CN113699269A - SNP (single nucleotide polymorphism) site related to small spike number per spike and spike grain number character of wheat and application thereof - Google Patents

Abstract

The invention discloses SNP sites related to the traits of small spike number per spike and grain number per spike of wheat and application thereof, and the SNP sites comprise a kit, primers and related molecular markers for identifying or assisting in identifying the traits of small spike number per spike and grain number per spike of wheat, and application of the elements in identifying or assisting in identifying the traits of small spike number per spike and grain number per spike of wheat. The invention provides a new method for the molecular marker-assisted selective breeding of wheat, and has important significance in cultivating high-yield wheat varieties and researching.

Description

SNP (single nucleotide polymorphism) site related to small spike number per spike and spike grain number character of wheat and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP site related to the number of small ears per ear and the number of grains per ear of wheat and application thereof.

Background

Wheat (Triticum aestivum L) is an important grain crop in the world, and increasing wheat yield is one of the main targets of breeders. With the increase of population, the improvement of the unit yield of wheat and the guarantee of the stable yield of the wheat are important ways for meeting the increasing requirements of food in recent years. The wheat yield is composed of three factors of spike number per unit area, grain number per spike and thousand grain weight. The three factors are also called the yield structure of wheat, and the product of the three factors is the yield per unit area of wheat. The number of small ears per ear is a key influence factor of the number of grains per ear. Meanwhile, the grain number per spike is also an important limiting factor influencing high yield of wheat, the grain number per spike is quantitative character controlled by multiple genes, continuous variation is realized, and the genetic basis is relatively complex. Therefore, it is important to excavate and control the excellent allelic variation of the small ear number and/or the ear number and develop a functional marker.

Currently, researchers have located a large number of QTLs that regulate the number of spikelets per ear. Liu et al genotyped the recombinant inbred line population containing 199 lines created by the hybridization of 20828' with the State examine wheat Chuan nong 16, and QTL positioning is carried out on spikelet number locus, 5 stable spikelet number QTL are detected on 2D, 4B, 5A, 5B and 5D chromosomes. Zhang et al preliminarily obtain QTL sites/regions related to spike trait by using QTL ICIMapping composite interval mapping method, and lay a theoretical foundation for further fine positioning of spike trait of wheat, gene cloning and molecular marker-assisted selective breeding. Luxiang and the like locate QTL of several related characters of the ear of wheat by utilizing a single-marker analysis and a composite interval mapping method, and find that 1 important QTL related to ear length, spikelet number, spikelet grain number and spike grain number exists on a 1A chromosome respectively. Zhang et al performed QTL analysis on the spike trait by SLAF-seq technology in combination with phenotype data of 9 different environments, and detected 30 QTLs related to spikelet number on chromosomes 1B, 2D, 4A, 4B, 5B, 6B, 7A and 7D, wherein a plurality of QTLs are QTLs stably expressed in a plurality of environments.

Meanwhile, researchers have also located a large number of genes and QTLs that regulate grain number per ear. Chen et al obtained 8 genes related to spike grain number by performing comprehensive comparison analysis on 156 genes in the interval through Ensembl Plants and NCBI of the credit-producing website. Ren et al used 23536 DArT probes covering 21 chromosomes of wheat for detection, constructed genetic linkage map, then carried out QTL positioning on grain number per ear, and detected 10 QTL controlling grain number per ear. Zuo et al, by bioinformatics means, performed map integration, mapping and meta-analysis on 163 QTL sites controlling the number of grains per spike from different genetic mapping populations, and finally obtained 35 consistent QTLs. Plum waves and the like utilize a wheat 55K SNP chip to carry out genotyping to construct a high-density genetic linkage map, and the QTL of 4 spikelets is identified in 5 environments at 2 points in 3 years. Wang et al performed protein function screening on 93 candidate genes by using wheat whole genome function annotation and Ensembl Plants to obtain 5 candidate genes for controlling the trait of the number of grains per spike of wheat.

Although such a large number of QTLs associated with the number of ears per ear of wheat and the number of grains per ear of wheat have been currently located. However, most of these QTLs are micro-effect QTLs, and stable expression in different environments is difficult, which makes practical use difficult.

Disclosure of Invention

The invention aims to solve the technical problem of providing a wheat small ear number per ear and ear grain number character related SNP site and application thereof.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows.

A kit is used for detecting the single nucleotide polymorphism of SNP loci in a wheat genome, wherein the SNP loci correspond to 1010 th base of a sequence shown in SEQ ID NO.1 from the 5' end.

As a preferred embodiment of the present invention, the nucleotide at the SNP site is G or A; when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B.

As a preferred technical scheme, the kit comprises a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in a sequence table and/or a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence table.

A primer, which is used for detecting the single nucleotide polymorphism of the SNP locus in the wheat genome, wherein the SNP locus corresponds to the 1010 th base from the 5' end of the sequence shown in SEQ ID NO. 1; the nucleotide at the SNP site is G or A; when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B.

As a preferred technical scheme, the primers are a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in a sequence table and/or a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence table.

A molecular marker whose nucleotide sequence is the sequence of the 5 'end 989-1144 bit in SEQ ID NO.1 and/or whose nucleotide sequence is the sequence of the 5' end 797-1406 bit in SEQ ID NO. 1.

The kit, the primers and the molecular marker are used for identifying or assisting in identifying the small spike number per spike and the spike grain number character of the wheat.

The kit, the primer and the molecular marker are applied to wheat breeding.

A method for identifying or assisting in identifying the small ear number per ear and grain number per ear traits of wheat comprises the following steps:

A. carrying out PCR amplification on any section of DNA fragment containing the following SNP sites in the genome DNA of the wheat to be detected, and carrying out enzyme digestion identification on the PCR amplification product; the SNP site corresponds to the 1010 th base from the 5' end of the sequence shown in SEQ ID NO. 1;

B. determining the genotype of the wheat to be detected, wherein when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B;

C. determining the small ear number per ear and the grain number per ear properties of the wheat to be detected according to the genotype of the wheat to be detected and the following standards: the number of small ears per ear and the number of grains per ear of the genotype A homozygous wheat are smaller than/candidate smaller than the number of small ears per ear and the number of grains per ear of the genotype B homozygous wheat.

As a preferred technical solution of the present invention, in step a: the DNA fragment amplified by the PCR is 989-1144bp at the 5' end in SEQ ID NO. 1; the specific primer pair for PCR amplification is a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO. 5; the enzyme digestion comprises the following steps: taking wheat genome DNA as a template, and taking the primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product by 10 times, and taking the diluted PCR product as a template and taking the primers 2F and 2R as a primer pair to amplify to obtain a PCR product; the PCR product is cut by restriction enzyme PstI; in the step B: if the PCR product can be cut, the nucleotide polymorphism site is G/G, and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphism site is A/A, and the genotype is B.

Adopt the produced beneficial effect of above-mentioned technical scheme to lie in: the invention discovers 18 SNPs through analyzing the genetic variation of DPY1 genes in a wheat natural variation population, and the SNPs respectively correspond to 609 th, 663 th, 1010 th, 1268 th, 1830 th, 2464 th, 2647 th, 3045 th, 3195 th, 3234 th, 3787 th, 4341 th, 4486 th, 4711 th, 4964 th, 5022 th, 5029 th and 5122 th from the 5' end of a sequence table 1. By designing a dCAPS marker for the 3 rd SNP site, the SNP is found to have two genotypes: genotype A (G) and genotype B (A). Correlation analysis proves that the size of the spikelet number per ear in the homozygous types of the two haplotypes is as follows: genotype B homozygous wheat > genotype A homozygous wheat; meanwhile, in the homozygous type of the two haplotypes, the ear size is: wheat homozygous for genotype b > wheat homozygous for genotype a. Experiments prove that the wheat with relatively high spikelet number and/or spike grain number can be found by detecting the SNP. The invention provides a new method for the molecular marker-assisted selective breeding of wheat, and has important significance in cultivating high-yield wheat varieties and researching.

Drawings

FIG. 1 shows the result of electrophoresis detection of a dCAPS labeled enzyme-digested product developed by SNP of the present invention; wherein lane M is a molecular weight standard; lane G is a band cut by PstI, and lane A is a band not cut by PstI.

Detailed Description

The following examples illustrate the invention in detail. The raw materials and various devices used in the invention are conventional commercially available products, and can be directly obtained by market purchase.

It will be understood that the terms "comprises" and "comprising," when used in this specification and the appended claims, specify the presence of stated features, integers, steps, operations, elements, and do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, and groups thereof.

It should also be understood that the term "and/or" as used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

As used in this specification and the appended claims, the term "if" may be interpreted contextually as "when", "upon" or "in response to" determining "or" in response to detecting ". Similarly, the phrase "if it is determined" or "if a [ described condition or event ] is detected" may be interpreted contextually to mean "upon determining" or "in response to determining" or "upon detecting [ described condition or event ]" or "in response to detecting [ described condition or event ]".

Furthermore, in the description of the present application and the appended claims, the terms "first," "second," "third," and the like are used for distinguishing between descriptions and not necessarily for describing or implying relative importance.

Reference throughout this specification to "one embodiment" or "some embodiments," or the like, means that a particular feature, structure, or characteristic described in connection with the embodiment is included in one or more embodiments of the present application. Thus, appearances of the phrases "in one embodiment," "in some embodiments," "in other embodiments," or the like, in various places throughout this specification are not necessarily all referring to the same embodiment, but rather "one or more but not all embodiments" unless specifically stated otherwise. The terms "comprising," "including," "having," and variations thereof mean "including, but not limited to," unless expressly specified otherwise.

The wheat material used in the following examples was from the national crop germplasm library (http:// icscaas. com. cn/jiguoku/zhongzhiku. htm), and the material information is presented in the chinese crop germplasm information web, website: http:// icgr.

Example 1 spike number-related SNP and PCR-cleavage polymorphism detection thereof

1. Specific primer for amplifying genome segment containing wheat SNP and sequence analysis

One SNP found in the exonic region of gene DPY1 on the wheat genome corresponds to the sequence listing SEQ ID NO: 11 from the 1010 th site at the 5' end, the site is found to have two genotypes in the wheat natural variation population:

genotype A: g

Genotype B: a. the

According to the sequence difference of different wheat genomes, designing specific primers for PCR amplification of DNA fragments respectively containing the SNP sites:

F1：TCTGGACAGGCTATTG(SEQ ID NO：2)；

R1：AATTCCCAGCAATGCTG(SEQ ID NO：3)；

F2:CTTTCCTCTGTGTACACTGCA(SEQ ID NO：4)；

R2:AACAAGAATAACTAAGGG(SEQ ID NO：5)。

the target sequence of PCR amplification by taking F1 and R1 as primer pairs is shown as 797-1406 bit sequence in sequence 1 of the sequence table; the target sequence of PCR amplification by taking F2 and R2 as primer pairs is shown as 989-1144 bit sequence in sequence 1 of the sequence table. Enzyme analysis showed that the polymorphism could be recognized by PstI, respectively.

2. Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

1) Extracting genome DNA of wheat to be detected;

2) using the genomic DNA obtained in the step 1) as a template, and performing PCR amplification by using primers F1 and R1, wherein a PCR amplification system (20 mu L) comprises: ddH₂mu.L of O7. mu.L, 10. mu.L of 2 XTaq Mix, 1. mu.L of each of primer F1 (10. mu. mol/L) and primer R1 (10. mu. mol/L), and 1. mu.L of template (20 ng/. mu.L).

PCR amplification conditions were 95 ℃ for 3 min; 30s at 95 ℃, 30s at 56 ℃ and 30s at 72 ℃ for 32 times of circulation; storing at 72 deg.C for 10min and 16 deg.C.

3) Diluting the PCR product obtained in the step 2) by 10 times, and performing PCR amplification by using primers F2 and R2 by using the diluted PCR product as a template, wherein a system (20 mu L) for PCR amplification is as follows: ddH₂mu.L of O7. mu.L, 10. mu.L of 2 XTaq Mix, 1. mu.L of each of primer F1 (10. mu. mol/L) and primer R1 (10. mu. mol/L), and 1. mu.L of template (20 ng/. mu.L).

PCR amplification conditions were 95 ℃ for 3 min; 30s at 95 ℃, 30s at 56 ℃ and 30s at 72 ℃ for 32 times of circulation; storing at 72 deg.C for 10min and 16 deg.C.

4) Carrying out enzyme digestion on the PCR product obtained in the step 3) by using PstI to obtain a digestion product, carrying out 4% agarose gel electrophoresis detection, recording whether the PCR product is cut into two fragments, and judging and recording the condition of the wheat to be detected at the position according to the following method:

if the enzyme digestion product is two fragments, the wheat to be detected is homozygous for G (shown as G/G) at the site (a lane G in figure 1);

if the enzyme digestion product is a fragment, the wheat to be detected is homozygous for A (shown as A/A) at the site (a lane A in figure 1).

5) According to the results of step 4), wheat was classified into I, II types in the case of the site as follows:

i: G/G (i.e., genotype A homozygous);

II: A/A (i.e., genotype B homozygous);

the "/" is preceded by a case on one homologous chromosome and the "/" is followed by a case on the other homologous chromosome.

3. Typing natural population by using dCAPS marker and performing correlation analysis on spike grain number character

And (3) taking 323 parts of hexaploid wheat in a natural population as the wheat to be tested, parting according to the method in the step 2, and randomly performing sequencing verification on the amplification products of part of wheat, wherein the results are shown in table 1.

TABLE 1 situation of the polymorphic sites in the wheat Natural population

Example 2

In 2015, the natural population wheat was planted in the hot and water areas of the experimental farm of the institute of crop science of Chinese academy of agricultural sciences (Beijing cisterm), in 2016, in the hot and water areas of the experimental farm of the institute of crop science of Chinese academy of agricultural sciences (Beijing cisterm and Changping), the number of spikelets per ear of each wheat variety was investigated, the number of spikelets per ear and the conditions of the polymorphic sites were subjected to correlation analysis by using Tassel2.1 software, and a mixed linear model + population structure (MLM + (Q + K)) method was selected for analysis, with P <0.05 as a significance level, and the results are shown in Table 2.

TABLE 2 correlation analysis results of DPY1-A gene polymorphic site conditions and spikelets per spike in natural populations

The correlation analysis results in table 2 indicate that the difference in the number of spikelets per ear of the two types formed by the natural population composed of 323 hexaploid wheat shown in table 1 reaches a significant level (P < 0.05). Wherein the number of spikelets per ear of wheat of type II is higher than the number of spikelets per ear of wheat of type I. In several environments, wheat material of type I has 0.39, 0.76 and 0.76 spikelets per ear less than wheat of type II, respectively. Studies of natural populations have shown that type II is an excellent genotype to increase the number of spikelets per ear of wheat.

Example 3

In 2015, the natural population wheat was planted in dry land and water land of the experimental farm of the institute of crop science of Chinese academy of agricultural sciences (Beijing cisterm), in 2016, the number of grains per ear of each wheat variety was investigated, the number of grains per ear and the condition of the polymorphic site were analyzed by association with software of Tassel2.1, and a mixed linear model + population structure (MLM + (Q + K)) method was selected for analysis, with P <0.05 as a significance level, with the results shown in Table 3.

TABLE 3 correlation analysis results of DPY1-A gene polymorphism site conditions and panicle number in natural population

The correlation analysis results in table 3 indicate that the spike grain number difference of the two types formed by the natural population composed of 323 hexaploid wheat shown in table 1 reaches a significant level (P < 0.05). Wherein the number of wheat ear grains of type II is higher than the number of wheat ear grains of type I. In several circumstances, type I wheat material has 2.32, 2.31, 2.49 and 3.01 grains per ear less than type II wheat, respectively. The research on natural population shows that type II is an excellent genotype for increasing the number of grains of wheat ears.

In the above embodiments, the descriptions of the respective embodiments have respective emphasis, and reference may be made to the related descriptions of other embodiments for parts that are not described or illustrated in a certain embodiment.

In summary, the present invention finds 18 SNPs by analyzing the genetic variation of the DPY1 gene in the natural variation population of wheat, which correspond to positions 609, 663, 1010, 1268, 1830, 2464, 2647, 3045, 3195, 3234, 3787, 4341, 4486, 4711, 4964, 5022, 5029 and 5122 of the sequence table 1 from the 5' end. By designing a dCAPS marker for the 3 rd SNP site, the SNP is found to have two genotypes: genotype A (G) and genotype B (A). Correlation analysis proves that the size of the spikelet number per ear in the homozygous types of the two haplotypes is as follows: genotype B homozygous wheat > genotype A homozygous wheat; meanwhile, in the homozygous type of the two haplotypes, the ear size is: wheat homozygous for genotype b > wheat homozygous for genotype a. Experiments prove that the wheat with relatively high spikelet number and/or spike grain number can be found by detecting the SNP. The invention provides a new method for the molecular marker-assisted selective breeding of wheat, and has important significance in cultivating high-yield wheat varieties and researching.

The above-mentioned embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; such modifications and substitutions do not substantially depart from the spirit and scope of the embodiments of the present invention, and are intended to be included within the scope of the present invention.

Sequence listing

<110> university of northriver

<120> wheat small ear number per ear and ear grain number character related SNP site and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5494

<212> DNA

<213> common wheat (Triticum aestivum L)

<400> 1

ggcggtttgc agcggcagcg gcatggatcg gtcgataggg tgcctgttgc ctgttggcgt 60

ctgcccccac tccactccac cagcccagca ccaacctcca ttcgcttccc ttgctgcgcg 120

ctagtactag tagattagat aggcgggcgg gcgggattga ttttgattga tcgccttcct 180

tctccttccg gcggccgagc gggctccctt ctgctctgct gccgcggcgc ggcgcggagg 240

cgggggaatt ccggtgtggt tcggtcttcg tctccgtcgc cgccgtcgtc ttgtccgggg 300

cgaatctgcg ggctgcggag gggatggaga cgtgggcgcg gtggcggtgg tgggtggtgg 360

ccgccgccgg cgtgctctgc gcggtcctgc cgccgccggc gtgctctgcg cggtcctgcc 420

gccgccggcc gccgccacgc tctctcccac cggcatcaac tacgaaggta accatcttat 480

cgatcttgct tcttcccccg agtttctctc aagtgaaaaa agtgttttcc ggcgcaacaa 540

gattcagcca aattggcaaa ggatttccgg tttcccttct tggcaacccc caatttggag 600

aagcgcacca atgccggcgc ttccgttgct tcctcgccat aactgatgtt tgctgccatg 660

tctcaaaaaa aaaagttgtt tgctgctggg atttggttaa gctgagcctg aatcttgttg 720

ggtcgcagtg gtggcgctca tggccatcaa gacggagctg caggaccact acaacgtgct 780

cgacaactgg gacatcaact ccgtcgaccc ctgcagctgg aggatggtca cctgctcctc 840

cgacggctac gtctccgcgc tgtacgcccc gctctttgcc cctcctccgg tctatctccg 900

gtgagcgtca ccagactaat cttctcaggt tcatctgtgc tcgcagtggt ctgcccagcc 960

aacgcctgtc cggaaaactg tcgcccggca tcgggaacct caccaggctg caatctgtgt 1020

aagcggctca ttgctagtaa aatttattac tgtttctttg aaaatgtatt gctctaggtt 1080

ccagaaaaat gaaagattgc aagtgttcgt gtttactgtt tctggacagg ctattgcaga 1140

acaacgcgat ttccggcact attcccagca ccataggcag gctggggatg ctccagacgc 1200

tcgacatgtc agacaatcat ctcaccggga gcatcccgac ttcactcggc gatctcaaga 1260

acctcaacta tctgtgagat ttcttgaccc ggttattgaa tttctctgcc tctttcctct 1320

gtgtacacag cagttcactc cttgtcctct tgttcctgcc aggaaattga ataacaacag 1380

tttatctgga gtcttacctg aatcactggc caccattaat ggcctcgcac ttgtgtatgt 1440

cctgtgaatc ccttagttat tcttgtttcc ctctttcctc tgtgtactgc aacaagcagc 1500

tctaataatt ggcctgtttc gcagagacct ctcgtttaac aacctgagcg gtcccgtgcc 1560

aaagatttct gcaagaactt tcaggtgagt agttcagctt atgcccgatc acctggctaa 1620

ttcaattcct acctgaacac cctccgtgca tgctctacac tattattgct catgctctca 1680

tttcttcttt cctttattgt cgcttgtttg tacagcattg ctgggaattc aatgatctgt 1740

ggcgtcaagt ctggagacaa ttgctcgtcc gtgtcgctgg acccgctttc ttatccacca 1800

gatgacctta agagtgagaa tttttttctt ttttctttta ccttgagaaa tatacatcaa 1860

tagcataaaa atggtattgt tttatcccct ctgctctgct catattcgtt tccttttctt 1920

cagttcagcc acaacaagcc atgtcaagaa gtcaccgaat tgctatcatc tgtggagcaa 1980

ctgtgggttc tgtagcgttt gtcgctattg tggtcagtat gcttctttgg tggaggcata 2040

ggcgtaatca gcagatattt tttgatgtaa atggtaatgc tcttttcgat gttgggcttg 2100

ttcatagtaa cactgtctgg atttaaactt caaaaaatag acatctttgt tgtgtcaaag 2160

attgaagaat cttgtttctt tagttttgag ctatatgttt catattttcc tgtttcgtag 2220

caaattaatt ttgacaaaga gagatataaa aatgctcttg gttcatttga cttacttacc 2280

tttggtcaaa gctgaatggt taacattgga ctaatcttca gttatttaat ttccacaccg 2340

tgttaaattc aaataaacac gggataccac ataatccatt ttgtggattt ctgtagcttc 2400

tagtgataac ataggcaatc aatctgttac agttcattag gacagccact accaattcag 2460

aattttatac ttggttgctt acatgcctag gtgccccttg ttacaaaaac ctttgctgca 2520

gttctgccca gttacttttg atacattgat ttgccttgca acaaacatga gatctctcat 2580

tttacaaata tactacttga tctggtagtt ataacatgct tacagtttgg gtccatgctt 2640

tcctgtctgg catgttatgc tgttttagtt ccatactatg gtacctgata ctgatacctc 2700

ctcttagcta cagatcaata tgacccagaa gtatgcttgg gccatctgaa aaagtacacc 2760

ttcaaggagc ttcgagcatc taccaacaat ttcaactcaa aaaacatatt aggtgaaggt 2820

ggctatggaa tagtatacaa gggtttctta cgtgatggtt cgattgttgc tgttaaaaga 2880

ttgaaagact acaatgctgt tggtggggaa gttcaatttc aaactgaagt tgaagtcata 2940

agcttagctg ttcatcggaa tctcctacgg ctcattggat tctgcactac agagtgcgag 3000

agattacttg tctatcctta tatgccaaat ggaagtgttg cttctcaatt gcgtggttag 3060

tctctttccc catgcactta agaacctttt aagtaattag cattacttgt gcagattcat 3120

taatggcctg tttaatttct gctttccttt gccatgcatt aggctcattt cagatttaca 3180

gtctagcatg gatccatgtt ggcgtattgt ttcagtcaac tcagactgcc accaaatgct 3240

caacttgaaa agctgacact tgttagcgtt caggacaaga gatcctcaac atgttcacct 3300

atagcatgtc atatagtagt cttatctgct tttagtgaaa gttatactac aatcttgaaa 3360

gcattaacta ggctcataca cagtctacca gccatttgtg gttttgagtt ttgacccacc 3420

tacctttcac cacatatcat cctgggtaga ttcgtccttc tgtctcgcca tcaaacaaag 3480

ctcggctatg gtgattgctc ctgttggaag tacactgttt gtgctgatag aagtagttcc 3540

atcaattaat tcaaatcata ctcatgctct ctgactccct ctatttactt aactctttat 3600

tgacatttca cagtgcacca tattttggaa tatgaactga gctatccaca acatgacatg 3660

tctagattta ctattgatga aatgaattaa tccctccgat tcatattact tgtcgctcac 3720

ttagtacaaa ataaaaaaag agccatctta tgacagcttt ccatttatac tattcagttt 3780

gcaagcaaac taaccttctc ttcagtaaac ctaaactttc ctgcatttct tttccagagc 3840

atataaatgg caagccagct ctagattggt cgaggagaaa gatgatagca ctgggtacag 3900

cgagagggct gctttatttg catgagcagt gtgatccaaa aataatccat cgtgatgtaa 3960

aagcctccaa tgtgcttctt gatgaatatt ttgaagcaat tgtgggtgat ttcggactgg 4020

caaaactgtt ggatcaccag gagacccatg ttaccactgc agtgcgtggt accgtgggac 4080

acatagctcc agagtatttg tcaactgggc agtcatcgga gaagacagat gtgtttgggt 4140

ttggggtcct gttggttgag ttgatcactg gccagaaagc attagatttc ggaagactgg 4200

caaatcagaa gggcggagtg cttgatttgg taagcatgtt atatcgtgtc ctttcggtgc 4260

aatggtctca agttcacttt attactttat gtgaaaagac cgctttctcc tttccattcg 4320

agtttcttcg attctcgcct ttagtttggt ctcttcagag cttttcgaca actatgtatg 4380

tcgcttttag ctcctttctc gccttttaca ttgagtacac ttgagatgct gaagcatatt 4440

ttcatagtag aaaacagaag ctgcaaaaat gatgccatcc ctgttagttt atatggcatt 4500

catttctgtt aatcgtttat catagtgtca gcatattaac tactccctcc gtaaactgat 4560

ataagatctt ttagatcact actttagttt acagaggaag taactattaa ccatcagtta 4620

ccaccttctg tttagagttc agacttgaga ccacttgtca aaataagtat tcaagggtgg 4680

tctcttttct tagtggtgta tacattttga aggatgccaa tacaaagaaa tatttcttgc 4740

cggaccacct aggtctcttt ctttgtgttc tttgtaaggg tgtcgatacg aagagatatt 4800

tcacgggcgg aaatcggcct tatttctgat tcttgcatgt ggtggttcca ggtaaagaag 4860

ctccatcagg agaagcagct gaacatgatg gtggacaaag acctgggcag caactacgac 4920

agggtggagc tggaggagat ggtgcaggtg gccctgctgt gcacgcagta ctacccgtcc 4980

caccgcccca ggatgtcgga ggtgatccgg atgctggaag gcgacgggct cgcggagaaa 5040

tgggaggcgt cgcagaacgt ggacacgccc aagtccgtct cgtcggagct cctgcccctg 5100

aagttcaccg atttcgcggg ggcggacgag tcctcggtcg gcctcgaggc catggagctc 5160

tccggaccaa ggtgaccggc gatccatttg atcgcgtaga tgcttgctgt tgcctggatg 5220

gtcgcattcg actaggagac ggggcaaagg agaggtgaca ttttttttga tgtcggatag 5280

ggtaagggta ggtggtggca ttcatttgta tatacgggca tggtatcgtg tatttgtgtg 5340

agctcaggtc ggcccttcgt tgctgctcat gtacatgtag gctaagagag aagagaagag 5400

aagagatggg atgagttgag taaatataca gtagaaagga aaatcttcca ttagtcagat 5460

atatcctatg tctttcctct tgtttgtcag gcct 5494

<210> 2

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tctggacagg ctattg 16

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aattcccagc aatgctg 17

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctttcctctg tgtacactgc a 21

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aacaagaata actaaggg 18

Claims (10)

1. A kit is used for detecting the single nucleotide polymorphism of SNP loci in a wheat genome, wherein the SNP loci correspond to 1010 th base of a sequence shown in SEQ ID NO.1 from the 5' end.

2. The kit of claim 1, wherein: the nucleotide at the SNP site is G or A; when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B.

3. The kit of claim 1, wherein: the kit comprises a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in a sequence table and/or a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence table.

4. A primer, which is used for detecting the single nucleotide polymorphism of the SNP locus in the wheat genome, wherein the SNP locus corresponds to the 1010 th base from the 5' end of the sequence shown in SEQ ID NO. 1; the nucleotide at the SNP site is G or A; when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B.

5. The primer of claim 4, wherein: the primers are a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence table and/or a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence table.

6. A molecular marker whose nucleotide sequence is the sequence of the 5 'end 989-1144 bit in SEQ ID NO.1 and/or whose nucleotide sequence is the sequence of the 5' end 797-1406 bit in SEQ ID NO. 1.

7. Use of the kit of claim 1, 2 or 3, the primer of claim 4 or 5, or the molecular marker of claim 6 for identifying or assisting in identifying traits of wheat spikelet per spike and spike grain number.

8. Use of the kit of claim 1 or 2 or 3, the primer of claim 4 or 5, the molecular marker of claim 6 in wheat breeding.

9. A method for identifying or assisting in identifying the small ear number per ear and the grain number per ear of wheat is characterized by comprising the following steps: the method comprises the following steps:

A. carrying out PCR amplification on any section of DNA fragment containing the following SNP sites in the genome DNA of the wheat to be detected, and carrying out enzyme digestion identification on the PCR amplification product; the SNP site corresponds to the 1010 th base from the 5' end of the sequence shown in SEQ ID NO. 1;

B. determining the genotype of the wheat to be detected, wherein when the nucleotide at the SNP site is G/G pure, the corresponding genotype is A; when the nucleotide at the SNP site is A/A pure, the corresponding genotype is B;

C. determining the small ear number per ear and the grain number per ear properties of the wheat to be detected according to the genotype of the wheat to be detected and the following standards: the number of small ears per ear and the number of grains per ear of the genotype A homozygous wheat are smaller than/candidate smaller than the number of small ears per ear and the number of grains per ear of the genotype B homozygous wheat.

10. The method for identifying or assisting in identifying traits of spikelet number per spike and kernel number per spike of wheat according to claim 9, wherein:

in the step A: the DNA fragment amplified by the PCR is 989-1144bp at the 5' end in SEQ ID NO. 1; the specific primer pair for PCR amplification is a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO. 5; the enzyme digestion comprises the following steps: taking wheat genome DNA as a template, and taking the primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product by 10 times, and taking the diluted PCR product as a template and taking the primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonucleasesPstICarrying out enzyme digestion on a PCR product;

in the step B: if the PCR product can be cut, the nucleotide polymorphism site is G/G, and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphism site is A/A, and the genotype is B.

Images