CN113699163B

CN113699163B - Rice premature senility dwarf gene ESD1 and application thereof

Info

Publication number: CN113699163B
Application number: CN202110605181.0A
Authority: CN
Inventors: 饶玉春; 褚晓洁; 严钢; 芦涛; 何瑞; 吴先美; 叶涵斐; 林晗; 王盛; 贾绮玮; 王珂欣
Original assignee: Zhejiang Normal University CJNU
Current assignee: Hegang Yingyuan Rice Industry Co ltd
Priority date: 2021-05-31
Filing date: 2021-05-31
Publication date: 2023-10-03
Anticipated expiration: 2041-05-31
Also published as: CN113699163A

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice premature senility dwarf gene ESD1 and a mechanism for regulating and controlling rice premature senility dwarf by the gene, and also relates to application of the gene in breeding. The invention discloses a rice premature senility dwarf gene ESD1, wherein the nucleotide sequence of an ESD1 gene mutant is shown as SEQ ID NO.2, and the invention also discloses a protein encoded by the rice premature senility dwarf gene ESD1. The invention also discloses application of the rice premature senility dwarf gene ESD 1: the rice premature senility dwarfing gene ESD1 promotes senescence and plant height dwarfing.

Description

Rice premature senility dwarf gene ESD1 and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice premature senility dwarf gene ESD1 and a mechanism for regulating and controlling rice premature senility dwarf by the gene, and also relates to application of the gene in breeding.

Background

Rice is a main grain crop in the world, so how to ensure high quality and high and stable yield of rice is an important topic of benefit and all mankind. In agricultural production, rice yield is largely dependent on leaf photosynthesis ^[1] . The final stage of the leaf growth process is aging, which is a normal life phenomenon in the plant development process, and also shows the adaptability of the plant to the environment ^[2] . Leaf senescence has two main effects on plants, on the one hand, senescence leaves transport nutrients to new leaves or various tissues in growth ^[3] On the other hand, the capability of plants to adapt to biotic or abiotic stress is enhanced ^[4] . The senescence of rice leaves mainly occurs in the later growth and development stage of rice, and the premature senility of rice, especially the premature senility of functional leaves in the middle and later stages of grouting, greatly influences the accumulation of organic matters in seeds, thereby greatly influencing the yield and quality of rice ^[5] . The plant height is one of the main factors influencing the lodging of rice, and the cultivation of moderately dwarf rice varieties is beneficial to improving the lodging resistance of the moderately dwarf rice varieties, so that the yield loss is reduced and the rice quality is improved. Therefore, the cloning and functional research of the gene reveal the genetic regulation mechanism of the gene, and the gene has important significance for cultivating and creating anti-aging moderately dwarfed rice varieties.

The main causes of the senescence of rice leaves can be divided into internal and external factors, wherein the internal factors are mainly plant hormones and gene regulation, and the external factors are mainly growth environments, such as abiotic stress of light, drought, saline-alkali stress and the like and biotic stress of plant diseases and insect pests and the like. Leaf senescence also causes the change of various physiological indexes in plants, and when plant leaves begin to senesce, chlorophyll protein complex and photosynthetic yield are reduced, because photosynthetic carbon circulation in the leaves is destroyed, various free radicals and membrane lipid peroxidation are accumulated in cells, thereby causing stem leaf wilt, premature leaf failure and seed grain irrigation of plantsThe defective pulp has shrunken grains, resulting in reduced yield ^[6] 。

The dwarf phenotype rice can influence photosynthetic efficiency due to the reduction of the light receiving area of a single plant, meanwhile, dwarf rice stems are short, small, thick and strong, have good lodging resistance and fertilizer resistance, and the short and small stems can reduce the assimilation of the stems, so that more photosynthetic products are transferred to the scion, thereby improving the rice yield ^[7] . Recent researches show that in the rice mutant with the dwarf phenotype, the plant height and the biological yield are positively correlated, so that the research on the rice dwarf phenotype plays an important role in rice breeding.

Although there have been many studies on the rice premature senility gene and the dwarf gene, the interrelation and mechanism of action between the rice premature senility and the dwarf gene are not clear,

the references referred to above are as follows:

[1] lim Pyung Ok, kim Hyo Jung, gil Nam hong. Leaf Seniscence [ J ]. Annual Review of Plant biology.2007,58:115-136 (Lim P O, kim H J, gil N H. Leaf Senescence. Plant biology annual. 2007, 58:156-136);

[2] vicky Buchanan-Wollaston. The molecular biology of leaf senescence [ J ]. Journal of Experimental Botany.1997,48 (2): 181-199 (Vicky B W. J. Mol. Biol. Experimental plant J. 1997,48 (2): 181-199);

[3] kaidala Ganesha Srikanta Dani, silvia Finelschi, marco Michelozzi, et al Do cytokins, volatile isoprenoids and carotenoids synergically delay leaf senescence? [J] Plant, cell & environmental.2016, 39 (5): 1103-1111 (Kaidala G, silvia F, marco M, etc.. Cytokinin, volatile isoprenoids and carotenoids synergistically retard leaf senescence; plant, cell and environment.2016,39 (5): 1103-1111);

[4] kim Jeong sik, woo Hye Ryun, nam Hong Gil. Toward Systems Understanding of Leaf Senescence: an Integrated Multi-Omics Perspective on Leaf Senescence Research [ J ]. Molecular plant.2016,9 (6): 813-25 (Kim J, woo H R, nam H G. System understanding of leaf senescence: comprehensive multiple groups of chemical perspectives of leaf senescence research. Molecular plant.2016,9 (6): 813-25);

[5] yang Bo, xia Min, zhang Xiaobo, wang Xiao, zhu Xiaoyan, he Peilong, he Guanghua, sang Xian spring. Identification of rice presenility mutant esl6, gene mapping [ J ]. Crop theory, 2016,42 (07): 976-983;

[6] ma Ziming, bai Huijiao, jin Yongmei, wu Tao, flos Magnoliae, ma Yan, jiang Wenzhu, duxing Lin. Identification, genetic analysis and gene localization of rice presenility mutant es-h [ J/OL ]. Molecular plant breeding 1-10;

[7] yu Yonggong, S Hua Min. Research on genes related to dwarf of rice [ J ]. Provisions on plant genetic resources, 2005 (03): 344-347.

Disclosure of Invention

The invention aims to solve the problem of providing a rice leaf premature senility dwarf control gene ESD1 and application thereof in rice breeding.

In order to solve the technical problems, the invention provides the following technical scheme:

the nucleotide sequence of the rice premature senility dwarf gene ESD1 is SEQ ID NO.1, and the coded amino acid sequence is SEQ ID NO.3;

the nucleotide sequence of the ESD1 gene mutant is SEQ ID NO.2, and the coded amino acid sequence is SEQ ID NO.4.

The invention also provides application of the rice premature senility dwarf gene ESD 1: the rice premature senility dwarfing gene ESD1 promotes senescence and plant height dwarfing.

The method comprises the following steps: abnormal chloroplast development, reduced chlorophyll content, and increased cell peroxidation and death in rice esd1 tissue; the external appearance is that the leaf margin is yellow and the leaf tip is dead, and the plant height is obviously dwarfed.

The rice premature senility dwarf mutant esd1 is obtained by screening from EMS mutagenesis library of japonica rice variety "Longjing 31". From the seedling stage, the phenotype of yellowing of leaf margin, dead leaf tip and short plant height appears. The invention adopts a map cloning method to clone the control gene ESD1 of the premature senility dwarf mutant gene ESD1. The ESD1 gene is obtained by single base substitution of the ESD1 (LOC_Os 01g 11040) gene, namely, the 343 th nucleotide C of SEQ ID NO.1 is mutated into T. Blast analysis found that the ESD1 (loc_os01g11040) gene and ES1 reported in the former paragraph are alleles, encoding cAMP class receptor protein inhibitor. However, the ESD1 mutation site is not identical to ES1 and results in premature termination of the encoded amino acid sequence.

The rice ESD1 gene provided by the invention has wide application prospect in the aspects of affecting rice senescence and dwarfing, the existing research has more researches on the aspects of rice premature senility or rice dwarfing, but the molecular mechanism and the regulation mechanism between the rice premature senility and the dwarfing are not clear. The invention lays an important foundation for the connection between the premature senility and the dwarf of the rice and the cultivation of new germplasm materials for delaying the aging and the lodging resistance of the rice, has important reference significance for cultivating super-high-yield and high-quality rice breeding, and simultaneously provides theoretical basis for cultivating crops with the premature senility resistance, the high quality and the high yield. Namely, the rice premature senility dwarf gene ESD1 provided by the invention provides a reference for researching the action mechanism between the premature senility and the dwarf of rice.

The gene ESD1 provides various experimental materials for research on premature senility and dwarf of rice, namely one of the purposes of the ESD 1: providing various experimental materials for researching rice premature senility; and the second purpose is: is used for cultivating dwarf-stem lodging-resistant rice varieties. The gene of the invention is introduced into some high-stalk lodging rice according to a conventional hybridization method, so that plants are dwarfed and lodging resistance of crops is improved; can also be used for breeding hybrid rice. The hybrid rice combination is formed by matching sterile lines and restorer lines, most of hybrid rice (including sterile lines, restorer lines and combinations) in China belongs to semi-dwarf varieties, and the basic and main components of sterile line and restorer line breeding are semi-dwarf varieties. Therefore, the ESD1 gene can be introduced into the sterile line and the restorer line by conventional breeding means, so that excellent hybrid rice varieties can be obtained through screening.

Drawings

The following describes the embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 is a schematic representation of the mutation site of mutant esd 1;

FIG. 2 shows the seedling stage phenotype and chlorophyll content of wild type and mutant esd 1;

a: wild type, mutant ESD1 and strain of complementary transgenic ESD 1-C;

b: she Biaoxing for wild type and mutant esd 1;

c: SPAD of wild type and mutant esd 1;

FIG. 3 is a view of the wild type and mutant esd1 scanning electron microscope;

a-C: a wild-type scanning electron microscope observation chart;

D-F: mutant esd1 scanning electron microscope observation;

FIG. 4 is a view of the wild type and mutant esd1 transmission electron microscope;

a-C: a wild-type transmission electron microscope observation chart;

D-F: mutant esd1 transmission electron microscopy images;

FIG. 5 is a histochemical staining analysis of wild type and mutant esd 1;

a: DAB dyeing;

b: NBT staining;

FIG. 6 is wild-type and mutant esd1 leaf TUNEL treatment.

a-B: wild-type leaf TUNEL treatment;

C-D: mutant esd1 leaf TUNEL treatment.

Detailed Description

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

the experimental methods used in the following examples are conventional, unless otherwise specified. Materials and reagents used in the examples were commercially available unless otherwise specified. The present invention will be described in further detail with reference to the following examples and drawings.

Example 1 obtaining of Rice mutant Material

The rice mutant esd1 material used in the invention is obtained by treating the japonica rice variety "Longjing 31" by using a EMS (ethyl methane sulphonate) chemical mutagenesis method.

The EMS processing mode is as follows: soaking dry Longjing 31 seeds to be treated in clear water for 8-10 hours, draining, soaking the seeds to be treated in EMS solution with the concentration of 1.5% at 28 ℃ for 10 hours, washing with tap water for 10-12 hours, and finally placing the seeds into a 37 ℃ oven for germination acceleration. And selfing the treated Longjing 31 to obtain the generation M2. The mutant esd1 is found in the generation M2, and after multi-generation selfing, the premature senility dwarf phenotype of the mutant can be found to be inherited stably, and a homozygous mutant strain is obtained and is named esd1.

Genomic DNA of wild type ("Long Jing 31") and mutant esd1 were extracted, and PCR was performed using pairs of primers consisting of esd1-1028F (ccaggttccatttccctttt) and esd1-2228R (cccccatgctaacacaagat), esd1-1922F (ttggggtgatgagaagaagg) and esd1-3105R (tagcgacaccaccaacttca), esd1-2700F (ttcttaggataggcgcactga) and esd1-4027R (ttcactcagaggctcaagca), esd1-3861F (cgtgtcaagatttggcagaa) and esd1-5047R (gctcgggttcagtctctgtc), esd1-4665F (ttagcaatacccccttgcac) and esd1-5950R (cagttgaatggcaaagctga), esd1-5596F (gctcatggttaagcatttacagc) and esd1-6959R (ccatctgctcaaattccaca), esd1-6735F (ccgttccacagcttggtagt) and esd1-8015F (tgtcgactaggcatggatca), and esd1-7707F (tgccttcttcttttgccaat) and esd1-8964F (cagatttttccgtaggtccaa), respectively, and sequence alignment was performed.

As shown in FIG. 1, compared with the genomic DNA of the wild type "Longjing 31", the mutant ESD1 has only one single base substitution on the second exon, i.e., the C at 343bp of the ESD1 gene is replaced by T, resulting in premature termination of the encoded amino acid sequence. Wherein the nucleotide sequence of the ESD1 gene of the wild-type Longjing 31 is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO.3; the nucleotide sequence of the ESD1 gene mutant of the mutant ESD1 is shown as SEQ ID NO.2, and the coded amino acid sequence is shown as SEQ ID NO.4.

Example 2 analysis of phenotype and chlorophyll content of Rice plants

As shown in fig. 2a, b, mutant esd1 exhibited a yellow leaf margin and dead leaf tip phenotype from the beginning of the seedling stage, and the plant height was significantly lower than that of the wild type. The leaf profile of mutant esd1 is compared to the leaf profile of the wild type: the edge and tip of the esd1 yellow, the tip die and curl, and the blade becomes narrow.

Senescence of leaves generally resulted in a decrease in chlorophyll content, and the present invention measured the chlorophyll content relative values of leaf tissues of wild type and mutant esd1 using a hand-held portable MIN LIA SPAD-502 chlorophyll meter, and found that the measured average chlorophyll content relative average value of individual plants of 15 mutant esd1 was 32.29, whereas the measured chlorophyll content relative average value of wild type was 50.25, which was extremely remarkable (fig. 2C).

Example 3 scanning electron microscope observation

The ultra-microstructure of the leaf surface at the same part of the wild type and the mutant in the tillering stage is observed by utilizing a scanning electron microscope, and the specific steps are as follows:

(1) sampling and fixing: taking fresh leaves of wild type and mutant at the same position, cutting out 2mm long fragments by a knife avoiding the main pulse of the leaves, placing the fragments into 2.5% glutaraldehyde fixing solution, vacuumizing for about 20-30min to enable a sample to sink, then replacing the new 2.5% glutaraldehyde fixing solution, and placing the fragments in a refrigerator at 4 ℃ for storage overnight.

(2) Secondary fixation: the fixative was decanted and the samples were rinsed 3 times with phosphate buffer (0.1M, PH =7) for 15min each. After rinsing, a proper amount of 1% osmium acid is added to fix the sample for 1-2 hours. The waste solution of hunger acid is discarded, and the sample is eluted by the phosphate buffer solution for 3 times, 15 minutes each time.

(3) And (3) dehydration treatment: the sample was dehydrated, and each concentration was treated for 15 minutes in a concentration gradient of 30% →50% →70% →80% →90% →95% ethanol→absolute ethanol.

(4) And (3) critical point drying: drying in Hitachi HCP-2 type critical point dryer.

(5) And (3) film plating observation: the surface of the material is coated with a film, and the treated sample is observed in a Hitachi SU 8010 scanning electron microscope.

As shown in fig. 3, the surface of mutant esd1 appeared smoother than that of the wild type due to fewer needle-like protrusions. At the same time, the surface of the mutant esd1 leaf has a disturbed arrangement of siliceous projections, and the number of siliceous projections around the stomata is significantly smaller than that of the wild type. Early studies showed that a decrease in the number of siliceous projections on the leaf surface not only resulted in a shorter plant but also affected root growth, which in turn resulted in a decrease in seed setting rate, which may be responsible for the shorter plant height of the mutant esd1.

Example 4 Transmission Electron microscope viewing

The mesophyll cell structures of the wild type and mutant esd1 were observed by transmission electron microscopy as follows:

(1) fixing: taking leaf when the mutant is aged at tillering stage, taking leaf at corresponding part of wild type, cutting out fragment with size of about 1mm×2mm by using blade to avoid leaf vein, and fixing in 2.5% glutaraldehyde solution.

(2) Secondary fixation: leaves fixed with glutaraldehyde were rinsed 3 times with phosphate buffer (0.1M, PH =7) and then treated overnight with 1% osmium acid.

(3) Dehydrating: washing the secondarily fixed leaf blade with phosphate buffer solution for 3 times, dehydrating with ethanol with gradient concentration of 50%, 70% and 90%, each dehydrating for 15min, transferring the sample into acetone-ethanol mixed solution with equal proportion for 15min after dehydration, treating with 90% acetone for 20min, and finally dehydrating with 100% acetone for 15min for 3 times.

(4) Embedding: treating the sample in the step (3) with a mixed solution of acetone and resin in a ratio of 2:1 for 3-4h, then treating the sample with a mixed solution of acetone and resin in a ratio of 1:2 overnight, finally embedding the sample with resin for 2-3h, and then sequentially drying the sample with a gradient temperature of 37 ℃, 45 ℃ and 60 ℃.

(5) Slicing: the samples were sliced using an ultra-thin microtome to a slice thickness of 80nm.

(6) Dyeing: the cut samples were stained with 3% uranyl acetate-lead citrate for 15min.

(7) Photographing: the stained leaves were photographed by observation under a Hitachi H-7650 transmission electron microscope.

Leaves are the main sites for plants to photosynthesis, and photosynthetic pigments are the necessities of plants to photosynthesis. Chlorophyll content in leaves directly affects the efficiency of photosynthesis in plants. However, premature aging of leaves is often accompanied by degradation of chlorophyll and changes in cellular structure. Mutation of rice ESD1 gene also resulted in a change in chloroplast structure in the mutant ESD1 leaf. As shown in FIG. 4, mutant esd1 is enriched with a large number of osmium-philic particles and starch particles, and the lamellar structure arrangement of the base particles is loosely disturbed, which ultimately leads to chloroplast dysplasia of mutant esd1.

Example 5 histochemical analysis

1.H ₂ O ₂ The accumulation detection comprises the following specific steps:

(1) preparing DAB staining solution: 20mg of DAB powder was weighed, 38ml of distilled water was added thereto, and the pH was adjusted to about 3.8 with 0.2M HCl so that DAB was dissolved to prepare a solution having a final concentration of 0.5 mg/ml. Stored in dark at 4 ℃ and is ready for use.

(2) Dyeing: immersing leaves of the same parts of the wild type and the mutant in DAB dye solution, vacuumizing for 15-30min, and incubating overnight at room temperature.

(3) Decoloring: pouring out the dye liquor, transferring the leaves into a tube containing 95% ethanol, and boiling in water bath at 80 ℃ until the leaves are completely decolorized.

(4) Photographing: pour out 95% ethanol and take a photograph.

2. The oxygen free radical content is detected by the following steps:

(1) preparing NBT staining solution: 50mg of NBT powder was weighed out, and in a 50ml centrifuge tube, 0.5ml of 1M sodium azide solution and 0.5ml of 1M phosphate buffer (pH 7.8) were added, and distilled water was added to a volume of 50ml. To prepare a solution with a final concentration of 1 mg/ml. And storing in dark at 4 ℃.

(2) Dyeing: immersing leaves of the same parts of the wild type and the mutant in NBT dye liquor, vacuumizing for 15-30min, and incubating overnight at room temperature.

(4) Photographing: pour out 95% ethanol and take a photograph.

Tunel treatment

Leaves of the same parts of the wild type and the mutant in the same period were placed in a centrifuge tube containing 2ml of FAA fixative. Vacuum was applied to the sample pellet, and the sample was then tested according to TUNEL (TdT-mediated dUTP Nick-End Label-ing) apoptosis test kit.

4. Test results

Active oxygen is closely related to senescence in plants, and excessive accumulation thereof directly kills cells. To further explore the cause of premature senescence of mutant esd1, the inventors stained DAB and NBT on leaves at the same site at the same time, and as a result found that in fig. 5, there were indeed a large amount of brown and blue deposits in the leaves of the mutant, indicating that there was indeed a large amount of active oxygen accumulation in the mutant.

TUNEL treatment can stain fragmented genomic DNA green, and the detection results in fig. 6A-B show that in wild type leaf cells few cells were positive and signal weak, while in mutant ESD1, as shown in fig. 6C-D, TUNEL signal was enhanced and randomly distributed, indicating that ESD1 mutation would induce massive cell death. Thus, the mutation of the ESD1 gene can be obtained, so that the mutant ESD1 accumulates excessive active oxygen, and the cell death is caused on a large scale. Premature senility of leaves seriously affects the yield and quality of rice. The rice aging can be delayed by researching the rice premature senility mechanism, so that the quality and the yield of the rice can be improved, and a foundation is provided for cultivating the good rice variety.

Example 6 complementary verification

Constructing a functional complementary vector of the rice ESD1 mutant, amplifying the whole genome DNA of the ESD1 including the promoter by using a primer pair consisting of primers ESD1-F (AAATCATCCTTGGACCCACTT) and ESD1-R (GCATGGGCCTATGAGAGAAT), and connecting the fragment with pCAMBIA1300 by using a homologous recombination kit to obtain the complementary vector. And (3) introducing the complementary vector into an esd1 mutant by using agrobacterium-mediated transformation, and obtaining a positive transgenic complementary plant through sequencing comparison, thereby finally obtaining a transgenic plant consistent with the wild type 'Longjing 31' phenotype. As shown in FIG. 2, the ESD1-C is not significantly different from the wild type in leaf type, plant height and the like, thus proving that the ESD1 has the functions of promoting aging and affecting rice plant type.

Finally, it should also be noted that the above list is merely a few specific embodiments of the present invention. Obviously, the invention is not limited to the above embodiments, but many variations are possible. All modifications directly derived or suggested to one skilled in the art from the present disclosure should be considered as being within the scope of the present invention.

Sequence listing

<110> Zhejiang university of teachers and students

<120> Rice premature senility dwarf gene ESD1 and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4005

<212> DNA

<213> Oryza sativa L. (Rice)

<400> 1

atgccgctgg tgaggttcga ggtgcggaat gaggtggggc ttggggaccc cgacctgtac 60

ggcggcggcg gcggtggagg aggaggagga ggaggaggag gagttggggc tgctgcgaag 120

aagggcgggg aggcggagcc caaggcgctg ctcgagggcg tcgccgtcgc cggtctcgtc 180

gggatcctgc gccagctcgg agatctcgcg gaatttgcag cagatgtttt tcacgactta 240

catgagcaag ttataactac atctgctagg gggcgcaagg tgctgactcg agtacagaac 300

atcgaggcag cacttccatc tcttgaaaaa gctgtcaaga atcagaagag ccatatacat 360

ttcacttatg taccaggctc tgattggcat gcacaactta aagatgagca aaatcacctg 420

ctttctagtg atctacctcg atttatgatg gattcctatg aagaatgtcg agacccacca 480

cgactttacc ttcttgataa atttgataat gctggagctg gggcttgttc gaggagacat 540

tctgatccat catacttcaa gaaagcatgg gatatgatga gagcagacaa gacaggaaat 600

ttccaaagag aaaagaaatc tcagaaaatc aagagaaaag gatcacgctt gagagaaccg 660

tatcacggac aaactacacc caggcagagg aatggtgaat tgcagcgagc actcaccgct 720

gttcagctta ccagcaggca ctttgcgact cctagtactg atggccggag cctttcagag 780

aatagatcta catctgatgt aagatctaac cctgacaata taagcagatc ttcttcgttt 840

agttcgaaag cacgactgag tttcacagag caagttctag atacaaagcc aactgtagtt 900

cctcatgaaa atggccatga caagctgtca aataataatc tacacaagct tagcaatacc 960

cccttgcaca cacggcttaa cggtaccagt gcagatgacc tgggtgatga tttgaagcaa 1020

agttccctgc tagatgatat gactgctagg tcaccttctg ttaaatggga tgagaaggct 1080

gaaattacca tgtctacaac ttccgtctac tgtgatgatg ttgtcatgga caaggctgaa 1140

catgtacaat ctaaatgtat tagccctgag cagcaagaaa tcgaccatag ggagatggag 1200

actttggagc agcaagaggc attacatcaa aaggcaaaac agttattagt gtcatcaggc 1260

ttgaaccacc atgatgaagt ccccagtgaa acagacaact atgtggatgc acttaataca 1320

cttgaatctg agacagagac tgaacccgag cttcaaacta aaagtcgagt gaaaccagta 1380

ccttctctca atgttgatgt gcctcaggtg gagctgatag ataacattgt cacagagtct 1440

cctgattctt ctgttgctga attccctgat gcatatcaaa attcaagtat gcctcctgct 1500

cctgagagcg cagctgattt tcccagtttg tcaagtgcag atgctcctga catttcagag 1560

ccagtattat caggctatac agctaatcct catcctgaag tgtcagctat tgctactaat 1620

acccctgtga gcaatacaga ggatgctcca ggtcctttag agatttcaga gtcagcatca 1680

cgagcctata taattacact tcctaatcaa agtttacctg attccaaaga aattccagac 1740

agtaaggcag aagatgcacc catagattct cctgagaaat tggaaccagg accttcaagc 1800

tatacaccta caattcccat taaagagtcc tctattgtca gtcaaaatac taatgcagaa 1860

aatgtttccg gagactgtag tgaaggcact gcttgtgcta tatcctattc ccagcatatc 1920

atttctgata agccaactaa tgaggtatct gctactaata gctcacctga tgatacctct 1980

agcgatgaag atacagttga aagtggtggc attgttgaag tgtctaattc acagcccatg 2040

ccactgaatg actcattgga gaacggatgt gcaactcaag gcctcccagc aaatgcccct 2100

actaattcta ctggagtatc ttctgttaag ctctggacta atgctgggct ctttggactt 2160

gagccatcta aacctccagt attcggtgcc catgatggtc caaaggagga tactacacct 2220

ggacacacac aacctcagct ttgccattca actgggtgcc ccgaagttca tttttcaaag 2280

cccactgaat cagcacaagt atatgttcca aatggcaatt cgccaattac cagcagtttt 2340

gtggggaaac ttgttggtat ctgtcctggt tctacaagcc acagctcaga gactaatcaa 2400

tcaacagtaa gaacacctga tactgttatt ggtcaaacag aggggtccac aggttgttcc 2460

acatcttttg agcacagtga tcacaaaaat attattggta agcaaacttc aataagtgag 2520

ctcctagaat ctgaagacag tgctgaaaat ggtgctgaaa tgttctctaa aactgacatg 2580

actggaagga ataacatgaa tcaggtgtct gcatcaagct tttcaagcat tgcacaaaga 2640

tttcttgcta atacacttca gcgaagaact cccaaataca ctgatcttcc tatgtcatct 2700

gttatagtta acactgatgc aaacgggact gatgaatcta cccaaatatc ttctctagcc 2760

cccaatgaaa caacattcga ggcatctcaa tttgagaaga aaacagaaaa tgacacaaat 2820

ggactgccca aatcgtcact cttctctagt agccattact ctgagaaatc atctccgccg 2880

cttgagtaca tgaaaatatc tttccaccct atgagtgcat ttgaaatgtc aaaattggac 2940

ctagatttct ctgatgaaaa tcttcatgag aatgccgatg atatgatgtt accaacgttt 3000

cagttacttc cagggtcttc cgttccacag cttggtagtg gttctgaatc ggaagatgat 3060

acttttggca gatcttatag ttattcttcg tatgatgatc taagtccacg gttatattca 3120

aactctgagt tgtgggatca agaagacgca aatggattgg aggatcatga tatgcataac 3180

aatccaaatc agataggatc cttcggagca ccaatctcta gctttgtgga atttgagcag 3240

atggacttat ctggtgcgaa gtccactgta tcacttacag atcttgggga tgataatgga 3300

cttggcacgt tagattctca tcctgctgga gaacttccta acttcgatac tttgatggct 3360

catcaaaatg aggccttcat tccgcacaat ccagtaagtt tatcaccaga tgaaggtcag 3420

ttgcctccac ctcctcctct tcccccaatg caatggagga caatgagaca agtagcttct 3480

gtagaagaag gaagaggttc tgcagctaaa gaagatatgc ttgagagtac ctcagatcta 3540

ccaccagtac acactcctgt tcaggaagaa catcttctgc ccatcgcacc accagatcaa 3600

caaaatcttc tgcccatcgc accaccagat caacaagggc atgcgaagga gaatgacaga 3660

aaagttgatg gggtaaaaga gataagcaat cctctcgaca ttgagatcag agcaagcttg 3720

cttcagcaaa tcagggataa gtcaggtcag cagaagctga atggacatga aaagtcaaaa 3780

gcagtaggca atgatactaa aaacttggat gaaagggagg agttgcttca acaaatcagg 3840

agcaagacat tcaatttaag acgaacaaat gcatctaaga caaacacctc atcaccaacc 3900

actgccaact ccagcgttgt agcaatcttg gaaaaggcaa atgcaatccg ccaggctgtg 3960

gccagtgatg agggaggtga tgatgatagt tggagtgata tatga 4005

<210> 2

<211> 4005

<212> DNA

<213> Oryza sativa L. (Rice)

<400> 2

atgccgctgg tgaggttcga ggtgcggaat gaggtggggc ttggggaccc cgacctgtac 60

ggcggcggcg gcggtggagg aggaggagga ggaggaggag gagttggggc tgctgcgaag 120

aagggcgggg aggcggagcc caaggcgctg ctcgagggcg tcgccgtcgc cggtctcgtc 180

gggatcctgc gccagctcgg agatctcgcg gaatttgcag cagatgtttt tcacgactta 240

catgagcaag ttataactac atctgctagg gggcgcaagg tgctgactcg agtacagaac 300

atcgaggcag cacttccatc tcttgaaaaa gctgtcaaga attagaagag ccatatacat 360

ttcacttatg taccaggctc tgattggcat gcacaactta aagatgagca aaatcacctg 420

ctttctagtg atctacctcg atttatgatg gattcctatg aagaatgtcg agacccacca 480

cgactttacc ttcttgataa atttgataat gctggagctg gggcttgttc gaggagacat 540

tctgatccat catacttcaa gaaagcatgg gatatgatga gagcagacaa gacaggaaat 600

ttccaaagag aaaagaaatc tcagaaaatc aagagaaaag gatcacgctt gagagaaccg 660

tatcacggac aaactacacc caggcagagg aatggtgaat tgcagcgagc actcaccgct 720

gttcagctta ccagcaggca ctttgcgact cctagtactg atggccggag cctttcagag 780

aatagatcta catctgatgt aagatctaac cctgacaata taagcagatc ttcttcgttt 840

agttcgaaag cacgactgag tttcacagag caagttctag atacaaagcc aactgtagtt 900

cctcatgaaa atggccatga caagctgtca aataataatc tacacaagct tagcaatacc 960

cccttgcaca cacggcttaa cggtaccagt gcagatgacc tgggtgatga tttgaagcaa 1020

agttccctgc tagatgatat gactgctagg tcaccttctg ttaaatggga tgagaaggct 1080

gaaattacca tgtctacaac ttccgtctac tgtgatgatg ttgtcatgga caaggctgaa 1140

catgtacaat ctaaatgtat tagccctgag cagcaagaaa tcgaccatag ggagatggag 1200

actttggagc agcaagaggc attacatcaa aaggcaaaac agttattagt gtcatcaggc 1260

ttgaaccacc atgatgaagt ccccagtgaa acagacaact atgtggatgc acttaataca 1320

cttgaatctg agacagagac tgaacccgag cttcaaacta aaagtcgagt gaaaccagta 1380

ccttctctca atgttgatgt gcctcaggtg gagctgatag ataacattgt cacagagtct 1440

cctgattctt ctgttgctga attccctgat gcatatcaaa attcaagtat gcctcctgct 1500

cctgagagcg cagctgattt tcccagtttg tcaagtgcag atgctcctga catttcagag 1560

ccagtattat caggctatac agctaatcct catcctgaag tgtcagctat tgctactaat 1620

acccctgtga gcaatacaga ggatgctcca ggtcctttag agatttcaga gtcagcatca 1680

cgagcctata taattacact tcctaatcaa agtttacctg attccaaaga aattccagac 1740

agtaaggcag aagatgcacc catagattct cctgagaaat tggaaccagg accttcaagc 1800

tatacaccta caattcccat taaagagtcc tctattgtca gtcaaaatac taatgcagaa 1860

aatgtttccg gagactgtag tgaaggcact gcttgtgcta tatcctattc ccagcatatc 1920

atttctgata agccaactaa tgaggtatct gctactaata gctcacctga tgatacctct 1980

agcgatgaag atacagttga aagtggtggc attgttgaag tgtctaattc acagcccatg 2040

ccactgaatg actcattgga gaacggatgt gcaactcaag gcctcccagc aaatgcccct 2100

actaattcta ctggagtatc ttctgttaag ctctggacta atgctgggct ctttggactt 2160

gagccatcta aacctccagt attcggtgcc catgatggtc caaaggagga tactacacct 2220

ggacacacac aacctcagct ttgccattca actgggtgcc ccgaagttca tttttcaaag 2280

cccactgaat cagcacaagt atatgttcca aatggcaatt cgccaattac cagcagtttt 2340

gtggggaaac ttgttggtat ctgtcctggt tctacaagcc acagctcaga gactaatcaa 2400

tcaacagtaa gaacacctga tactgttatt ggtcaaacag aggggtccac aggttgttcc 2460

acatcttttg agcacagtga tcacaaaaat attattggta agcaaacttc aataagtgag 2520

ctcctagaat ctgaagacag tgctgaaaat ggtgctgaaa tgttctctaa aactgacatg 2580

actggaagga ataacatgaa tcaggtgtct gcatcaagct tttcaagcat tgcacaaaga 2640

tttcttgcta atacacttca gcgaagaact cccaaataca ctgatcttcc tatgtcatct 2700

gttatagtta acactgatgc aaacgggact gatgaatcta cccaaatatc ttctctagcc 2760

cccaatgaaa caacattcga ggcatctcaa tttgagaaga aaacagaaaa tgacacaaat 2820

ggactgccca aatcgtcact cttctctagt agccattact ctgagaaatc atctccgccg 2880

cttgagtaca tgaaaatatc tttccaccct atgagtgcat ttgaaatgtc aaaattggac 2940

ctagatttct ctgatgaaaa tcttcatgag aatgccgatg atatgatgtt accaacgttt 3000

cagttacttc cagggtcttc cgttccacag cttggtagtg gttctgaatc ggaagatgat 3060

acttttggca gatcttatag ttattcttcg tatgatgatc taagtccacg gttatattca 3120

aactctgagt tgtgggatca agaagacgca aatggattgg aggatcatga tatgcataac 3180

aatccaaatc agataggatc cttcggagca ccaatctcta gctttgtgga atttgagcag 3240

atggacttat ctggtgcgaa gtccactgta tcacttacag atcttgggga tgataatgga 3300

cttggcacgt tagattctca tcctgctgga gaacttccta acttcgatac tttgatggct 3360

catcaaaatg aggccttcat tccgcacaat ccagtaagtt tatcaccaga tgaaggtcag 3420

ttgcctccac ctcctcctct tcccccaatg caatggagga caatgagaca agtagcttct 3480

gtagaagaag gaagaggttc tgcagctaaa gaagatatgc ttgagagtac ctcagatcta 3540

ccaccagtac acactcctgt tcaggaagaa catcttctgc ccatcgcacc accagatcaa 3600

caaaatcttc tgcccatcgc accaccagat caacaagggc atgcgaagga gaatgacaga 3660

aaagttgatg gggtaaaaga gataagcaat cctctcgaca ttgagatcag agcaagcttg 3720

cttcagcaaa tcagggataa gtcaggtcag cagaagctga atggacatga aaagtcaaaa 3780

gcagtaggca atgatactaa aaacttggat gaaagggagg agttgcttca acaaatcagg 3840

agcaagacat tcaatttaag acgaacaaat gcatctaaga caaacacctc atcaccaacc 3900

actgccaact ccagcgttgt agcaatcttg gaaaaggcaa atgcaatccg ccaggctgtg 3960

gccagtgatg agggaggtga tgatgatagt tggagtgata tatga 4005

<210> 3

<211> 1334

<212> PRT

<213> Oryza sativa L. (Rice)

<400> 3

Met Pro Leu Val Arg Phe Glu Val Arg Asn Glu Val Gly Leu Gly Asp

1 5 10 15

Pro Asp Leu Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly

20 25 30

Gly Gly Val Gly Ala Ala Ala Lys Lys Gly Gly Glu Ala Glu Pro Lys

35 40 45

Ala Leu Leu Glu Gly Val Ala Val Ala Gly Leu Val Gly Ile Leu Arg

50 55 60

Gln Leu Gly Asp Leu Ala Glu Phe Ala Ala Asp Val Phe His Asp Leu

65 70 75 80

His Glu Gln Val Ile Thr Thr Ser Ala Arg Gly Arg Lys Val Leu Thr

85 90 95

Arg Val Gln Asn Ile Glu Ala Ala Leu Pro Ser Leu Glu Lys Ala Val

100 105 110

Lys Asn Gln Lys Ser His Ile His Phe Thr Tyr Val Pro Gly Ser Asp

115 120 125

Trp His Ala Gln Leu Lys Asp Glu Gln Asn His Leu Leu Ser Ser Asp

130 135 140

Leu Pro Arg Phe Met Met Asp Ser Tyr Glu Glu Cys Arg Asp Pro Pro

145 150 155 160

Arg Leu Tyr Leu Leu Asp Lys Phe Asp Asn Ala Gly Ala Gly Ala Cys

165 170 175

Ser Arg Arg His Ser Asp Pro Ser Tyr Phe Lys Lys Ala Trp Asp Met

180 185 190

Met Arg Ala Asp Lys Thr Gly Asn Phe Gln Arg Glu Lys Lys Ser Gln

195 200 205

Lys Ile Lys Arg Lys Gly Ser Arg Leu Arg Glu Pro Tyr His Gly Gln

210 215 220

Thr Thr Pro Arg Gln Arg Asn Gly Glu Leu Gln Arg Ala Leu Thr Ala

225 230 235 240

Val Gln Leu Thr Ser Arg His Phe Ala Thr Pro Ser Thr Asp Gly Arg

245 250 255

Ser Leu Ser Glu Asn Arg Ser Thr Ser Asp Val Arg Ser Asn Pro Asp

260 265 270

Asn Ile Ser Arg Ser Ser Ser Phe Ser Ser Lys Ala Arg Leu Ser Phe

275 280 285

Thr Glu Gln Val Leu Asp Thr Lys Pro Thr Val Val Pro His Glu Asn

290 295 300

Gly His Asp Lys Leu Ser Asn Asn Asn Leu His Lys Leu Ser Asn Thr

305 310 315 320

Pro Leu His Thr Arg Leu Asn Gly Thr Ser Ala Asp Asp Leu Gly Asp

325 330 335

Asp Leu Lys Gln Ser Ser Leu Leu Asp Asp Met Thr Ala Arg Ser Pro

340 345 350

Ser Val Lys Trp Asp Glu Lys Ala Glu Ile Thr Met Ser Thr Thr Ser

355 360 365

Val Tyr Cys Asp Asp Val Val Met Asp Lys Ala Glu His Val Gln Ser

370 375 380

Lys Cys Ile Ser Pro Glu Gln Gln Glu Ile Asp His Arg Glu Met Glu

385 390 395 400

Thr Leu Glu Gln Gln Glu Ala Leu His Gln Lys Ala Lys Gln Leu Leu

405 410 415

Val Ser Ser Gly Leu Asn His His Asp Glu Val Pro Ser Glu Thr Asp

420 425 430

Asn Tyr Val Asp Ala Leu Asn Thr Leu Glu Ser Glu Thr Glu Thr Glu

435 440 445

Pro Glu Leu Gln Thr Lys Ser Arg Val Lys Pro Val Pro Ser Leu Asn

450 455 460

Val Asp Val Pro Gln Val Glu Leu Ile Asp Asn Ile Val Thr Glu Ser

465 470 475 480

Pro Asp Ser Ser Val Ala Glu Phe Pro Asp Ala Tyr Gln Asn Ser Ser

485 490 495

Met Pro Pro Ala Pro Glu Ser Ala Ala Asp Phe Pro Ser Leu Ser Ser

500 505 510

Ala Asp Ala Pro Asp Ile Ser Glu Pro Val Leu Ser Gly Tyr Thr Ala

515 520 525

Asn Pro His Pro Glu Val Ser Ala Ile Ala Thr Asn Thr Pro Val Ser

530 535 540

Asn Thr Glu Asp Ala Pro Gly Pro Leu Glu Ile Ser Glu Ser Ala Ser

545 550 555 560

Arg Ala Tyr Ile Ile Thr Leu Pro Asn Gln Ser Leu Pro Asp Ser Lys

565 570 575

Glu Ile Pro Asp Ser Lys Ala Glu Asp Ala Pro Ile Asp Ser Pro Glu

580 585 590

Lys Leu Glu Pro Gly Pro Ser Ser Tyr Thr Pro Thr Ile Pro Ile Lys

595 600 605

Glu Ser Ser Ile Val Ser Gln Asn Thr Asn Ala Glu Asn Val Ser Gly

610 615 620

Asp Cys Ser Glu Gly Thr Ala Cys Ala Ile Ser Tyr Ser Gln His Ile

625 630 635 640

Ile Ser Asp Lys Pro Thr Asn Glu Val Ser Ala Thr Asn Ser Ser Pro

645 650 655

Asp Asp Thr Ser Ser Asp Glu Asp Thr Val Glu Ser Gly Gly Ile Val

660 665 670

Glu Val Ser Asn Ser Gln Pro Met Pro Leu Asn Asp Ser Leu Glu Asn

675 680 685

Gly Cys Ala Thr Gln Gly Leu Pro Ala Asn Ala Pro Thr Asn Ser Thr

690 695 700

Gly Val Ser Ser Val Lys Leu Trp Thr Asn Ala Gly Leu Phe Gly Leu

705 710 715 720

Glu Pro Ser Lys Pro Pro Val Phe Gly Ala His Asp Gly Pro Lys Glu

725 730 735

Asp Thr Thr Pro Gly His Thr Gln Pro Gln Leu Cys His Ser Thr Gly

740 745 750

Cys Pro Glu Val His Phe Ser Lys Pro Thr Glu Ser Ala Gln Val Tyr

755 760 765

Val Pro Asn Gly Asn Ser Pro Ile Thr Ser Ser Phe Val Gly Lys Leu

770 775 780

Val Gly Ile Cys Pro Gly Ser Thr Ser His Ser Ser Glu Thr Asn Gln

785 790 795 800

Ser Thr Val Arg Thr Pro Asp Thr Val Ile Gly Gln Thr Glu Gly Ser

805 810 815

Thr Gly Cys Ser Thr Ser Phe Glu His Ser Asp His Lys Asn Ile Ile

820 825 830

Gly Lys Gln Thr Ser Ile Ser Glu Leu Leu Glu Ser Glu Asp Ser Ala

835 840 845

Glu Asn Gly Ala Glu Met Phe Ser Lys Thr Asp Met Thr Gly Arg Asn

850 855 860

Asn Met Asn Gln Val Ser Ala Ser Ser Phe Ser Ser Ile Ala Gln Arg

865 870 875 880

Phe Leu Ala Asn Thr Leu Gln Arg Arg Thr Pro Lys Tyr Thr Asp Leu

885 890 895

Pro Met Ser Ser Val Ile Val Asn Thr Asp Ala Asn Gly Thr Asp Glu

900 905 910

Ser Thr Gln Ile Ser Ser Leu Ala Pro Asn Glu Thr Thr Phe Glu Ala

915 920 925

Ser Gln Phe Glu Lys Lys Thr Glu Asn Asp Thr Asn Gly Leu Pro Lys

930 935 940

Ser Ser Leu Phe Ser Ser Ser His Tyr Ser Glu Lys Ser Ser Pro Pro

945 950 955 960

Leu Glu Tyr Met Lys Ile Ser Phe His Pro Met Ser Ala Phe Glu Met

965 970 975

Ser Lys Leu Asp Leu Asp Phe Ser Asp Glu Asn Leu His Glu Asn Ala

980 985 990

Asp Asp Met Met Leu Pro Thr Phe Gln Leu Leu Pro Gly Ser Ser Val

995 1000 1005

Pro Gln Leu Gly Ser Gly Ser Glu Ser Glu Asp Asp Thr Phe Gly Arg

1010 1015 1020

Ser Tyr Ser Tyr Ser Ser Tyr Asp Asp Leu Ser Pro Arg Leu Tyr Ser

1025 1030 1035 1040

Asn Ser Glu Leu Trp Asp Gln Glu Asp Ala Asn Gly Leu Glu Asp His

1045 1050 1055

Asp Met His Asn Asn Pro Asn Gln Ile Gly Ser Phe Gly Ala Pro Ile

1060 1065 1070

Ser Ser Phe Val Glu Phe Glu Gln Met Asp Leu Ser Gly Ala Lys Ser

1075 1080 1085

Thr Val Ser Leu Thr Asp Leu Gly Asp Asp Asn Gly Leu Gly Thr Leu

1090 1095 1100

Asp Ser His Pro Ala Gly Glu Leu Pro Asn Phe Asp Thr Leu Met Ala

1105 1110 1115 1120

His Gln Asn Glu Ala Phe Ile Pro His Asn Pro Val Ser Leu Ser Pro

1125 1130 1135

Asp Glu Gly Gln Leu Pro Pro Pro Pro Pro Leu Pro Pro Met Gln Trp

1140 1145 1150

Arg Thr Met Arg Gln Val Ala Ser Val Glu Glu Gly Arg Gly Ser Ala

1155 1160 1165

Ala Lys Glu Asp Met Leu Glu Ser Thr Ser Asp Leu Pro Pro Val His

1170 1175 1180

Thr Pro Val Gln Glu Glu His Leu Leu Pro Ile Ala Pro Pro Asp Gln

1185 1190 1195 1200

Gln Asn Leu Leu Pro Ile Ala Pro Pro Asp Gln Gln Gly His Ala Lys

1205 1210 1215

Glu Asn Asp Arg Lys Val Asp Gly Val Lys Glu Ile Ser Asn Pro Leu

1220 1225 1230

Asp Ile Glu Ile Arg Ala Ser Leu Leu Gln Gln Ile Arg Asp Lys Ser

1235 1240 1245

Gly Gln Gln Lys Leu Asn Gly His Glu Lys Ser Lys Ala Val Gly Asn

1250 1255 1260

Asp Thr Lys Asn Leu Asp Glu Arg Glu Glu Leu Leu Gln Gln Ile Arg

1265 1270 1275 1280

Ser Lys Thr Phe Asn Leu Arg Arg Thr Asn Ala Ser Lys Thr Asn Thr

1285 1290 1295

Ser Ser Pro Thr Thr Ala Asn Ser Ser Val Val Ala Ile Leu Glu Lys

1300 1305 1310

Ala Asn Ala Ile Arg Gln Ala Val Ala Ser Asp Glu Gly Gly Asp Asp

1315 1320 1325

Asp Ser Trp Ser Asp Ile

1330

<210> 4

<211> 114

<212> PRT

<213> Oryza sativa L. (Rice)

<400> 4

Met Pro Leu Val Arg Phe Glu Val Arg Asn Glu Val Gly Leu Gly Asp

1 5 10 15

Pro Asp Leu Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly

20 25 30

Gly Gly Val Gly Ala Ala Ala Lys Lys Gly Gly Glu Ala Glu Pro Lys

35 40 45

Ala Leu Leu Glu Gly Val Ala Val Ala Gly Leu Val Gly Ile Leu Arg

50 55 60

Gln Leu Gly Asp Leu Ala Glu Phe Ala Ala Asp Val Phe His Asp Leu

65 70 75 80

His Glu Gln Val Ile Thr Thr Ser Ala Arg Gly Arg Lys Val Leu Thr

85 90 95

Arg Val Gln Asn Ile Glu Ala Ala Leu Pro Ser Leu Glu Lys Ala Val

100 105 110

Lys Asn

Claims

1. MutantESD1A gene characterized in that: mutantESD1The nucleotide sequence of the gene is shown as SEQ ID NO. 2; it can promote rice aging and plant height dwarf.

2. The mutant of claim 1ESD1A protein encoded by a gene, characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO.4.

3. The mutant of claim 1ESD1The application of the gene is characterized in that: the gene causes abnormal development of chloroplasts in rice tissues, the chlorophyll content is reduced, and the cell peroxidation and death are aggravated; the external appearance is that the leaf margin is yellow and the leaf tip is dead, and the plant height is obviously dwarfed.