CN113717290A

CN113717290A - Composite transdermal recombinant fibronectin and application thereof

Info

Publication number: CN113717290A
Application number: CN202111056589.3A
Authority: CN
Inventors: 温龙平; 钱洁颖; 武洪淼
Original assignee: Beijing Tianyi Medical Research Institute
Current assignee: Beijing Tianyi Biotechnology Co ltd
Priority date: 2021-09-09
Filing date: 2021-09-09
Publication date: 2021-11-30
Anticipated expiration: 2041-09-09
Also published as: CN113717290B

Abstract

The application belongs to the technical field of biology, and particularly relates to composite transdermal recombinant fibronectin and application thereof. The present application provides a composite transdermal recombinant fibronectin comprising: a fusion polypeptide in which transdermal short peptide, fibronectin and collagen are sequentially linked; the amino acid sequence of the transdermal short peptide has an amino acid sequence shown as SEQ ID NO. 1; the amino acid sequence of fibronectin is shown as the amino acid sequence shown in SEQ ID NO. 2; the amino acid sequence of the collagen is shown as SEQ ID NO. 3. The application discloses the application of the composite transdermal recombinant fibronectin in preparing a product for penetrating a skin barrier and promoting cell adhesion, cell extension and cell growth. The application provides a composite transdermal recombinant fibronectin and application thereof, which can effectively solve the technical problems of low transdermal capacity, cell adhesion, poor stretching and growth capacity of the existing fibronectin.

Description

Composite transdermal recombinant fibronectin and application thereof

Technical Field

The application belongs to the technical field of biology, and particularly relates to composite transdermal recombinant fibronectin and application thereof.

Background

Fibronectin (Fibronectin, FN), a high molecular weight (about 440kDa) glycoprotein of the extracellular matrix, binds to integrin transmembrane receptor proteins. Fibronectin has many biological functions, such as essential to the processes of wound healing and embryonic development. Cellular fibronectin aggregates in the extracellular matrix, an insoluble network that separates and supports organs and tissues of an organism. Fibronectin and fibrin deposit at the site of injury, form blood clots, stop bleeding and protect the subcutaneous tissue and, secondly, play an important role in cell adhesion, spreading, growth, migration and differentiation. Fibronectin has wide application and huge market in the fields of medicine, cosmetics and scientific research, but the yield of natural fibronectin extracted from human or animal blood and tissues is extremely limited and the cost is high. Furthermore, fibronectin molecules are too large to be absorbed by the skin with intact keratinous structures. Thus limiting the use and production of FN in many applications, especially in the area of cosmetic skin care. In addition, the skin surface has a substance barrier which prevents most protein drugs from passing through the skin, and fibronectin is a protein molecule and has low transdermal capacity, so that the application effect is poor under the condition that the skin barrier is complete or partially complete.

Disclosure of Invention

In order to solve the problems, the application provides a composite transdermal recombinant fibronectin and an application thereof, which can effectively solve the technical problems of low transdermal capacity and poor cell adhesion, expansion and growth capacity of the existing fibronectin.

In a first aspect, the present application provides a composite transdermal recombinant fibronectin comprising: a fusion polypeptide in which transdermal short peptide, fibronectin and collagen are sequentially linked;

the amino acid sequence of the transdermal short peptide has an amino acid sequence shown as SEQ ID NO. 1; or the amino acid sequence shown in SEQ ID NO.1 is modified, substituted, deleted or added with one or more amino acids, and has at least 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 1;

the amino acid sequence of the fibronectin is shown as the amino acid sequence shown in SEQ ID NO. 2; or the amino acid sequence shown in SEQ ID NO.2 is modified, substituted, deleted or added with one or more amino acids, and has at least 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 2;

the amino acid sequence of the collagen is shown as SEQ ID NO. 3; or the amino acid sequence shown in SEQ ID NO.3 is modified, substituted, deleted or added with one or more amino acids, and has at least 90 percent of homology with the amino acid sequence shown in SEQ ID NO. 3.

In another embodiment, the transdermal short peptide is linked to the fibronectin with a linking peptide;

the fibronectin is linked to the collagen with a linking peptide.

In another embodiment, the amino acid sequence of the linker peptide is one of GGGGS, GSGGSGGGSGGSGGG or GGGGSGGG.

In a second aspect, the application provides a nucleotide sequence encoding any of the complex transdermal recombinant fibronectin.

In another embodiment of the present invention, the substrate,

the transdermal short peptide shown in SEQ ID NO.1 has a nucleotide sequence shown in SEQ ID NO. 4;

the fibronectin shown in SEQ ID NO.2 has a nucleotide sequence shown in SEQ ID NO. 5;

the collagen shown in SEQ ID NO.3 has a nucleotide sequence shown in SEQ ID NO. 6.

Specifically, the amino acid sequence of the transdermal short peptide TD-1 is SEQ ID No. 1: ACSSSPKHCG, the nucleotide sequence of which is SEQ ID No. 4: GCTTGTAGTAGCAGCCCGAGCAAACATTGCGGT are provided.

Specifically, the C end of the transdermal short peptide TD-1 is connected with a fibronectin fragment through a connecting peptide, the amino acid sequence of the fibronectin is SEQ ID No. 2: IQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTGSAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRT, and the nucleotide sequence of the fibronectin is SEQ ID No. 5: ATCCAGTGGAATGCACCACAGCCATCTCACATTTCCAAGTACATTCTCAGGTGGAGACCTAAAAATTCTGTAGGCCGTTGGAAGGAAGCTACCATACCAGGCCACTTAAACTCCTACACCATCAAAGGCCTGAAGCCTGGTGTGGTATACGAGGGCCAGCTCATCAGCATCCAGCAGTACGGCCACCAAGAAGTGACTCGCTTTGACTTCACCACCACCAGCACCAGCACAGGATCTGCTGTTCCTCCTCCCACTGACCTGCGATTCACCAACATTGGTCCAGACACCATGCGTGTCACCTGGGCTCCACCCCCATCCATTGATTTAACCAACTTCCTGGTGCGTTACTCACCTGTGAAAAATGAGGAAGATGTTGCAGAGTTGTCAATTTCTCCTTCAGACAATGCAGTGGTCTTAACAAATCTCCTGCCTGGTACAGAATATGTAGTGAGTGTCTCCAGTGTCTACGAACAACATGAGAGCACACCTCTTAGAGGAAGACAGAAAACAGTTTCTGATGTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGCCTACTGATCAGCTGGGATGCTCCTGCTGTCACAGTGAGATATTACAGGATCACTTACGGAGAAACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCTGGGAGCAAGTCTACAGCTACCATCAGCGGCCTTAAACCTGGAGTTGATTATACCATCACTGTGTATGCTGTCACTGGCCGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAATTACCGAACA are provided.

Specifically, the C end of the fibronectin is connected with a collagen fragment through a connecting peptide, wherein the amino acid sequence of the collagen is SEQ ID No. 3: GFPGER, the nucleotide sequence of which is SEQ ID No. 6: GGTTTCCCGGGTGAACGT are provided.

In a third aspect, the present application provides a recombinant expression vector comprising said nucleotide sequence.

The fourth aspect of the application provides an engineering bacterium containing the recombinant expression vector.

In a fifth aspect, the application discloses the use of the said complex transdermal recombinant fibronectin for the preparation of a product for crossing the skin barrier.

The sixth aspect of the application discloses the application of the composite transdermal recombinant fibronectin in preparing products for promoting cell adhesion, cell extension and cell growth.

The seventh aspect of the application provides a skin preparation, which comprises the composite transdermal recombinant fibronectin and pharmaceutically acceptable auxiliary materials.

Specifically, the pharmaceutically acceptable auxiliary materials are selected from one or more of carriers, diluents or excipients.

The application obtains the composite transdermal recombinant fibronectin based on an Escherichia coli expression system. It is therefore a first object of the present application to provide a small molecule, complexed transdermal recombinant fibronectin. A second object of the present application is to provide a composite transdermal recombinant fibronectin which better penetrates the skin barrier. The third purpose of the application is to provide a composite type small molecule composite transdermal recombinant fibronectin with the double biological functions of fibronectin and collagen.

1. The functional area of fibronectin is specifically intercepted, and the transdermal enhancement peptide TD-1 is connected with the fibronectin through a connecting peptide; in addition, the fibronectin is connected with the collagen functional fragment through the connecting peptide, so that the obtained composite protein product integrating the functions of transdermal penetration, fibronectin and collagen has stronger biological function and activity and small molecular weight, and can effectively solve the difficulty of preparing the fibronectin by a DNA recombination technology.

2. The composite functional transdermal recombinant fibronectin has stronger capability of promoting cell adhesion, extension and growth than single fibronectin, and has transdermal activity which is not possessed by the single fibronectin.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a pET22b expression vector provided in the examples herein.

FIG. 2 is an SDS-PAGE electrophoresis of the composite transdermal recombinant fibronectin before and after induction of expression as provided in the examples of the present application.

FIG. 3 is an SDS-PAGE electrophoresis of purified, composite transdermal recombinant fibronectin provided in the examples herein.

FIG. 4 is a graph showing the results of experiments on the cell adhesion promotion of HaCat cells by different recombinant proteins provided in the examples of the present application.

FIG. 5 is a graph showing the results of the CCK8 experiments for promoting cell adhesion for various recombinant proteins provided in the examples of the present application.

FIG. 6 is a graph showing the results of experiments on cell proliferation of different recombinant proteins provided in the examples of the present application.

FIG. 7 is a graph showing the results of in vitro transdermal experiments on SD rats with different recombinant proteins provided in the examples of the present application.

FIG. 8 is a graph showing the results of in vivo transdermal experiments in SD rats with different recombinant proteins provided in the examples of the present application.

Detailed Description

The application provides a composite transdermal recombinant fibronectin and application thereof, which are used for solving the technical defects of low transdermal capacity, cell adhesion, poor expansion and growth capacity of fibronectin in the prior art.

The technical solutions in the embodiments of the present application will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.

The raw materials and reagents used in the following examples are commercially available or self-made.

Example 1

The embodiment of the application provides a preparation method of composite transdermal recombinant fibronectin, which comprises the following steps:

in this example 1, in order to obtain a composite transdermal recombinant fibronectin target fragment and an expression vector (the expression vector of this example is labeled as: TD-1-FN-COL), FIG. 1 is a vector sequence map provided in the example. Using a commercial vector pET22b (Code No. VT1200, Youbao), designing enzyme cutting sites according to pET22b related sequence positions; the structure of a fragment of interest of complex transdermal recombinant fibronectin). The amino acid sequence of the transdermal short peptide TD-1 is SEQ ID No. 1: ACSSSPKHCG, the nucleotide sequence of which is SEQ ID No. 4: GCTTGTAGTAGCAGCCCGAGCAAACATTGCGGT, respectively; the amino acid sequence of fibronectin is SEQ ID No. 2:

IQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTGSAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRT, the nucleotide sequence is SEQ ID No. 5:

ATCCAGTGGAATGCACCACAGCCATCTCACATTTCCAAGTACATTCTCAGGTGGAGACCTAAAAATTCTGTAGGCCGTTGGAAGGAAGCTACCATACCAGGCCACTTAAACTCCTACACCATCAAAGGCCTGAAGCCTGGTGTGGTATACGAGGGCCAGCTCATCAGCATCCAGCAGTACGGCCACCAAGAAGTGACTCGCTTTGACTTCACCACCACCAGCACCAGCACAGGATCTGCTGTTCCTCCTCCCACTGACCTGCGATTCACCAACATTGGTCCAGACACCATGCGTGTCACCTGGGCTCCACCCCCATCCATTGATTTAACCAACTTCCTGGTGCGTTACTCACCTGTGAAAAATGAGGAAGATGTTGCAGAGTTGTCAATTTCTCCTTCAGACAATGCAGTGGTCTTAACAAATCTCCTGCCTGGTACAGAATATGTAGTGAGTGTCTCCAGTGTCTACGAACAACATGAGAGCACACCTCTTAGAGGAAGACAGAAAACAGTTTCTGATGTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGCCTACTGATCAGCTGGGATGCTCCTGCTGTCACAGTGAGATATTACAGGATCACTTACGGAGAAACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCTGGGAGCAAGTCTACAGCTACCATCAGCGGCCTTAAACCTGGAGTTGATTATACCATCACTGTGTATGCTGTCACTGGCCGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAATTACCGAACA, respectively; the SEQ ID No.1 and the SEQ ID No.2 are connected through a connecting peptide GGGGS, and a fibronectin fragment is connected at the C end of the transdermal short peptide TD-1; connecting a collagen fragment at the C-terminal of fibronectin, wherein the amino acid sequence of the collagen is SEQ ID No. 3: GFPGER, the nucleotide sequence of which is SEQ ID No. 6: GGTTTCCCGGGTGAACGT, and is linked to the C-terminus of fibronectin via the linker peptide GGGGGGS.

Thus, to facilitate protein purification, the end of the fragment of interest was inserted into a His-Tag (His-Tag), and the amino acid sequence of the target fragment of the complex functional transdermal recombinant fibronectin of this example is SEQ ID No: 7:

MHHHHHHACSSSPSKHCGGGGGSIQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTGSAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRT GGGGS GFPGER, the nucleotide sequence is SEQ ID No. 8:

ATGCACCATCACCATCATCACGCGTGTTCCTCTTCTCCGAGCAAACACTGCGGCGGCGGTGGCGGTTCTATCCAGTGGAACGCACCGCAGCCGTCCCATATCAGCAAATACATCCTGCGTTGGCGTCCGAAAAACTCCGTTGGTCGTTGGAAAGAAGCGACGATCCCGGGCCACCTGAACTCTTACACTATCAAAGGTCTGAAACCGGGCGTTGTTTATGAAGGCCAGCTGATCAGCATTCAGCAGTATGGTCACCAAGAAGTTACTCGTTTCGATTTCACTACCACTTCTACCTCCACCGGCTCCGCAGTGCCGCCACCGACTGATCTGCGTTTCACTAATATCGGCCCGGACACCATGCGTGTCACTTGGGCGCCGCCGCCGTCTATTGACCTGACCAACTTCCTGGTCCGCTACAGCCCGGTCAAAAACGAAGAAGATGTGGCGGAACTGTCTATCAGCCCGTCTGACAACGCCGTCGTACTGACTAATCTGCTGCCAGGTACCGAGTACGTAGTTTCCGTGTCTTCTGTGTACGAACAGCACGAATCTACTCCGCTGCGCGGTCGTCAAAAAACCGTTTCTGACGTCCCTCGTGACCTGGAAGTGGTTGCTGCTACCCCTACTTCCCTGCTGATCTCTTGGGATGCACCTGCTGTAACCGTTCGTTACTACCGTATCACCTATGGTGAAACCGGTGGTAACAGCCCGGTACAAGAATTCACCGTGCCGGGCTCTAAATCTACTGCGACCATCTCCGGTCTGAAACCAGGTGTGGATTATACCATTACCGTGTATGCTGTTACCGGTCGTGGCGATTCTCCGGCAAGCTCCAAACCTATCTCTATCAACTACCGTACCGGTGGTGGCGGCTCTGGTTTCCCGGGTGAACGT。

a composite transdermal recombinant fibronectin target fragment (SEQ ID No:8) was amplified by PCR amplification and reacted with pET22b (+) vector (see FIG. 1) using the fast-cutting enzymes FastDigestNdeI (Code No. FD0583, Thermo Fisher Scientific) and FastDigest XhoI (Code No. FD0694, Thermo Fisher Scientific), respectively. The reaction system is shown in Table 1. NdeI (CATATG) -XhoI (CTCGAG).

TABLE 1

The reaction system is gently mixed and then centrifuged to carry out the reaction, and the reaction conditions are as follows:

reacting at 30 ℃ for 1h, then reacting at 37 ℃ for 1h, after the double enzyme digestion reaction is finished, carrying out 1% agarose gel electrophoresis on the target fragment and pET22b (+) vector enzyme digestion products, and carrying out gel cutting, purification and recovery.

Example 2

The specific steps for constructing the composite transdermal recombinant fibronectin protein particle TD-1-FN-COL in the embodiment 2 are as follows:

(1) the fragment of interest was ligated with pET22b (+) expression vector:

the target fragment purified and recovered by the double-restriction in example 1 was ligated with pET22b (+) (hereinafter referred to as vector DNA) to construct a recombinant plasmid. The Ligation was performed by using DNA Ligation Kit Ver.2.1 Ligation Kit (Code No.6022Q, Takara), and the specific procedures were as follows: the target fragment recovered by gel cutting purification in example 1 was uniformly mixed with pET22b (+) vector DNA to prepare a mixture of 10. mu.L in volume (molar ratio of vector DNA to target fragment 0.03 pmol: 0.3pmol), and the mixture was incubated in a water bath at 60 ℃ for 2 min. Adding a Solution I with the same volume into the mixed Solution, uniformly mixing, and placing the mixture in a water bath tank at the temperature of 16 ℃ for a connection reaction for 16 hours to obtain a connection reaction Solution.

(2) Transformation and plate coating culture:

adding 1 mu L Solution III into 9 mu L of the ligation reaction Solution in a 1.5mL centrifuge tube, uniformly mixing, immediately transferring into 50 mu L LTrans-T1 competent cells (Code No. CT101-01, all-type gold), standing on ice for 30min, performing water bath heat shock at 42 ℃ for 45sec, immediately standing on ice for 2min, adding 250 mu L SOC liquid culture medium, and performing shake recovery culture at 37 ℃ and 200rpm for 1h in a shaking table. 100 μ L of the resuscitated culture broth was applied to LB solid medium containing AMP 21032(100 μ g/mL), and after complete absorption, the cells were inverted and incubated overnight in an incubator at 37 ℃. White positive single colonies and blue negative control single colonies were selected, inoculated into 4mL SOC liquid medium containing 4. mu.L AMP (100mg/mL), and shake-cultured at 37 ℃ for 10 hours on a shaker at 200 rpm. Recombinant plasmids were extracted according to the experimental method of endotoxin-free plasmid miniprep kit (Code No. DP118-02, Tiangen Biochemical technology Co., Ltd.), and stored in a refrigerator at-20 deg.C for use to obtain composite transdermal recombinant fibronectin (TD-1-FN-COL).

Example 3

This example 3 is the induced expression and SDS-PAGE electrophoretic identification of composite transdermal recombinant fibronectin protein particle TD-1-FN-COL, and the specific steps are as follows:

1. the composite transdermal recombinant fibronectin protein particle TD-1-FN-COL is transformed into BL21(DE3) competent cells:

mu.L of the composite transdermal recombinant fibronectin protein particle TD-1-FN-COL extracted in example 2 was transformed into 50. mu.L of BL21(DE3) competent cells (Code No.9126, TaKaRa), allowed to stand on ice for 30min, then subjected to water bath heat shock at 42 ℃ for 45sec, immediately allowed to stand on ice for 2min, added with 250. mu.L of SOC liquid medium, and subjected to resuscitative culture at 37 ℃ and 200rpm in a shaker for 1 h. 100 μ L of the resuscitated culture broth was applied to LB solid medium containing AMP (100mg/mL), and after complete absorption, the medium was inverted and incubated overnight in an incubator at 37 ℃. White positive single colonies and blue negative control single colonies were selected, inoculated into 4mL SOC liquid medium containing 4. mu.L AMP (100mg/mL), and shake-cultured in a shaker at 37 ℃ and 200rpm for 10h to obtain a positive recombinant bacterial liquid.

2. Induced expression and SDS-PAGE electrophoretic identification of composite transdermal recombinant fibronectin protein particle TD-1-FN-COL:

taking 7mL of the positive recombinant bacterial liquid, inoculating into 500mL of SOC liquid culture solution containing AMP (100. mu.g/. mu.L), shake-culturing in a shaker at 37 ℃ and 200rpm for 5h, and measuring OD of the induced positive recombinant bacterial liquid by using an ultraviolet spectrophotometer every other hour₆₀₀When the bacterial liquid OD₆₀₀When the concentration reaches 0.5, IPTG is respectively added to the final concentration of 0.5mmol/L, and sampling and gel-casting are carried out to detect the expression condition of the protein.

3. SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) identification of the induction expression protein:

1) and (3) respectively taking the induced positive recombinant bacterial liquid in the step (2) and the non-induced positive recombinant bacterial liquid in the step (1), centrifuging for 15min at 10000rpm and 4 ℃, discarding the supernatant, weighing the wet weight of the thalli, washing the precipitate with 1 XPBS + 1% (v/v) Tween once, centrifuging for 18min at 10000rpm and 4 ℃, and resuspending the precipitate with 1 XPBS (pH7.4, 0.01M) (10 times volume of the wet weight). And (3) carrying out ultrasonic crushing on the thalli in the suspension on ice, and setting ultrasonic conditions: the total time is 40min, the ultrasonic time is 2sec, the ultrasonic dwell time is 1sec, the power is 65W, the ultrasonic is carried out twice, centrifugation is carried out for 15min at 10000rpm and 4 ℃, supernatant is discarded, and the precipitated thalli are reserved. A small amount of the precipitate was placed in 1.5mL centrifuge tubes, and an appropriate amount of L × PBS (pH7.4, 0.01M) was added to suspend the precipitate, and an appropriate amount of 5 × protein loading buffer was added to the suspension, mixed well, boiled for 10min, and 10 μ L of each sample was loaded. The standard protein ProteinRuler IV is used as Marker, the current is 100mA, the voltage is 100V, and SDS-PAGE electrophoresis is carried out for 1.5 h.

2) Dyeing and decoloring: after SDS-PAGE electrophoresis is finished, the protein gel block is gently taken out and placed on a shaking table, Coomassie brilliant blue staining solution is added for staining for 1 hour, then destaining solution is added for destaining for 15 minutes, the destaining solution is discarded, new destaining solution is replaced, the operation is repeated for 3 times, and finally destaining is carried out overnight. The results of the photographs taken after the decolorization was completed are shown in FIG. 2, in which FIG. 2 is a SDS-PAGE electrophoresis of the composite transdermal recombinant fibronectin before and after induction, and FIG. 2 is a SDS-PAGE electrophoresis of the labeled composite transdermal recombinant fibronectin before and after induction. As can be seen from the electrophoresis chart in FIG. 2, the expression level of the composite transdermal recombinant fibronectin TD-1-FN-COL protein is obviously improved after IPTG-induced expression.

Example 4

This example shows the purification of recombinant fibronectin induced by expression in example 3, including the denaturation, renaturation and purification of transdermal recombinant fibronectin, with the following specific steps:

1. denaturation of inclusion bodies: the complex transdermal recombinant fibronectin obtained by induction expression in step 3 of example 3 was precipitated as inclusion bodies, resuspended in 8M urea (pH 7.0), and denatured in a shaker at 4 ℃ overnight to completely dissolve the inclusion bodies, thereby obtaining a protein-denatured solution.

2. Renaturation of the protein: adopting a low-temperature dilution renaturation method, centrifuging the protein denaturation liquid at 8000rpm and 4 ℃ for 10min, taking the supernatant, slowly adding 20mM Tris-HCl with the volume of 1 time, renaturing at the pH of 7.0 and 4 ℃ overnight, slowly adding renaturation liquid with the volume of 1 time (the renaturation liquid is 20mM Tris-HCl (pH 7.0), 2mM GSH and 0.2mM GSSG) into the denaturation liquid, and carrying out renaturation overnight, wherein the renaturation is finished when the concentration of urea is 2M.

3. And (3) purification: and filtering the renatured protein by a membrane to remove impurities, and purifying the target protein twice by a nickel column (Niulon Biotechnology Co., Ltd. in Hangzhou) because the target fragment has a His label to obtain the purified protein which is marked as the composite transdermal recombinant fibronectin TD-1-FN-COL.

With reference to the methods of examples 1 to 4, purified proteins in which fibronectin FN and collagen COL were fused were prepared, and fibronectin FN and collagen COL were linked by GGGGS and labeled FN-COL. In the same manner, purified protein fused fibronectin FN and transdermal short peptide TD-1 was prepared, wherein fibronectin FN and transdermal short peptide TD-1 are linked by GGGGS, and labeled FN-TD-1.

The two purified recombinant fibronectin proteins were subjected to SDS-PAGE electrophoresis, and the results are shown in FIG. 3, FIG. 3 is a SDS-PAGE electrophoresis of the purified composite transdermal recombinant fibronectin provided in the examples of the present application, and labeled 1 and 2 in FIG. 3 are both TD-1-FN-COL of the purified composite transdermal recombinant fibronectin induced to be expressed in example 3. This example shows that high purity protein was obtained by purification on a nickel column, with purification efficiency as high as 95% by grey scale calculation of the protein of interest.

Example 5

This example 5 is a cell adhesion, spreading and growth promotion experiment of the purified composite transdermal recombinant fibronectin TD-1-FN-COL of example 4, which comprises the following steps:

experiments were performed with human immortalized epidermal cells HaCat (BNCC342026 ATCC) using renaturation solutions (20mM Tris-HCl (pH 7.0), 2mM GSH and 0.2mM GSSG) as controls and CON (PBS) as a blank. The purified composite transdermal recombinant fibronectin TD-1-FN-COL obtained in example 4 is covered on a 96-well plate, the temperature is kept overnight at 4 ℃, protein solution is absorbed, transdermal recombinant fibronectin is covered at the bottom of the 96-well plate, 5000 cell suspensions without serum are respectively added into the well plate, the culture box is incubated at 37 ℃ for 1h, and the adhesion and the expansion conditions of each group of cells are observed under a 10-fold microscope, so that the cell adhesion, the expansion and the growth promotion activity of the transdermal recombinant fibronectin are verified, the experimental result of the epidermal cell HaCat is shown in figure 4, and figure 4 is an experimental result graph of the composite transdermal recombinant fibronectin provided by the example of the application on the cell adhesion promotion of the HaCat cells.

As can be seen from FIG. 4, con is PBS control group, purified protein 1 and purified protein 2 are composite transdermal recombinant fibronectin TD-1-FN-COL group, con has no function of promoting cell adhesion, and TD-1-FN-COL fusion protein can effectively promote cell adhesion, cell extension and cell growth in 1h in cells without serum, and mainly plays a role of fibronectin in promoting the effect, thus proving that the composite transdermal recombinant fibronectin prepared in example 4 retains the biological activity of fibronectin in promoting cell adhesion, cell extension and cell growth.

Example 6

The composite transdermal recombinant fibronectin TD-1-FN-COL and fibronectin collagen FN-COL purified in example 4 were coated on a 96-well plate for 30 minutes after being formulated at various concentrations (2.5, 5, 7.5, 10, 15, 20. mu.g/mL) and washed twice with PBS. After blocking with 1% BSA at 37 ℃ for 30 minutes, human immortalized epidermal cells HaCat (cultured in serum-free medium) were added, the medium was gently aspirated after 1 hour, the non-adsorbed cells were gently rinsed with PBS, the number of viable cells adsorbed on the bottom of the well plate was measured by the CCK8 method, and the activity of recombinant fibronectin was verified, as shown in FIG. 5, FIG. 5 is a graph showing the results of the CCK8 assay for promoting cell adhesion provided in the examples of the present application, and FIG. 5 shows that the cell adhesion activity of the composite transdermal recombinant fibronectin TD-1-FN-COL is superior to that of fibronectin FN-COL.

Example 7

This example is a cell proliferation promoting experimental validation of the purified composite transdermal recombinant fibronectin TD-1-FN-COL and transdermal fibronectin FN-TD-1 of example 4. The experimental procedure was as follows:

experiments were carried out using human immortalized epidermal cells HaCat (BNCC342026 ATCC) with renaturation solution (20mM Tris-HCl (pH 7.0), 2mM GSH and 0.2mM GSSG) as controls and transdermal fibronectin solution of equivalent concentration as control protein. The purified composite transdermal recombinant fibronectin and transdermal fibronectin of example 4 were coated on a 96-well plate, overnight at 4 ℃, protein solution was aspirated, the bottom of the 96-well plate was coated with transdermal recombinant fibronectin, and 5000 cell suspensions containing no serum were added to the plate. After 48 hours, the viability of the cells treated in each group was examined by MTT and the ability of the composite transdermal recombinant fibronectin TD-1-FN-COL to promote cell proliferation was compared with that of transdermal fibronectin FN-TD-1.

As shown in fig. 6, fig. 6 is a graph showing the results of experiments on cell proliferation of different recombinant proteins provided in the examples of the present application, and the same concentration of the recombinant fibronectin TD-1-FN-COL has a stronger ability to promote cell proliferation than the transdermal fibronectin FN-TD-1, indicating that the transdermal fibronectin TD-1-FN-COL fused with collagen has a better ability to promote cell proliferation.

Example 8

The external transdermal experiment of SD rat of this application specifically includes:

10 SD rats (SPF grade, Hunan Slek) were sampled and randomly divided into 2 groups. After depilation, the hair was left for 48h and the heart was sacrificed by taking blood. Two intact skin pieces were immediately taken from the same SD rat and made into recombinant fibronectin-collagen (FN-COL) and transdermal recombinant fibronectin TD-1-FN-COL. The skin was mounted on a transdermal patch, and 30. mu.g of FN-COL protein obtained in example 4 or TD-1-FN-COL protein obtained in example 4 was added to the horny surface of the skin, and 4mL buffer was added to the dermal layer. The amount of FN protein in each sample was determined by pipetting 100. mu.L of the receiving solution at 2h, 4h, 8h, and 16h, respectively, and using a Human FN ELISA kit (Examjie, cat # K3631-100).

In vitro transdermal experimental results as shown in fig. 7, fig. 7 is a graph showing the results of the in vitro transdermal experimental results of SD rats with different recombinant proteins provided in the examples of the present application, and the transdermal capacity of the composite transdermal recombinant fibronectin TD-1-FN-COL is significantly enhanced compared to the recombinant fibronectin-collagen group (FN-COL) to which TD-1 short peptide is not linked.

Example 9

The in vivo transdermal experiment of this application SD rat specifically includes:

ten SD rats (SPF grade, hunan slaick) were randomly drawn and equally divided into 2 groups: it is divided into a recombinant fibronectin-collagen (FN-COL) transdermal administration group and a composite transdermal recombinant fibronectin TD-1-FN-COL transdermal administration group. After the SD rat is anesthetized with chloral hydrate, a month of 2cm is cut out from the abdomen²The hairless part is smeared and administrated, and blood is collected from heart after 5 h. Serum was collected from the blood samples by centrifugation, and 100. mu.L each of the sera was assayed for FN protein content using a Human FN ELISA kit (Aimeijie, cat # K3631-100).

The results are shown in fig. 8, and fig. 8 is a graph of the results of the in vivo transdermal experiment of SD rats with different recombinant proteins provided in the examples of the present application. The content of the composite transdermal recombinant fibronectin TD-1-FN-COL penetrating through the skin is obviously higher than that of the recombinant fibronectin-collagen group FN-COL, which indicates that the composite transdermal recombinant fibronectin has stronger transdermal promotion effect.

Comparative example 1

The comparative examples of the present application provide control fragments of interest, specifically including:

the control target fragment 1 and the control target fragment 2 were prepared according to the preparation method of example 1. The amino acid sequence of the recombinant protein 1 for comparison was: ACSSSPSKHCGGGGGSIQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTGSAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRTGGGGSGPPGPAGQDGRPGPPGPPGARGQAGVMGFPGPKGAAGEPGKAGERGVPGPPGAVGPAGKDGEAGAQGPPGPAGPAGERGEQGPAGPPGPAGQDGRPGPPGPPGARGQAGVMGFPGPKGAAGEPGKAGERGVPGPPGAVGPAGKDGEAGAQGPPGPAGPAGERGEQGPAGPPGPAGQDGRPGPPGPPGARGQAGVMGFPGPKGAAGEPGKAGERGVPGPPGAVGPAGKDGEAGAQGPPGPAGPAGERGEQGPA, respectively; the amino acid sequence of the recombinant protein 2 for comparison was: ACSSSPSKHCGGGGGSIQWNAPQPSHISKYILRWRPKNSVGRWKEATIPGHLNSYTIKGLKPGVVYEGQLISIQQYGHQEVTRFDFTTTSTSTGSAVPPPTDLRFTNIGPDTMRVTWAPPPSIDLTNFLVRYSPVKNEEDVAELSISPSDNAVVLTNLLPGTEYVVSVSSVYEQHESTPLRGRQKTVSDVPRDLEVVAATPTSLLISWDAPAVTVRYYRITYGETGGNSPVQEFTVPGSKSTATISGLKPGVDYTITVYAVTGRGDSPASSKPISINYRTGGGGSGPPGPAGQDGRPGPPGPPGARGQAGVMGFPGPKGAAGEPGKAGERGVPGPPGAVGPAGKDGEAGAQGPPGPAGPAGERGEQGPA are provided.

In an attempt to ligate the control target fragment 1 and the control target fragment 2 into E.coli, the control target fragment 1 and the control target fragment 2 could not be transformed into E.coli, and thus recombinant proteins of the control target fragment 1 and the control target fragment 2 could not be obtained by an E.coli expression system.

The above results demonstrate that the composite transdermal recombinant fibronectin TD-1-FN-COL of the present application has a small molecular weight (about 33 kD), is easily prepared by DNA recombination technology, and retains the biological functions and activities of fibronectin. Among them, TD-1 short peptide has the function of promoting the transdermal absorption of recombinant fibronectin, but has no influence on the biological activity of recombinant fibronectin. The collagen is added to form the transdermal recombinant fibronectin with composite functions, has stronger capability of promoting cell adhesion, growth and proliferation than the original transdermal fibronectin, and has obvious advantages.

In summary, after the transdermal short peptide shown in SEQ ID No.1, fibronectin shown in SEQ ID No.2 and collagen shown in SEQ ID No.3 are connected in sequence, the three polypeptides are synergistic to play a role of 1+1+1 > 3, and have better transdermal effect and capability of promoting cell adhesion, cell extension and cell growth than the transdermal short peptide, the fibronectin and the collagen which are independent.

The foregoing is only a preferred embodiment of the present application and it should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present application, and these improvements and modifications should also be considered as the protection scope of the present application.

Sequence listing

<110> Beijing institute of Tiyi medicine

<120> a composite transdermal recombinant fibronectin and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 11

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Cys Ser Ser Ser Pro Ser Lys His Cys Gly

1 5 10

<210> 2

<211> 264

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Ile Gln Trp Asn Ala Pro Gln Pro Ser His Ile Ser Lys Tyr Ile Leu

1 5 10 15

Arg Trp Arg Pro Lys Asn Ser Val Gly Arg Trp Lys Glu Ala Thr Ile

20 25 30

Pro Gly His Leu Asn Ser Tyr Thr Ile Lys Gly Leu Lys Pro Gly Val

35 40 45

Val Tyr Glu Gly Gln Leu Ile Ser Ile Gln Gln Tyr Gly His Gln Glu

50 55 60

Val Thr Arg Phe Asp Phe Thr Thr Thr Ser Thr Ser Thr Gly Ser Ala

65 70 75 80

Val Pro Pro Pro Thr Asp Leu Arg Phe Thr Asn Ile Gly Pro Asp Thr

85 90 95

Met Arg Val Thr Trp Ala Pro Pro Pro Ser Ile Asp Leu Thr Asn Phe

100 105 110

Leu Val Arg Tyr Ser Pro Val Lys Asn Glu Glu Asp Val Ala Glu Leu

115 120 125

Ser Ile Ser Pro Ser Asp Asn Ala Val Val Leu Thr Asn Leu Leu Pro

130 135 140

Gly Thr Glu Tyr Val Val Ser Val Ser Ser Val Tyr Glu Gln His Glu

145 150 155 160

Ser Thr Pro Leu Arg Gly Arg Gln Lys Thr Val Ser Asp Val Pro Arg

165 170 175

Asp Leu Glu Val Val Ala Ala Thr Pro Thr Ser Leu Leu Ile Ser Trp

180 185 190

Asp Ala Pro Ala Val Thr Val Arg Tyr Tyr Arg Ile Thr Tyr Gly Glu

195 200 205

Thr Gly Gly Asn Ser Pro Val Gln Glu Phe Thr Val Pro Gly Ser Lys

210 215 220

Ser Thr Ala Thr Ile Ser Gly Leu Lys Pro Gly Val Asp Tyr Thr Ile

225 230 235 240

Thr Val Tyr Ala Val Thr Gly Arg Gly Asp Ser Pro Ala Ser Ser Lys

245 250 255

Pro Ile Ser Ile Asn Tyr Arg Thr

260

<210> 3

<211> 6

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Gly Phe Pro Gly Glu Arg

1 5

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcttgtagta gcagcccgag caaacattgc ggt 33

<210> 5

<211> 792

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atccagtgga atgcaccaca gccatctcac atttccaagt acattctcag gtggagacct 60

aaaaattctg taggccgttg gaaggaagct accataccag gccacttaaa ctcctacacc 120

atcaaaggcc tgaagcctgg tgtggtatac gagggccagc tcatcagcat ccagcagtac 180

ggccaccaag aagtgactcg ctttgacttc accaccacca gcaccagcac aggatctgct 240

gttcctcctc ccactgacct gcgattcacc aacattggtc cagacaccat gcgtgtcacc 300

tgggctccac ccccatccat tgatttaacc aacttcctgg tgcgttactc acctgtgaaa 360

aatgaggaag atgttgcaga gttgtcaatt tctccttcag acaatgcagt ggtcttaaca 420

aatctcctgc ctggtacaga atatgtagtg agtgtctcca gtgtctacga acaacatgag 480

agcacacctc ttagaggaag acagaaaaca gtttctgatg ttccgaggga cctggaagtt 540

gttgctgcga cccccaccag cctactgatc agctgggatg ctcctgctgt cacagtgaga 600

tattacagga tcacttacgg agaaacagga ggaaatagcc ctgtccagga gttcactgtg 660

cctgggagca agtctacagc taccatcagc ggccttaaac ctggagttga ttataccatc 720

actgtgtatg ctgtcactgg ccgtggagac agccccgcaa gcagcaagcc aatttccatt 780

aattaccgaa ca 792

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtttcccgg gtgaacgt 18

Claims

1. A composite transdermal recombinant fibronectin comprising: a fusion polypeptide in which transdermal short peptide, fibronectin and collagen are sequentially linked;

2. The complex transdermal recombinant fibronectin of claim 1, wherein the transdermal short peptide is linked to the fibronectin by a linking peptide;

the fibronectin is linked to the collagen with a linking peptide.

3. The composite transdermal recombinant fibronectin of claim 2, wherein the amino acid sequence of the linker peptide is one of GGGGS, GSGGSGGGSGGSGGG or GGGGSGGG.

4. A nucleotide sequence encoding the complex transdermal recombinant fibronectin of any one of claims 1-3.

5. The nucleotide sequence of claim 4,

6. A recombinant expression vector comprising the nucleotide sequence of claim 4 or 5.

7. An engineered bacterium comprising the recombinant expression vector of claim 6.

8. Use of the composite transdermal recombinant fibronectin of any one of claims 1-3 in the preparation of a product for penetrating the skin barrier.

9. Use of the composite transdermal recombinant fibronectin of any one of claims 1-3 in preparation of products for promoting cell adhesion, cell spreading and cell growth.

10. A skin preparation comprising the composite transdermal recombinant fibronectin of any one of claims 1 to 3 and a pharmaceutically acceptable excipient.