CN113699158B

CN113699158B - Nucleic acid aptamer of aristolochic acid A as well as screening method and application thereof

Info

Publication number: CN113699158B
Application number: CN202111025947.4A
Authority: CN
Inventors: 余伯阳; 刘秀峰; 陈美琪; 田蒋为; 李纪伟
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2021-09-02
Filing date: 2021-09-02
Publication date: 2023-08-01
Anticipated expiration: 2041-09-02
Also published as: CN113699158A

Abstract

The invention discloses a nucleic acid aptamer capable of specifically recognizing aristolochic acid A and application thereof for the first time, and belongs to the field of bioengineering. The invention takes aristolochic acid A as a target, screens out the aptamer with specific recognition capability to aristolochic acid A by using a cPature-SELEX technology, selects the aptamer with highest occurrence frequency in a high-throughput sequencing result, and further improves the performance of the nucleic acid aptamer by shortening and constructing a stable secondary structure. The nucleic acid aptamer has the characteristics of easy synthesis, easy modification, good stability and the like, and can be used for the construction of a rapid detection method of traditional Chinese medicines of Aristolochiaceae, traditional Chinese medicines possibly containing Aristolochia acid A and products thereof.

Description

Nucleic acid aptamer of aristolochic acid A as well as screening method and application thereof

Technical Field

The invention belongs to the technical field of screening and application of nucleic acid aptamer, and in particular relates to a nucleic acid aptamer of aristolochic acid A and a screening method thereof.

Background

Aristolochic acid (AristoLochic acids, AAs for short), also known as total aristolochic acid, akenin, is a nitrophenanthrenecarboxylic acid with potent carcinogenicity and nephrotoxicity, wherein aristolochic acid a is the most naturally occurring, highest in content, and most at risk of nephrotoxicity and carcinogenesis mutation. At present, different countries take different measures to cope with the toxicity problem of aristolochic acid, such as most countries and regions prohibit the use of products containing AAs, but the renal injury of aristolochic acid occurs at any irregular time all over the world, and meanwhile, some aristolochidae traditional Chinese medicinal materials and preparations with relatively low aristolochic acid content are not forbidden, so that the content measurement and strict quality control standard of the traditional Chinese medicinal materials and preparations containing or possibly containing AAs are particularly important for guiding clinical reasonable medication.

The SELEX technology (exponential enrichment ligand system evolution technology) is a novel in-vitro screening technology, and the obtained aptamer is mainly a single-stranded oligonucleotide sequence of short DNA or RNA, can form a specific space conformation of a secondary structure such as hairpin, stem loop, pseudoknot and the like matched with a target molecule, and has strong specificity and affinity; the target molecule range screened by the technology is wide, and can relate to metal ions, peptides, toxins and other small molecules, enzymes, proteins, antibodies and other macromolecular substances, complete viruses, bacteria, living cells, pathological tissue sections and the like. Compared with antibodies, the aptamer has the advantages of small molecule, short screening period, capability of in vitro chemical synthesis and repeated use, easiness in marking and modification, high stability and low immunogenicity, long-term storage and room-temperature transportation. The main steps of SELEX screening include library or target immobilization, target elution, non-binding library isolation, binding aptamer amplification, and single strand preparation. The targets are usually immobilized on solids such as magnetic microspheres, agarose beads, graphene oxide, etc., but there is not enough functional group for the small molecules to be immobilized on the solid surface, and immobilization of the small molecule targets to the functional groups of the small molecules that would be occupied by the magnetic bead surface reduces the screening efficiency, capture-SELEX is an alternative method by immobilizing the oligonucleotide library on a solid substrate instead of immobilizing the targets. Capture-SELEX has been successful in selecting small molecule targets such as cadmium, penicillin, quinolones, lipopolysaccharides, and the like.

The invention uses SELEX technology to screen and obtain the aptamer of aristolochic acid A for the first time, which has important meaning for detecting trace AAs.

Disclosure of Invention

The invention aims to solve the screening problem of difficulty in fixing small molecules by fixing an oligonucleotide library on a solid matrix instead of a target object by using a capture-SELEX technology, provides an aristolochic acid A nucleic acid aptamer with high specificity and affinity, correspondingly provides a screening method and application of the aptamer, further improves the performance of the nucleic acid aptamer by shortening and constructing a stable secondary structure, and establishes a foundation for the subsequent detection of Chinese medicines belonging to the family aristolochiaceae, chinese medicines possibly containing aristolochic acid A and products thereof.

The technical scheme adopted by the invention is as follows:

a nucleic acid aptamer of aristolochic acid A, which is characterized in that the aptamer sequence is shown in SEQ1 or truncated sequences shown in SEQ2 and SEQ 3.

The nucleic acid aptamer is characterized in that the nucleic acid aptamer can be connected with a fluorescent marker, biotin, a nano material or a radioactive substance.

The nucleic acid aptamer is characterized in that a product obtained by modifying the structure of the nucleic acid aptamer by shortening or extending or partially replacing a base is modified by connecting a fluorescent marker, biotin, a nano material and a radioactive substance.

The nucleic acid aptamer is applied to detection of medicines, foods, agricultural products and other products containing aristolochic acid A.

A method for detecting aristolochic acid A in traditional Chinese medicine is characterized in that two unlabeled single-stranded DNAs (cDNA-G and r-cDNA-G) are designed and comprise sequences formed by G-quadruplex, and the 3' -end part base of the cDNA-G is complementarily paired with an aristolochic acid A aptamer.

The screening method of the aristolochic acid A nucleic acid aptamer comprises the following steps:

s1, library fixation: fixing the ssDNA library on the surface of a streptavidin agarose microsphere, and washing to obtain a washing liquid;

s2, target screening and separation: adding aristolochic acid A into agarose microsphere compound, passing through column, eluting to obtain eluent; performing polyacrylamide gel electrophoresis;

s3, library amplification: performing PCR amplification and recovering ssDNA aptamer;

s4, sequencing: high throughput sequencing of the enriched library;

s5, verifying: and (3) carrying out secondary structure prediction on the sequenced sequence, detecting the affinity and specificity of the aptamer to aristolochic acid A, and screening out the nucleic acid aptamer with high affinity and strong specificity.

Further, in the aristolochic acid A aptamer screening method, 200 mu L of streptavidin agarose microspheres are taken in a micro-column in the step S1, and the environment of the balance column is washed with 1 Xbuffer binding buffer, and 250 mu L of the streptavidin agarose microspheres are taken each time.

Further, in the aristolochic acid A aptamer screening method, in step S1, 250. Mu.L of ssDNA library and capture cDNA are mixed with each other in a ratio of 1:5, carrying out hybridization annealing at the mass ratio of substances at 95 ℃ for 10min, naturally cooling to room temperature, and then mixing and washing with the washed and balanced streptavidin agarose microspheres for 5 times to obtain eluent; the microsphere columns were washed multiple times with buffer to remove unbound library.

Furthermore, in the aristolochic acid A aptamer screening method, the target small molecules are not modified in the step S2, the target small molecules interact with ssNDA to the greatest extent, and low-affinity aptamers are easy to separate and characterize.

In step S2, 750 μl of target solution with a certain concentration is prepared according to the screening conditions, and each time 250 μl of target solution is separated for 3 times and eluted by column, and the eluate is collected.

Furthermore, in step S2, the method for screening aristolochic acid A aptamer is carried out in round 11 and the conditions of the screening process can be adjusted to remove non-specific aptamers.

In step S2, the collected eluent after 3 times of target object addition is centrifugally concentrated through an ultrafiltration tube with 3 dissociation constants to carry out library amplification.

In step S2, a certain amount of annealed solution of ssDNA of the library is taken, the eluate after the library is combined with the microspheres is washed with buffer solution, the unbound eluate is washed with the eluate of the target, and polyacrylamide gel electrophoresis experiment is performed to monitor the enrichment of the library in the screening process. Preferentially, in the aristolochic acid A aptamer screening method, specific PCR conditions in the step S3 are as follows: mix 25. Mu.L, FP 5. Mu.L, RBP 5. Mu.L, aptamer 5. Mu.L, deionized water 10. Mu.L, reaction conditions of 95℃2min,95℃15S,58℃30S,72℃45S,11 cycles, 72℃5min.

Furthermore, in the aristolochic acid A aptamer screening method, a biotinylation reverse primer is added in the step S3 for PCR, and the product is uniformly mixed with a streptavidin agarose microsphere column, washed and subjected to alkaline denaturation to obtain ssDNA chains and separated.

Furthermore, in step S4, the aristolochic acid A aptamer screening method performs high throughput sequencing on the 10 th round and the 15 th round libraries.

Furthermore, in the aristolochic acid A aptamer screening method, in the step S5, MST micro-thermophoresis molecular interaction is adopted to detect the affinity and the specificity of the aptamer.

In another aspect of the invention, the nucleic acid aptamer of aristolochic acid A obtained by the screening method is shown in SEQ 1.

In another aspect of the present invention, as an improvement of the above technical scheme, the nucleic acid aptamer is structurally modified by shortening or extending or partially replacing bases, and optionally, a fluorescent substance, biotin, a nano luminescent material and a radioactive substance are attached to the nucleotide sequence of the nucleic acid aptamer.

The Aristolochia acid A aptamer was screened by immobilizing ssDNA library on the surface of agarose microspheres using the streptavidin-biotin method. Streptavidin-biotin is the highest known affinity conjugate with a dissociation constant of about 1015moL/L and an affinity that is at least 1 ten thousand times greater than the affinity of the antigen to the antibody. A biotin modified short oligonucleotide linker strand complementary to the base of the ssDNA library will affect folding of the ssDNA library, binding of the aptamer to the target in the presence of the target, and release of the aptamer from the oligonucleotide linker strand.

There is no clear definition of the number of aptamer screening rounds or counter-screen discussions for a target. The number of rounds is generally dependent on the target and the researcher wishes to achieve specificity and affinity criteria. The eluents of each theoretical screening were verified by polyacrylamide gel electrophoresis. In the target screening process, collecting a hybridization mixture of the ssDNA library and the captured cDNA, adding an eluent after agarose microsphere columns, finally cleaning a buffer solution of the microbeads, and adding the eluent after target objects; after the reverse screening is added, the eluent after the reverse screening is added is collected, the buffer solution of the final time of the microbeads is washed, and the gel electrophoresis chart is used for carrying out a strip, particularly comparing the difference between the final time of buffer washing and target elution, and the screening is stopped by referring to which round of ending. No counter-screening was added at rounds 1-10, and the elution band was significantly reduced from the target band at round 10, with library specificity up to 14.63%, indicating that the library had been enriched and the specificity was varied as shown in FIG. 2. And performing high-throughput sequencing on the 10 rounds of libraries; and (3) adding the 11 th round of the reverse screening process, calculating the library specificity from the 11 th round to the 15 th round according to gel electrophoresis results, wherein the target eluting band from the 11 th round is brighter than the reverse screening eluting band, the library specificity value reaches 24.83%, carrying out high-throughput sequencing on the 15 th round of the library, and detecting the affinity of the library according to a gel eluting affinity experiment, so that the affinity of the 15 th round is highest.

Detection principle: a method for detecting aristolochic acid A in a traditional Chinese medicine sample based on a chlorhexidine/G-quadruplex colorimetric analysis.

Two unlabeled DNA single strands were introduced:

cDNA-G:GTCGTAAGTTCTGCCTGGGG

r-cDNA-G:GGGTAGGGCGGGAGGCAGAACTT

one (cDNA-G) can be base paired with 15 bases at the 5' end of any one of the aptamers of SEQ1-3 to form a double strand (dsDNA), and the other (r-cDNA-G) is complementary to cDNA-G and is rich in G sequence. In the absence of aristolochic acid A, two cDNAs cannot hybridize to form a G-quadruplex, and the enzyme activity of hemin is reduced due to aggregation. And when aristolochic acid A is present, the aristolochic acid A is specifically combined with an aptamer, double chains are dissociated, cDNA-G is released and combined with r-cDNA-G to form a G-quadruplex structure and chlorhexidine, and the aristolochic acid A can catalyze hydrogen peroxide to oxidize 2, 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic Acid) (ABTS) to enable a solution to be dark green, and the maximum absorption wavelength is 420nm for colorimetric detection.

Advantageous effects

According to the invention, the Capture-SELEX technology is firstly used for screening out the nucleic acid aptamer of the small molecular substance aristolochic acid A, the aptamer affinity and specificity characterization is carried out through MST, and the performances such as the nucleic acid aptamer affinity, specificity and structural stability are further improved through a sequence shortening strategy. The library was immobilized by streptavidin-modified agarose microspheres and biotinylated short nucleotide strands complementary to the library. In the presence of aristolochic acid A, the aptamer with affinity is released from the short nucleotide chain hybridized chain, the eluent is collected by a micro-column and amplified to be used as a next-round screening library, polyacrylamide gel electrophoresis is used for monitoring the screening process, binding affinity determination is used for determining the terminated SELEX cycle, biotinylation reverse primer is used for PCR, the product is uniformly mixed with streptavidin agarose microsphere column, washing and alkali denaturation are carried out to obtain ssDNA as the next-round screening library. The screening method does not need special instruments and equipment, is simple and convenient to operate, and the ssDNA aptamer has the characteristics of easy synthesis, easy modification, stable structure and the like, and lays a foundation for the subsequent detection of traditional Chinese medicines belonging to the Aristolochiaceae family, traditional Chinese medicines possibly containing aristolochic acid A and products thereof.

Drawings

FIG. 1Capture-SELEX technical flow schematic

FIG. 2 round 1-15 library-specific curves

FIG. 3 schematic representation of the secondary structure of the aptamer SEQ1

FIG. 4 secondary structure schematic of aptamer SEQ2

FIG. 5 determination of dissociation constant curve of aptamer to aristolochic acid A using MST

FIG. 6 determination of dissociation constant curves of nucleic acid aptamers to aristolochic acid A, nuciferine, bile acid, berberine hydrochloride, dehydrocordierite using MST

FIG. 7 dye displacement assay for detection effect of aptamer on aristolochic acid A. (A) The absorption spectrum (B) of Cy7 in the presence of 0,0.4, 0.8, 1.6, 1.1, 3.1,6.3, 12.5, 25, 50, 100uM aristolochic acid A in the aptamer sensor was based on the measurement curve generated by absorbance ratio at 670/775nm at 0-100 uM aristolochic acid A, the inset representing a linear curve with target concentration ranging from 0 to 12.5 uM.

Detailed Description

The invention is further illustrated below in conjunction with specific examples, which are given by way of illustration only and are not to be construed as limiting the invention. The starting materials used in the examples were all commercially available from conventional sources unless otherwise specified.

Example 1 screening of nucleic acid aptamers

The ssDNA library is composed of a central 30 base random region flanked by 43 base primer binding regions 5 '-CGAGCATAGGCAGAACTTACGAC- (N30) -GTCGTAAGAGCGAGTCATTC-3', N representing A or G or C or T.

cDNA-bio(5’-Bio-TTTTTGTCGTAAGTTCTGCCATTTT-3’)

PCR primer sequence:

Primer FP(5’-CGAGCATAGGCAGAACTTAC-3’)

Primer RP-bio(5’-Bio-GAATGACTCGCTCTTACGAC-3’)

first round screening:

s1.SsDNA library immobilization

600mL of water in the beaker is heated to boiling, such as microwave heating, using 1000pmoL library, library to capture cDNA at 1:5 ratio, mixed in 5 Xbuffer (Tris-HCl 50mM,NaCL 100mM,MgCL) ₂ 2.5 mM) solution sterilization water was added to 250. Mu.L of 1 Xbuffer solution, the library was heated with boiling water, and the captured cDNA mixture was taken out and cooled to room temperature, and the library was hybridized with the captured cDNA. Adding 250 μl of streptavidin agarose microspheres into the microcolumn, standing, washing with 250 μl of 1 Xbuffer each time for 5 times until the solution is balanced, taking 2 μl of sample for gel electrophoresis before modifying the library and capture cNDA hybridization mixture into microspheres, repeatedly adding modification for 5 times to ensure maximum immobilization of ssDNA library onto microspheres, and collecting eluate. The unbound library molecules were removed by 1 Xbuffer wash, 5mL under automatic gravity, manual 250. Mu.L buffer wash 10 times.

S2, target screening and separating

Adding 1mM aristolochic acid A into agarose microsphere complex, 250 μl each time, and eluting with column for 3 times to obtain eluate; collecting a hybridization mixture of the ssDNA library and the captured cDNA, adding an eluent after agarose microsphere columns, finally cleaning a buffer solution of the microbeads, and adding the eluent after target objects; after the reverse screening is added, the eluent after the reverse screening is added is collected, the buffer solution of the final time of the microbeads is washed, and the change condition of the library in the screening process is monitored by the strip outline on the polyacrylamide gel electrophoresis chart. The comparison of the differences between the bands on the gel electrophoresis pattern, in particular the last buffer and the elution of the target, is used to refer to which round of end-stop screening. No counter-screen was added at rounds 1-10, and the elution bands were significantly reduced from the target bands at round 10, with library specificity up to 14.63%, indicating that the library had been enriched and the specificity was varied as shown in FIG. 2. And performing high-throughput sequencing on the 10 rounds of libraries; and (3) adding the reverse screening process for 11 rounds, calculating the library specificity from 11 th round to 15 th round according to gel electrophoresis results, wherein the target eluting band from the 11 th round is brighter than the reverse screening eluting band, the library specificity value reaches 24.83%, and carrying out high-throughput sequencing on the 15 th round of library as shown in figure 2.

The counter screening is introduced in the process, and the times and the concentration can be adjusted according to the band diagram of gel electrophoresis so as to remove the non-specific aptamer; most preferably, the reverse screening process is performed at round 11 to reduce library non-specificity.

S3, library amplification: PCR amplification, ssDNA aptamer recovery

The collected 3 eluates were concentrated to about 100. Mu.L by passing through a 3K ultrafiltration tube, and PCR was performed using the addition of biotinylated reverse primers under the following conditions: the initial denaturation is carried out at 95 ℃ for 2min, 11-15 cycles of cyclic denaturation are carried out at 95 ℃ for 15S, annealing is carried out at 58 ℃ for 30S, extension is carried out at 72 ℃ for 45S, and finally, 5min at 72 ℃ and storage at 12 ℃ are carried out. Mixing the product with streptavidin agarose microsphere column, washing, alkaline denaturing and separating to obtain ssDNA, concentrating to 100 μl with 3K ultrafiltration tube, and measuring library concentration with micro-spectrophotometer for next round of screening, and storing the rest at-20deg.C as backup.

TABLE 1 screening conditions for aristolochic acid aptamer

S4, monitoring gel elution affinity of nucleic acid aptamer

Screening was performed for 15 rounds, reverse screening was added to round 11, PCR amplification was performed on round 10 and round 15 aptamer libraries, and after ssDNA recovery of the library, its affinity with aristolochic acid a was determined by gel elution affinity experiments.

The gel elution affinity experiment comprises the following specific steps:

1. library hybridization 50pmoL ssDNA library was denatured and hybridized with 250pmoL captured cDNA to 125. Mu.L of 1 Xbuffer solution, at 95℃for 10min, and naturally cooled to room temperature.

2. Library fixation was performed at volume ratio 1:1 proportion and buffer solution are washed and balanced, and then the streptavidin agarose microsphere is incubated for 30min, after incubation, the mixture is rotated and incubated for 5min by using 625 mu L of 1 Xbuffer each time, the mixture is stood for 5min, the washing solution is discarded, the operation is repeated for 5 times, and finally 625 mu L of 1 Xbuffer is added to be evenly split-packed into 7 parts of ssDNA library and agarose microsphere conjugate.

3. Incubating target to prepare 7 concentration gradient mandril acid A solutions of 0, 10, 50, 100, 250, 500 and 1000 mu M, sequentially adding 50 mu L of each solution into 7 split-packed ssDNA library agarose microsphere conjugates, incubating for 1h, combining the aptamer with the target in the process, releasing the aptamer from the oligonucleotide connecting chain, standing for 15min after incubation, and sequentially taking 40 mu L of supernatant

4. Microsphere elution 50 mu L of 98% formide solution is added into a ssDNA library and agarose microsphere conjugate, the mixture is uniformly mixed, incubated for 10min at 90 ℃, the mixture is kept stand for 15min, the supernatant is taken to obtain an unreleased oligonucleotide chain on the microsphere, and the supernatant and the elution supernatant after incubation of the target are subjected to polyacrylamide gel electrophoresis to detect the contour of a strip.

S5, sequencing of library

Based on the above monitoring results, the 10 th round and the 15 th round were selected for high throughput sequencing.

S6, software prediction

The sequenced sequences are subjected to family classification, the first 20 sequence families are selected according to the frequency and the enrichment degree of the sequences, homology analysis and phylogenetic tree analysis are performed by using CLustaL software, the first dozens of sequences are screened according to the sequence frequency, NUPACK is used for secondary structure prediction, the structural stability is achieved, the number of rings in the secondary structure exists, and the following aptamers are selected for subsequent affinity and specificity determination. It is noted that after obtaining the entire sequence, the library contains flanking regions beyond the stem, which is not considered necessary for the aptamer sensor, SEQ1 is the entire sequence, SEQ2 (8 bases beside the reserved random region) is obtained outside the forward and reverse primer regions that are trimmed as the capture region, and SEQ3 is the aptamer used for detection based on the chlorhydrin/G-quadruplex colorimetric analysis for the specific number of reserved bases outside the random region in a form that requires structural conversion of the aptamer in the sensor.

Results:

SEQ1:CGAGCATAGGCAGAACTTACGGCGCTAGGGTTGTCACTGCTGGGTATCT TGTAGTCGTAAGAGCGAGTCATTC

SEQ2:CTTACGGCGCTAGGGTTGTCACTGCTGGGTATCTTGTAGTCGTAAG

SEQ3:AGGCAGAACTTACGGCGCTAGGGTTGTCACTGCTGGGTATCTTGTAG TCGTAAG

after the entire sequence is obtained, the library contains flanking regions beyond the stem, which is not considered necessary for a functional aptamer sensor, is trimmed outside the capture zone of the forward primer region, and trimmed outside the capture competition zone, with specific modifications of the inside and outside requiring conversion of the sensor format according to aptamer structure

Example 2 nucleic acid aptamer binding Capacity to aristolochic acid A and specificity analysis

To further verify the affinity and specificity of the nucleic acid aptamer to aristolochic acid a, the dissociation constant of the aptamer was detected using MST, and the 5' -end Cy 5-labeled aptamer sequences SEQ1, SEQ2 and SEQ3 were chemically synthesized and their dissociation constants to the target were determined using microphoresis. The measurement procedure was as follows:

s1, preparing a mother solution, namely preparing an aptamer mother solution with the concentration of 200nM by taking a 1 Xbuffer buffer solution (Tris-HCL 50mM,NaCL 100mM,MgCL22.5mM, 0.005% Tween-20,5% DMSO) as a solvent, and cooling in an ice water bath at the temperature of 95 ℃ for 10 min; respectively preparing target object solutions of aristolochic acid A, nuciferine, bile acid, berberine hydrochloride and dehydrocorydaline with mother liquor concentration of 100 mu M; 1 Xbuffer buffer.

S2, preparing gradient solution, preparing 16 gradient concentrations, respectively adding 10 mu L of 1 Xbuffer solution into the serial numbers 1-16 and 2-16, taking 20 mu L of target mother solution into the serial numbers 1, sucking 10 mu L of solution from the serial numbers 1 to 2, uniformly mixing, sucking 10 mu L of solution into the serial numbers 3, sequentially mixing the solution to 16, discarding 10 mu L, and ensuring that 10 mu L of gradient concentration target solution exists in each tube.

S3, mixing and incubating, wherein 10 mu L of aptamer mother liquor is respectively absorbed, sequentially adding the aptamer mother liquor into 1-16 tubes, and incubating for 5min.

S4, the capillary sample adding capillary is inserted into the sample tube, and the capillary sample adding capillary is sequentially arranged on the sample tray from high concentration to low concentration according to the serial number sequence of 1-16.

S5, measuring the fluorescence intensity by using a micro thermophoresis molecular interaction instrument under the conditions of 10% fluorescence excitation intensity and low power in capillary scanning.

S6, calculating: the dissociation constant value of the aptamer was calculated according to the HILL formula.

The results show that the nucleic acid aptamer SEQ1, SEQ2 and SEQ3 can specifically recognize aristolochic acid A. The dissociation constant of SEQ1 is 7.6. Mu.M, SEQ2, SEQ3 is on the nanomolar scale. As shown in FIG. 5, SEQ2 has strong binding ability with the mandril acid A and a dissociation constant of 293nM. As shown in fig. 6, SEQ2 can specifically bind to aristolochic acid a, and does not bind to aristolochic acid structural compounds such as nuciferine, bile acid, berberine hydrochloride, dehydrocorydaline, and the like.

Example 3 detection of the detection Effect of aptamer on aristolochic acid A by dye replacement

Diethyl thiotricarbocyanine (Cy 7) is a small molecule dye that exists in equilibrium between monomeric and dimeric forms with absorption peaks at 760 and 670nm, respectively. Studies indicate that Cy7 monomers can bind to the hydrophobic target binding domain of the aptamer, which results in a strong increase in absorbance at 760 nm. However, binding of the target to the aptamer can displace Cy7 monomers from the binding domain, which results in dimerization of the dye in aqueous solution, resulting in a decrease in absorbance at 760nm and an increase in absorbance at 670 nm. Thus, this method can be used as a colorimetric indicator for small molecule detection.

First, 70. Mu.L of a mixture of SEQ2 aptamers (final total aptamer concentration=15. Mu.M) was mixed with 2. Mu.L of Cy7 (final concentration 2. Mu.M) in reaction buffer (final concentration 10mM Tris-HCl,0.5mM magnesium chloride, 20mM sodium chloride, 0.01% Tween 20,5% dimethyl sulfoxide, pH 7.4) and incubated at 37℃for 30min to form Cy7 aptamer complexes.

To the Cy 7-aptamer complex mixed solution was added 8. Mu.L of aristolochic acid A, the final concentrations of aristolochic acid A were 0,0.4,1.6,3.1,6.3, 12.5, 25, 50, 100. Mu.M, respectively, and the mixture was mixed well, and 75. Mu.L of the mixture was filled into a transparent flat-bottomed 384-well plate.

Absorbance at 670 and 775nm was measured using a microplate reader, and the absorbance ratio a670/a775 was calculated for each sample. The signal gain is calculated as (R-R0)/R0, where R0 and R are the A670/A775 values in the absence and presence, respectively.

The results are shown in FIG. 7: with increasing aristolochic acid A concentration, the absorbance of CY7 at 775nm is reduced, while the absorbance at 670nm is enhanced. Indicating that aristolochic acid a is able to displace Cy7 monomer from the aptamer into solution and thereby form dimer. The signal gain was calculated using the absorbance ratio (A670/A775) between 670-775nm, and the generated calibration curve showed that the signal was linear with aristolochic acid A concentration, the linear equation was y=0.0184x-0.0005, the correlation coefficient was 0.9756, and the detection limit was 0.1228 μg/ml. Indicating that aristolochic acid A can be detected and analyzed by Cy7 dye replacement method.

Example 4 detection of aristolochic acid A in A sample of drug with aptamer

A method for detecting aristolochic acid A in a traditional Chinese medicine sample based on a chlorhexidine/G-quadruplex colorimetric analysis.

Two unlabeled DNA single strands were introduced:

cDNA-G:GTCGTAAGTTCTGCCTGGGG

r-cDNA-G:GGGTAGGGCGGGAGGCAGAACTT

one (cDNA-G) can form a double strand (dsDNA) with 15 base pairs at the 5' end of the SEQ3 aptamer, and the other (r-cDNA-G) is complementary to cDNA-G and is rich in G sequence. In the absence of aristolochic acid A, two cDNAs cannot hybridize to form a G-quadruplex, and the enzyme activity of hemin is reduced due to aggregation. In the presence of aristolochic acid A, the aristolochic acid A is specifically combined with an aptamer, double chains are dissociated, cDNA-G is released and combined with r-cDNA-G to form a G-quadruplex structure and chlorhexidine, and the aristolochic acid A can catalyze hydrogen peroxide to oxidize 2, 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic Acid) (ABTS) to enable a solution to be dark green, and the maximum absorption wavelength is 420nm.

Pulverizing herba asari Chinese medicinal material sample, processing with 60 mesh sieve, precisely weighing 0.5g, adding 25m L70% methanol extract, ultrasonic treating for 45min, centrifuging at 4000r/10min, collecting supernatant, evaporating to dryness, dissolving the residue in 4ml 50% DMSO solution, filtering the supernatant with 0.22mm filter membrane, detecting content of aristolochic acid A in herba asari by established colorimetric detection method, and comparing with high performance liquid chromatography. The detection results of the asarum herb which is a traditional Chinese medicine sample are shown in a table 2, and the table results show that the established measurement results of the two methods have better consistency, and the established colorimetric method has higher sensitivity and lower cost.

Table 2 detection results and detection methods of aristolochic acid a in asarum herb

Therefore, the invention screens out the aptamer with specificity and affinity to aristolochic acid A by using the cPature-SELEX technology, selects the aptamer with highest occurrence frequency of high-flux sequencing results, further improves the performance of the nucleic acid aptamer by shortening and constructing a high-stability secondary structure, and measures the affinity to the obtained aristolochic acid A aptamer by using a micro-thermophoresis molecular interaction instrument (MST), wherein the aptamer has the characteristics of easy synthesis, easy modification, stability and the like, and can be used for the construction of the quick detection method of the aristolochic acid A, the traditional Chinese medicine possibly containing aristolochic acid A and the product thereof.

While only a few embodiments of the present invention have been described, it should be noted that modifications could be made by those skilled in the art without departing from the principles of the present invention, which modifications are to be regarded as being within the scope of the invention.

Sequence listing

<110> university of Chinese medical science

<120> nucleic acid aptamer of aristolochic acid A, screening method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 73

<212> DNA

<213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

cgagcatagg cagaacttac ggcgctaggg ttgtcactgc tgggtatctt gtagtcgtaa 60

gagcgagtca ttc 73

<210> 2

<211> 46

<212> DNA

<213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

cttacggcgc tagggttgtc actgctgggt atcttgtagt cgtaag 46

<210> 3

<211> 54

<212> DNA

<213> Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 3

aggcagaact tacggcgcta gggttgtcac tgctgggtat cttgtagtcg taag 54

<210> 4

<211> 25

<212> DNA

<213> cDNA-bio (2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 4

tttttgtcgt aagttctgcc atttt 25

<210> 5

<211> 20

<212> DNA

<213> Primer FP(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 5

cgagcatagg cagaacttac 20

<210> 6

<211> 20

<212> DNA

<213> Primer FP(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 6

gaatgactcg ctcttacgac 20

<210> 7

<211> 20

<212> DNA

<213> cDNA-G(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 7

gtcgtaagtt ctgcctgggg 20

<210> 8

<211> 23

<212> DNA

<213> r-cDNA-G(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 8

gggtagggcg ggaggcagaa ctt 23

Claims

1. The nucleic acid aptamer of aristolochic acid A is characterized in that the sequence of the nucleic acid aptamer is shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO. 3.

2. The nucleic acid aptamer of aristolochic acid A is characterized in that a nucleic acid aptamer sequence shown as SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 is connected with a fluorescent marker, biotin, a nano material or a radioactive substance.

3. Use of the nucleic acid aptamer of claim 1 or 2 for detecting aristolochic acid a in a product.

4. The use according to claim 3, wherein the product is a pharmaceutical, food or agricultural product.

5. A method for detecting aristolochic acid a in a product, characterized in that a sample is contacted with the aptamer of claim 1, two unlabeled single-stranded DNA cdnas-G and r-cDNA-G are designed, comprising a sequence formed by G-quadruplexes; and the 3' -end part base of cDNA-G is complementarily paired with the nucleic acid aptamer of claim 1; r-cDNA-G is complementary to cDNA-G and is rich in G sequence; when aristolochic acid A is not contained, two single-stranded DNA can not be hybridized to form a G-quadruplex, and the activity of the hemin is reduced due to aggregation; in the presence of aristolochic acid A, the aristolochic acid A is specifically combined with the aptamer shown in the claim 1, double chains are dissociated, cDNA-G is released and forms a G-quadruplex structure with r-cDNA-G to be combined with chlorhexidine, and the solution is dark green by catalyzing hydrogen peroxide to oxidize 2, 2-dinitrogen-bis (3-ethyl-benzothiazole-6-sulfonic acid) for colorimetric analysis;

wherein cDNA-G is GTCGTAAGTTCTGCCTGGGG

r-cDNA-G: GGGTAGGGCGGGAGGCAGAACTT。