CN113684207B - SNP molecular marker, PCR primer and application - Google Patents
SNP molecular marker, PCR primer and application Download PDFInfo
- Publication number
- CN113684207B CN113684207B CN202111111194.9A CN202111111194A CN113684207B CN 113684207 B CN113684207 B CN 113684207B CN 202111111194 A CN202111111194 A CN 202111111194A CN 113684207 B CN113684207 B CN 113684207B
- Authority
- CN
- China
- Prior art keywords
- snp
- base
- seq
- sequence shown
- mycobacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003147 molecular marker Substances 0.000 title claims abstract description 15
- 101150013736 gyrB gene Proteins 0.000 claims abstract description 9
- 101150090202 rpoB gene Proteins 0.000 claims abstract description 9
- 241000186359 Mycobacterium Species 0.000 claims description 32
- 238000000034 method Methods 0.000 claims description 32
- 101000690100 Homo sapiens U1 small nuclear ribonucleoprotein 70 kDa Proteins 0.000 claims description 15
- 102100024121 U1 small nuclear ribonucleoprotein 70 kDa Human genes 0.000 claims description 15
- 241001302239 Mycobacterium tuberculosis complex Species 0.000 claims description 11
- 238000001514 detection method Methods 0.000 claims description 11
- 241000186367 Mycobacterium avium Species 0.000 claims description 8
- 241000186364 Mycobacterium intracellulare Species 0.000 claims description 8
- 241000187479 Mycobacterium tuberculosis Species 0.000 claims description 7
- 230000003321 amplification Effects 0.000 claims description 7
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 7
- 238000012163 sequencing technique Methods 0.000 claims description 7
- 241000187492 Mycobacterium marinum Species 0.000 claims description 6
- 238000000137 annealing Methods 0.000 claims description 5
- 241001508003 Mycobacterium abscessus Species 0.000 claims description 4
- 241000186365 Mycobacterium fortuitum Species 0.000 claims description 4
- 101100029173 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173) SNP2 gene Proteins 0.000 claims description 4
- 101100236128 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) LSM2 gene Proteins 0.000 claims description 4
- 101100094821 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) SMX2 gene Proteins 0.000 claims description 4
- 201000010099 disease Diseases 0.000 claims description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 4
- 241000193830 Bacillus <bacterium> Species 0.000 claims description 2
- 238000000018 DNA microarray Methods 0.000 claims description 2
- 238000001712 DNA sequencing Methods 0.000 claims description 2
- 238000004925 denaturation Methods 0.000 claims description 2
- 230000036425 denaturation Effects 0.000 claims description 2
- 238000003745 diagnosis Methods 0.000 claims description 2
- 238000001502 gel electrophoresis Methods 0.000 claims description 2
- 238000004128 high performance liquid chromatography Methods 0.000 claims description 2
- 238000004949 mass spectrometry Methods 0.000 claims description 2
- 150000001875 compounds Chemical group 0.000 claims 1
- 101100038261 Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB) rpo2C gene Proteins 0.000 abstract description 6
- 101150012629 parE gene Proteins 0.000 abstract description 6
- 101150085857 rpo2 gene Proteins 0.000 abstract description 6
- 108020004414 DNA Proteins 0.000 description 16
- 108090000623 proteins and genes Proteins 0.000 description 11
- 241000894007 species Species 0.000 description 7
- 238000005516 engineering process Methods 0.000 description 6
- 239000012634 fragment Substances 0.000 description 6
- 201000008827 tuberculosis Diseases 0.000 description 6
- 241000186363 Mycobacterium kansasii Species 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 5
- 238000003759 clinical diagnosis Methods 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 241000894006 Bacteria Species 0.000 description 3
- 241001467553 Mycobacterium africanum Species 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- 241000186366 Mycobacterium bovis Species 0.000 description 2
- PVNIIMVLHYAWGP-UHFFFAOYSA-N Niacin Chemical compound OC(=O)C1=CC=CN=C1 PVNIIMVLHYAWGP-UHFFFAOYSA-N 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 230000034994 death Effects 0.000 description 2
- 231100000517 death Toxicity 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 description 2
- 108020000946 Bacterial DNA Proteins 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 206010059866 Drug resistance Diseases 0.000 description 1
- 241001312372 Mycobacterium canettii Species 0.000 description 1
- 241000187478 Mycobacterium chelonae Species 0.000 description 1
- 241000186362 Mycobacterium leprae Species 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108090000913 Nitrate Reductases Proteins 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 241000270708 Testudinidae Species 0.000 description 1
- 206010000269 abscess Diseases 0.000 description 1
- 238000009825 accumulation Methods 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 210000003578 bacterial chromosome Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000000872 buffer Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000006799 invasive growth in response to glucose limitation Effects 0.000 description 1
- 230000007774 longterm Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229960003512 nicotinic acid Drugs 0.000 description 1
- 235000001968 nicotinic acid Nutrition 0.000 description 1
- 239000011664 nicotinic acid Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 239000011535 reaction buffer Substances 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012070 whole genome sequencing analysis Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides SNP molecular markers, PCR primers and application thereof, and relates to the technical field of molecular markers and application thereof. The SNP molecular markers comprise SNP 1-SNP 8 positioned on rpoB genes and SNP 9-SNP 15 positioned on gyrB genes. The SNP molecular marker provided by the invention has polymorphism in 9 mycobacteria, and the type of the mycobacteria to be detected can be identified by detecting the base type of the mycobacteria on the SNP locus.
Description
Technical Field
The invention relates to the technical field of molecular markers, in particular to a SNP molecular marker, a PCR primer and application.
Background
Tuberculosis (TB) caused by a complex of mycobacterium Tuberculosis is the infectious disease with the highest single mortality rate. The WHO report in 2020 suggests that 20 million TB infected people account for 1/3-1/4 of the total global population, while about 1000 tens of thousands of people with morbidity and 140 tens of thousands of deaths. Correspondingly, the TB-infected person in China has about 3.5 hundred million, the number of the ill people is 86.6 ten thousand, the death rate is 3.9 ten thousand, and the third place in the world.
The Mycobacterium tuberculosis complex belongs to the genus Mycobacterium (Mycobacterium) and mainly comprises Mycobacterium tuberculosis (Mycobacterium tuberculosis), mycobacterium bovis (Mycobacterium bovis), mycobacterium africanum, mycobacterium tenuifolia, mycobacterium kennedi and other species. Within the genus Mycobacterium, in addition to Mycobacterium tuberculosis complex and Mycobacterium leprae, more than 100 species such as Mycobacterium avium, mycobacterium intracellulare, and the like, which are also called nontuberculous mycobacteria (No-tuberculosis mycobacteria, NTM) are included.
The traditional method for identifying the mycobacterium is judged according to the phenotypic characteristics of colony morphology, oxygen preference, nicotinic acid accumulation, nitrate reductase activity and the like, and has the advantages of simple method, low reagent price, easy popularization and long-term use. But the method has long time consumption, low positive rate, large pollution and lack of repeatability, and can not accurately and timely provide reference for clinical diagnosis. With the rapid development of molecular biology technology, identification or differentiation of mycobacterium tuberculosis strains and other strains in mycobacterium can be completed by utilizing the specificity of homologous DNA sequences in mycobacterium based on PCR and other technologies, thereby providing objective basis for clinical diagnosis and treatment, and being favored due to the advantages of rapidness, high efficiency, high specificity and the like.
The whole genome sequencing technology is perfected with rapid progress in molecular biology technology, and has become the 'mainstream technology' for identifying strains. According to the method, the mycobacterium is identified to the species or subspecies level according to the specificity of DNA homology fragment sequences of different species of mycobacterium, so that the resolution and accuracy are greatly improved, and meanwhile, the identification time is obviously shortened. However, it is very difficult to be applied to clinical diagnosis because it is expensive and is mostly used for scientific research.
16SrDNA is a bacterial DNA sequence, can code a sequence corresponding to 16SrRNA on a chromosome, is an inherent sequence of all bacterial chromosome genes, and can be used for identifying strains. The method has the advantages of few species, large content and moderate molecular size, not only can embody the difference among different bacteria, but also can easily detect the sequence by a sequencing technology, and can identify bacteria to a species level as a gold standard for identifying mycobacterium. However, because of the high sequence identity and close relatedness of some mycobacteria homologous DNA sequences, the 16SrDNA sequence composition is completely consistent, so that some strains with relatively close relatedness, such as mycobacterium avium and mycobacterium intracellulare, mycobacterium torticola and mycobacterium abscessus, kansas and mycobacterium gastrinus, and the like, cannot be distinguished. There is thus an urgent need to develop an improved method for rapid identification of mycobacteria with high accuracy.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide SNP molecular markers, PCR primers and application. The SNP molecular marker provided by the invention has polymorphism in 9 mycobacteria, and the type of the mycobacteria to be detected can be identified by detecting the base type of the mycobacteria on the SNP locus.
The technical scheme provided by the invention is as follows:
in a first aspect, the present invention provides an SNP molecular marker for identifying a Mycobacterium tuberculosis complex, the SNP molecular marker comprising SNP1 to SNP8 located on the rpoB gene and SNP9 to SNP15 located on the gyrB gene; wherein,
SNP1 is located at position 14 from the 5' -end of the sequence shown in SEQ ID No.1, and the base is A, G;
SNP2 is located at 26 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP3 is located at 65 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP4 is located at 128 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP5 is located at 170 from 5' end of sequence shown in SEQ ID No.1, and the base is G, T or C;
SNP6 is located at 311 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G or T;
SNP7 is located at 421 th from the 5' end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP8 is located at 498 from the 5' end of the sequence shown in SEQ ID No.1, and the base is G, A;
SNP9 is positioned at the 32 position from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP10 is positioned at 38 positions from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G, A or C;
SNP11 is located at 59 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G, T, C or A;
SNP12 is positioned at 149 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP13 is located at 236 from 5' end of sequence shown in SEQ ID No.2, and the base is C, T or G;
SNP14 is located at 302 position from 5' end of sequence shown in SEQ ID No.2, the base is C, T;
SNP15 is located at the 437 position from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G or A.
The SNP molecular markers of the present invention have polymorphisms between a Mycobacterium tuberculosis complex and non-Mycobacterium tuberculosis NTM (Mycobacterium marinum, mycobacterium fortuitum, mycobacterium abscessum, mycobacterium avium, mycobacterium tortoise, mycobacterium kansasii, mycobacterium intracellulare, mycobacterium kavalum).
In a second aspect, the invention provides PCR primers for amplifying the aforementioned SNP molecular markers, comprising primers SEQ ID No.3 and SEQ ID No.4 for amplifying the sequence shown in SEQ ID No. 1; primers SEQ ID No.5 and SEQ ID No.6 for amplifying the sequence shown in SEQ ID No. 2.
The primer composition for identifying the mycobacterium provided by the invention can amplify the SNP marker genes distributed, shortens the gene length through optimization, and can amplify rpoB genes and gyrB genes of the mycobacterium in a sample to be detected more rapidly, sensitively and specifically.
In a third aspect, the present invention provides a kit for detecting the aforementioned SNP molecular markers, comprising the aforementioned PCR primers; preferably, the kit further comprises dNTPs, taq DNA polymerase, mg 2+ At least one of PCR reaction buffer.
In a fourth aspect, the present invention provides a gene chip comprising a PCR primer as described above.
In a fifth aspect, the invention provides the use of said SNP molecular markers or said PCR primers or said kit for the detection and/or identification of Mycobacterium tuberculosis complex, and the invention provides the use of said SNP molecular markers or said PCR primers or said kit for the detection and typing of Mycobacteria, said use being for non-disease diagnostic purposes.
In a sixth aspect, the present invention provides a method for identifying a Mycobacterium tuberculosis complex for non-disease diagnosis purposes, by detecting polymorphisms of the SNP molecular markers as described above to determine the species type of the sample to be tested.
In one embodiment, the method for detecting polymorphism of SNP molecular markers comprises one or more of the following: SNP detection method based on gel electrophoresis, DNA sequencing method, DNA chip method, denaturation high performance liquid chromatography or mass spectrometry detection method.
In one embodiment, in the method, when the polymorphism result shows that the base corresponding to SNP1 to SNP15 is ACTGGGTAAAGATTA, the polymorphism result is a Mycobacterium tuberculosis complex;
when the base corresponding to SNP1 to SNP15 is GGCCTCCGCCCGGCG, the mycobacterium abscessus is obtained;
when the bases corresponding to SNP1 to SNP15 are ACTGGGTAAAAATTA, the Mycobacterium calycinum is obtained;
when the bases corresponding to SNP1 to SNP15 are GGCGCCCACGCGCCG, the Mycobacterium avium is obtained;
when the base corresponding to SNP1 to SNP15 is GGCCTTCGCCGCGCG, the base is mycobacterium chelonii;
when the bases corresponding to SNP1 to SNP15 are GGCCTTCACGCCCCG, the Mycobacterium fortuitum is obtained;
when the base corresponding to SNP1 to SNP15 is GGCCTCCACGCCCCG, it is M.intracellulare;
when the base corresponding to SNP1 to SNP15 is GGCCTGCAGCGCCCG, the Mycobacterium kansasii is obtained;
when the base corresponding to SNP1 to SNP15 is GGCGTCCACGTCCCG, it is Mycobacterium marinum.
In one embodiment, the method further comprises obtaining DNA of the sample to be tested; amplifying the DNA as a template by using the PCR primer; sequencing the amplified product to determine the polymorphism of the SNP molecular marker.
In a specific embodiment, the method comprises:
1) Extracting genome DNA of a sample to be detected;
2) Respectively amplifying DNA fragments containing core SNP markers by PCR reaction by using the extracted genome DNA as a template and respectively using primers shown in SEQ ID No. 3-4 and primers shown in SEQ ID No. 5-6;
3) Detecting PCR amplified products, sequencing the amplified products, analyzing the sequencing result, and judging polymorphism at SNP sites.
In one embodiment, the concentration of the primer in the amplification system is 350 to 500nM, preferably 500nM.
In one embodiment, during amplification, 2 sets of primers are subjected to the same annealing temperature, which is 58℃to 62℃and preferably 60 ℃.
The beneficial effects are that:
(1) The SNP loci contained in the SNP molecular markers provided by the invention are distributed on two different genes, and different types of mycobacteria are distinguished from the SNP polymorphism on the two different genes, so that the polymorphism difference between different types of mycobacteria SNP can be increased, and the identification accuracy is improved.
(2) The SNP molecular marker provided by the invention has polymorphism in 9 mycobacteria, and the type of the mycobacteria to be detected can be identified by detecting the base type of the mycobacteria on 15 SNP loci.
(3) The method for identifying the mycobacterium does not need complex steps such as culture, biochemical detection and the like, and is simple and convenient to operate; and the detection result is quickly obtained without waiting for a long time.
(4) The invention can identify various clinically common NTM bacteria besides identifying the mycobacterium tuberculosis which mainly infects human bodies and causes serious drug resistance, and has comprehensive identification.
(5) The method of the invention does not need a large-scale expensive detection instrument, and can perform experiments only by using a common PCR instrument and reagents thereof.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the rpoB and gyrB gene clades (wherein Mycobacterium avium: mycobacterium avium; mycolicibacterium fortuitum: mycobacterium fortuitum; mycobacteroides chelonae: mycobacterium torticolum; mycobacteroides abscessus: mycobacterium abscess; mycobacterium marinum: mycobacterium marinum; mycobacterium kansasii: mycobacterium kansasii; mycobacterium intracellulare: mycobacterium intracellulare; mycobacterium canettii: mycobacterium kakii) provided by the examples of the present invention;
fig. 2 is a clinical outcome verification based on rpoB and gyrB genes (a portion of the outcome figure is shown cut away).
Detailed Description
The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Example 1: SNP molecular marker
The SNP molecular markers selected by the invention are positioned on rpoB genes and gyrB genes. The selected gene has high conservation degree in mycobacterium and strong diversity among different NTMs, and the specific method is that the target gene is divided into 10 longer fragments by on-line analysis software MEME, and the internal fragments of the gene are selected as alternative amplification regions according to the principle that the difference between MTBC and NTM is as small as possible and the difference between MTBC and NTM is as large as possible. The selected fragment is introduced into MEGA7.0 software for gene alignment, and a variable site is marked, namely SNP, and screening is carried out for standby according to the principle that the diversity of the SNP at the same site is as strong as possible (with two or more base types). The visible difference of the evolutionary tree constructed according to the target gene is obvious, and the evolutionary tree is shown in figure 1.
As can be seen from the molecules in FIG. 1, there is no difference in the M.tuberculosis complex, such as L1-L7 (linear 1-linear 7 all belong to MTB complex, where L1 corresponds to Indo-Oceanic linear, L2 East-Asian linear, L3 East-African-Indian linear, L4 Euro-American linear, L5 and L6 are M.africanum West Africa 1 and M.africanum West Africa 2;L7 Ethiopian lineage), and there is a strong diversity in other NTMs, and there is a strong difference between different NTMs, which is an effective combination of molecular markers.
In the provided SNP molecular markers, SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8 are located in rpoB genes, and SNP9, SNP10, SNP11, SNP12, SNP13, SNP14, SNP15 are located in gyrB genes.
SNP1 is located at position 14 from the 5' -end of the sequence shown in SEQ ID No.1, and the base is A, G;
SNP2 is located at 26 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP3 is located at 65 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP4 is located at 128 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP5 is located at 170 from 5' end of sequence shown in SEQ ID No.1, and the base is G, T or C;
SNP6 is located at 311 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G or T;
SNP7 is located at 421 th from the 5' end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP8 is located at 498 from the 5' end of the sequence shown in SEQ ID No.1, and the base is G, A;
SNP9 is positioned at the 32 position from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP10 is positioned at 38 positions from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G, A or C;
SNP11 is located at 59 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G, T, C or A;
SNP12 is positioned at 149 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP13 is located at 236 from 5' end of sequence shown in SEQ ID No.2, and the base is C, T or G;
SNP14 is located at 302 position from 5' end of sequence shown in SEQ ID No.2, the base is C, T;
SNP15 is located at the 437 position from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G or A.
The distribution and base type of each SNP site in the SNP molecular marker are shown in Table 1.
TABLE 1 distribution and base type of each SNP site in SNP molecular markers
Example 2: PCR detection of Mycobacterium species to be tested
The detection method comprises the following steps:
1) Extracting genome DNA of a sample to be detected;
2) Respectively amplifying DNA fragments containing core SNP markers by PCR reaction by using the extracted genome DNA as a template and respectively using primers shown in SEQ ID No. 3-4 and primers shown in SEQ ID No. 5-6;
3) Detecting PCR amplified products, sequencing the amplified products, analyzing the sequencing result, and judging polymorphism at SNP sites.
TABLE 2 PCR primer pairs
SEQ ID No.1：
CGTACGCGGCTCCACTGTTCGTCACCGCCGAGTTCATCAACAACAACACCGGTGAGATCAAGAGTCAGACGGTGTTCATGGGTGACTTCCCGATGATGACCGAGAAGGGCACGTTCATCATCAACGGGACCGAGCGTGTGGTGGTCAGCCAGCTGGTGCGGTCGCCCGGGGTGTACTTCGACGAGACCATTGACAAGTCCACCGACAAGACGCTGCACAGCGTCAAGGTGATCCCGAGCCGCGGCGCGTGGCTCGAGTTTGACGTCGACAAGCGCGACACCGTCGGCGTGCGCATCGACCGCAAACGCCGGCAACCGGTCACCGTGCTGCTCAAGGCGCTGGGCTGGACCAGCGAGCAGATTGTCGAGCGGTTCGGGTTCTCCGAGATCATGCGATCGACGCTGGAGAAGGACAACACCGTCGGCACCGACGAGGCGCTGTTGGACATCTACCGCAAGCTGCGTCCGGGCGAGCCCCCGACCAAAGAGTCAGCGCAGACGCTGTTGGAAAACTTG。
SEQ ID No.2：
ACGCGGTCGACGAGGCGATGGCCGGTTATGCAACCACAGTGAACGTAGTGCTGCTTGAGGATGGCGGTGTCGAGGTCGCCGACGACGGCCGCGGCATTCCGGTCGCCACCCACGCCTCCGGCATACCGACCGTCGACGTGGTGATGACACAACTACATGCCGGCGGCAAGTTCGACTCGGACGCGTATGCGATATCTGGTGGTCTGCACGGCGTCGGCGTGTCGGTGGTTAACGCGCTATCCACCCGGCTCGAAGTCGAGATCAAGCGCGACGGGTACGAGTGGTCTCAGGTTTATGAGAAGTCGGAACCCCTGGGCCTCAAGCAAGGGGCGCCGACCAAGAAGACGGGGTCAACGGTGCGGTTCTGGGCCGACCCCGCTGTTTTCGAAACCACGGAATACGACTTCGAAACCGTCGCCCGCCGGCTGCAAGAGATG。
PCR reaction system:
using the primer pairs in table 2, a conventional PCR reaction system was employed, as follows:
the total volume was 20. Mu.L, and it contained 2X Premix Taq (Code No.: R004A, takara Co., premix is a 2-fold concentration Mixture composed of DNA Polymerase, buffer, dNTP mix) 10. Mu.L, and 10. Mu.M of each of the upstream and downstream primers was 1. Mu.L (final concentration was 0.5. Mu.M);
1 μl of DNA template was supplemented with a double distilled water 7 μl to 20 μl system.
PCR reaction procedure:
94 ℃ for 5min;30 cycles: 94 ℃,45sec;60 ℃,45sec;72 ℃,50sec, final extension 72 ℃,7min.
The same annealing temperature is adopted for the primer pair 2, so that the operation steps are reduced, and the strain identification time is saved.
Judging polymorphism at SNP locus, and determining strain type:
if the sample to be tested is represented by the 15 th site: ACTGGGTAAAGATTA, it is a Mycobacterium tuberculosis complex;
if the sample to be tested is represented by the 15 th site: GGCCTCCGCCCGGCG, it is Mycobacterium abscessum;
if the sample to be tested is represented by the 15 th site: ACTGGGTAAAAATTA, mycobacterium kavaliensis;
if the sample to be tested is represented by the 15 th site: GGCGCCCACGCGCCG, mycobacterium avium;
if the sample to be tested is represented by the 15 th site: GGCCTTCGCCGCGCG it is Mycobacterium chelonian;
if the sample to be tested is represented by the 15 th site: GGCCTTCACGCCCCG, then it is an accidental mycobacterium;
if the sample to be tested is represented by the 15 th site: GGCCTCCACGCCCCG is M.intracellulare;
if the sample to be tested is represented by the 15 th site: GGCCTGCAGCGCCCG it is Mycobacterium kansasii;
if the sample to be tested is represented by the 15 th site: GGCGTCCACGTCCCG it is Mycobacterium marinum.
According to the verification of PCR experiments, the method has stronger consistency against clinical tuberculosis strains, is effective molecular identification for identifying tubercle bacillus and NTM, and then 200 cases of clinical MTB samples are used for verification, and only partial clinical strains with differences are shown as the partial clinical strains have no SNP differences, and the results of the partial clinical strains with differences are shown in figure 2. The results were classified based on clinically established strains, 100% agreement with the clinical results. The SNP classification target has stronger consistency, has larger difference with NTM, and is an effective basis for clinical diagnosis.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.
SEQUENCE LISTING
<110> Beijing chest hospital affiliated to university of capital medical science; beijing city tuberculosis chest tumor institute
<120> SNP molecular marker, PCR primer and application
<130> PA21024390
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 515
<212> DNA
<213> rpoB
<400> 1
cgtacgcggc tccactgttc gtcaccgccg agttcatcaa caacaacacc ggtgagatca 60
agagtcagac ggtgttcatg ggtgacttcc cgatgatgac cgagaagggc acgttcatca 120
tcaacgggac cgagcgtgtg gtggtcagcc agctggtgcg gtcgcccggg gtgtacttcg 180
acgagaccat tgacaagtcc accgacaaga cgctgcacag cgtcaaggtg atcccgagcc 240
gcggcgcgtg gctcgagttt gacgtcgaca agcgcgacac cgtcggcgtg cgcatcgacc 300
gcaaacgccg gcaaccggtc accgtgctgc tcaaggcgct gggctggacc agcgagcaga 360
ttgtcgagcg gttcgggttc tccgagatca tgcgatcgac gctggagaag gacaacaccg 420
tcggcaccga cgaggcgctg ttggacatct accgcaagct gcgtccgggc gagcccccga 480
ccaaagagtc agcgcagacg ctgttggaaa acttg 515
<210> 2
<211> 437
<212> DNA
<213> gyrB
<400> 2
acgcggtcga cgaggcgatg gccggttatg caaccacagt gaacgtagtg ctgcttgagg 60
atggcggtgt cgaggtcgcc gacgacggcc gcggcattcc ggtcgccacc cacgcctccg 120
gcataccgac cgtcgacgtg gtgatgacac aactacatgc cggcggcaag ttcgactcgg 180
acgcgtatgc gatatctggt ggtctgcacg gcgtcggcgt gtcggtggtt aacgcgctat 240
ccacccggct cgaagtcgag atcaagcgcg acgggtacga gtggtctcag gtttatgaga 300
agtcggaacc cctgggcctc aagcaagggg cgccgaccaa gaagacgggg tcaacggtgc 360
ggttctgggc cgaccccgct gttttcgaaa ccacggaata cgacttcgaa accgtcgccc 420
gccggctgca agagatg 437
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
gtgcaaagac aaggacatga 20
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<400> 4
tagcgcttct ccttgaagaa 20
<210> 5
<211> 20
<212> DNA
<213> artificial sequence
<400> 5
catttgggag gtggtcgaca 20
<210> 6
<211> 20
<212> DNA
<213> artificial sequence
<400> 6
agccccttgt tgaggaacgc 20
Claims (8)
1. A method for identifying Mycobacterium tuberculosis complex for non-disease diagnosis purpose is characterized in that the strain type of a sample to be detected is judged by detecting polymorphism of SNP molecular markers;
the SNP molecular markers are SNP 1-SNP 8 positioned on the rpoB gene and SNP 9-SNP 15 positioned on the gyrB gene; wherein the method comprises the steps of
SNP1 is located at position 14 from the 5' -end of the sequence shown in SEQ ID No.1, and the base is A, G;
SNP2 is located at 26 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP3 is located at 65 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP4 is located at 128 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G;
SNP5 is located at 170 from 5' end of sequence shown in SEQ ID No.1, and the base is G, T or C;
SNP6 is located at 311 positions from the 5' -end of the sequence shown in SEQ ID No.1, and the base is C, G or T;
SNP7 is located at 421 th from the 5' end of the sequence shown in SEQ ID No.1, and the base is C, T;
SNP8 is located at 498 from the 5' end of the sequence shown in SEQ ID No.1, and the base is G, A;
SNP9 is positioned at the 32 position from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP10 is positioned at 38 positions from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, C or G;
SNP11 is located at 59 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is G, T, C or A;
SNP12 is positioned at 149 from the 5' -end of the sequence shown in SEQ ID No.2, and the base is A, G or C;
SNP13 is located at 236 from 5' end of sequence shown in SEQ ID No.2, and the base is C, T or G;
SNP14 is located at 302 position from 5' end of sequence shown in SEQ ID No.2, the base is C, T;
SNP15 is located in 437 position from 5' end of sequence shown in SEQ ID No.2, the base is G or A;
when the polymorphism result shows that the bases corresponding to SNP 1-SNP 15 are ACTGGGTAAAGATTA, the compound group is mycobacterium tuberculosis;
when the base corresponding to SNP 1-SNP 15 is GGCCTCCGCCCGGCG, the mycobacterium abscessus is obtained;
when the base corresponding to SNP 1-SNP 15 is ACTGGGTAAAAATTA, the mycobacterium kapto is obtained;
when the base corresponding to SNP 1-SNP 15 is GGCGCCCACGCGCCG, the base is mycobacterium avium;
when the base corresponding to SNP 1-SNP 15 is GGCCTTCGCCGCGCG, the base is mycobacterium chelonii;
when the base corresponding to SNP 1-SNP 15 is GGCCTTCACGCCCCG, the Mycobacterium fortuitum is obtained;
when the base corresponding to SNP 1-SNP 15 is GGCCTCCACGCCCCG, the base is M.intracellulare;
when the base corresponding to SNP 1-SNP 15 is GGCCTGCAGCGCCCG, the bacillus kansasii is obtained;
when the base corresponding to SNP1 to SNP15 is GGCGTCCACGTCCCG, it is Mycobacterium marinum.
2. The method according to claim 1, wherein the method for detecting the polymorphism of the SNP molecular marker comprises one or more of the following: SNP detection method based on gel electrophoresis, DNA sequencing method, DNA chip method, denaturation high performance liquid chromatography or mass spectrometry detection method.
3. The method according to claim 1, wherein the amplification is performed using PCR primers using the DNA of the sample to be tested as a template; sequencing the amplified product to determine the polymorphism of the SNP molecular marker;
the PCR primer comprises primers SEQ ID No.3 and SEQ ID No.4 for amplifying a sequence shown in SEQ ID No. 1; primers SEQ ID No.5 and SEQ ID No.6 for amplifying the sequence shown in SEQ ID No. 2.
4. The method of claim 3, wherein the concentration of PCR primers in the amplification procedure is 350-500 nM.
5. The method of claim 4, wherein the concentration of PCR primers in the amplification procedure is 500nM.
6. The method of claim 5, wherein 2 sets of primers are used at the same annealing temperature during the amplification process, the annealing temperature being 58 ℃ to 62 ℃.
7. The method of claim 6, wherein the annealing temperature is 60 ℃.
8. Use of the SNP molecular marker of claim 1 for detecting and/or identifying a mycobacterium tuberculosis complex, the use being for non-disease diagnostic purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111111194.9A CN113684207B (en) | 2021-09-23 | 2021-09-23 | SNP molecular marker, PCR primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111111194.9A CN113684207B (en) | 2021-09-23 | 2021-09-23 | SNP molecular marker, PCR primer and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113684207A CN113684207A (en) | 2021-11-23 |
| CN113684207B true CN113684207B (en) | 2024-01-09 |
Family
ID=78586889
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111111194.9A Active CN113684207B (en) | 2021-09-23 | 2021-09-23 | SNP molecular marker, PCR primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113684207B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2001299354A (en) * | 2000-04-21 | 2001-10-30 | Srl Inc | Nucleic acid for detecting bacterium belonging to genus mycobacterium |
| CN101560568A (en) * | 2008-04-16 | 2009-10-21 | 亚洲基因科技股份有限公司 | Method and kit for detecting mycobacterium tuberculosis and nontuberculous mycobacterium |
| CN111057783A (en) * | 2020-03-18 | 2020-04-24 | 中国疾病预防控制中心传染病预防控制所 | Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme constant-temperature rapid amplification technology and application thereof |
| CN113249502A (en) * | 2021-05-08 | 2021-08-13 | 上海康黎诊断技术有限公司 | Related gene, method, primer group and kit for mycobacterium tuberculosis complex flora identification and drug resistance detection |
-
2021
- 2021-09-23 CN CN202111111194.9A patent/CN113684207B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2001299354A (en) * | 2000-04-21 | 2001-10-30 | Srl Inc | Nucleic acid for detecting bacterium belonging to genus mycobacterium |
| CN101560568A (en) * | 2008-04-16 | 2009-10-21 | 亚洲基因科技股份有限公司 | Method and kit for detecting mycobacterium tuberculosis and nontuberculous mycobacterium |
| CN111057783A (en) * | 2020-03-18 | 2020-04-24 | 中国疾病预防控制中心传染病预防控制所 | Primer probe group for detecting mycobacterium tuberculosis complex and rpoB mutation based on multi-enzyme constant-temperature rapid amplification technology and application thereof |
| CN113249502A (en) * | 2021-05-08 | 2021-08-13 | 上海康黎诊断技术有限公司 | Related gene, method, primer group and kit for mycobacterium tuberculosis complex flora identification and drug resistance detection |
Non-Patent Citations (2)
| Title |
|---|
| 基于gyrB序列Taqman实时荧光PCR检测在MTC鉴定中的应用;张诗蒙等;《实用医学杂志》;第30卷(第3期);第472-474页 * |
| 采用gyrB基因扩增快速鉴定结核分枝杆菌复合群的初步研究;尹小毛等;《实用医学杂志》;第26卷(第23期);摘要、第4263页3讨论部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113684207A (en) | 2021-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Desjardin et al. | Comparison of the ABI 7700 system (TaqMan) and competitive PCR for quantification of IS 6110 DNA in sputum during treatment of tuberculosis | |
| CN102634575B (en) | Rapid identification method and kit of novel mycobacterium strain | |
| Kong et al. | Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification | |
| Guo et al. | Rapid, accurate determination of multidrug resistance in M. tuberculosis isolates and sputum using a biochip system | |
| Kong et al. | secA1 gene sequence polymorphisms for species identification of Nocardia species and recognition of intraspecies genetic diversity | |
| WO2012169099A1 (en) | Method for detecting fungi, reaction solution for pcr, and carrier for detecting fungi | |
| Innings et al. | Identification of 43 Streptococcus species by pyrosequencing analysis of the rnpB gene | |
| Reddington et al. | Novel multiplex real-time PCR diagnostic assay for identification and differentiation of Mycobacterium tuberculosis, Mycobacterium canettii, and Mycobacterium tuberculosis complex strains | |
| Thiede et al. | Rapid and sensitive typing of NPM1 mutations using LNA-mediated PCR clamping | |
| Peng et al. | Multi-fluorescence real-time PCR assay for detection of RIF and INH resistance of M. tuberculosis | |
| CN109628619B (en) | SNP molecular marker and method for identifying mycobacteria, primer composition, kit and application | |
| CN113373251B (en) | SNP molecular marker for identifying mycobacterium tuberculosis complex, PCR primer and application | |
| CN103014135A (en) | Method for identifying mycobacterium tuberculosis | |
| EP2677040A1 (en) | Probe, chip, kit and method for detection of mycobacterium tuberculosis, non-tuberculous mycobacteria and drug resistant of mycobacterium tuberculosis | |
| CN116875712A (en) | Mycobacterium tuberculosis complex multi-target detection system based on fluorescence labeling capillary electrophoresis | |
| CN112280840A (en) | Kit for detecting and identifying mycobacterium and detection method thereof | |
| CN113684207B (en) | SNP molecular marker, PCR primer and application | |
| CN106868113A (en) | SNP marker and its application for identifying mycobacterium bovis | |
| Wang et al. | Rapid method for identification of six common species of mycobacteria based on multiplex SNP analysis | |
| KR101765677B1 (en) | Primer set for detection of mycobacterium tuberculosis and non-Tuberculosis mycobacteria and use thereof | |
| JP2010517584A (en) | Genetic methods for species identification of Campylobacter | |
| CN106834498A (en) | The primer and method of a kind of Rapid identification mycobacteria | |
| Chikamatsu et al. | Evaluation of Q Gene Mycobacteria: A novel and easy nucleic acid chromatography method for mycobacterial species identification | |
| CN103757110B (en) | A kind of vibrio cholerae analyzes parting kit | |
| Victor et al. | Strain-specific variation in the dnaJ gene of mycobacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |