method for obtaining the sample nucleic acid to be detected comprises the steps of:

carrying out cracking treatment on a sample to be detected to obtain a cracking solution containing nucleic acid of the sample to be detected;

and adsorbing the lysate by a nucleic acid enricher, cleaning the adsorbed nucleic acid of the sample to be detected, and eluting the nucleic acid.