CN113684160B - Klebsiella bacteria for modifying Rcs signal system and application thereof - Google Patents
Klebsiella bacteria for modifying Rcs signal system and application thereof Download PDFInfo
- Publication number
- CN113684160B CN113684160B CN202010420345.8A CN202010420345A CN113684160B CN 113684160 B CN113684160 B CN 113684160B CN 202010420345 A CN202010420345 A CN 202010420345A CN 113684160 B CN113684160 B CN 113684160B
- Authority
- CN
- China
- Prior art keywords
- klebsiella
- bacteria
- rcsa
- rcsb
- regulatory protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/26—Klebsiella (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
Abstract
The invention discloses Klebsiella bacteria for modifying an Rcs signal system and application thereof. The modified Klebsiella bacteria are bacteria for expressing the transcription regulatory protein RcsA gene or the regulatory protein RcsB gene in an Rcs signal system at high level; alternatively, the engineered Klebsiella bacteria are bacteria that inactivate the transcriptional regulatory protein RcsA or the regulatory protein RcsB in the Rcs signaling system. The transformation efficiency of exogenous DNA can be improved by modifying Klebsiella bacteria of the inactivation regulatory protein RcsA or regulatory protein RcsB; and increases the yield of 1, 3-propanediol and 2, 3-butanediol produced by the bacterium. The invention obviously improves the yield of extracellular polysaccharide in fermentation liquor when the modified klebsiella bacteria which overexpress the transcription regulatory protein RcsA or regulatory protein RcsB are fermented and cultured by taking glucose as a carbon source.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to an improved Klebsiella bacterium and application thereof in the aspects of molecular biological operation, metabolite production and the like.
Background
Klebsiella spp is a class of gram-negative bacteria that is widely distributed in nature, including Klebsiella pneumoniae (Klebsiella pneumonia), klebsiella acidophilus (Klebsiella oxytoca), and Klebsiella mutans (Klebsiella variicola). The bacteria of genus bacteria have the characteristics of vigorous growth, capability of utilizing various carbon sources for growth and the like. At present, klebsiella bacteria are mainly used as production strains of chemicals such as 1, 3-propanediol, 2, 3-butanediol, 2-ketogluconic acid, acetoin and the like, and have the advantages of high substrate conversion rate, high final product concentration and the like.
The surface of the Klebsiella bacteria has a capsule structure, and the capsule can improve the resistance of the bacteria to adverse environment. At the same time, the existence of the capsule also increases the resistance of DNA entering cells, and reduces the conversion efficiency of DNA entering cells in molecular biological operation. The capsules also have a very important influence on the industrial application of the strains, and the capsular polysaccharide produced in the fermentation broth increases the viscosity of the fermentation broth, which places a burden on the fermentation broth in the clarification process. In klebsiella bacteria, the synthesis and transport of capsular polysaccharide is realized by encoding related proteins by cps gene clusters, and the expression level of the cps gene clusters is regulated by an Rcs signal system.
Rcs (Regulator of capsule synthesis) the phosphorylated signal transduction system is a multicomponent system which plays an important role in regulating the synthesis of capsular polysaccharides (Capsular polysaccharide, cps) and extracellular polysaccharides (Eps). The Rcs signal pathway mainly includes four proteins: helper proteins RcsA, response regulatory proteins RcsB, transmembrane sensor kinase RcsC, and phosphotransporter RcsD. When cells are subjected to an external stimulus, the transmembrane sensing kinase RcsC undergoes autophosphorylation, and subsequently the phosphate group is transferred to the response regulatory protein RcsB with the aid of the phosphate transporter RcsD, thereby activating the protein RcsB. Forming an RcsAB complex by the activated RcsB protein and RcsA protein, and then regulating and controlling the expression of a target gene; meanwhile, the RcsB protein has some other functions, and can activate transcription of various genes, including capsular synthesis related genes and membrane proteins, and inhibit synthesis of flagella, independently without participation of auxiliary proteins.
Disclosure of Invention
The invention aims to provide Klebsiella bacteria for modifying an Rcs signal system and application thereof.
The technical scheme adopted by the invention for achieving the purpose is as follows:
the modified Klebsiella bacteria are bacteria which over-express the transcription regulatory protein RcsA gene in an Rcs signal system.
The modified Klebsiella bacteria are bacteria which over-express regulatory protein RcsB genes in an Rcs signal system.
The modified Klebsiella bacteria are transcription regulatory protein RcsA or regulatory protein RcsB bacteria in an inactivated Rcs signal system.
The protein RcsA is transcriptional regulatory protein a in Rcs signal pathway in klebsiella bacteria, and the name of coding gene RcsA. The gene reading frame in the genome of Klebsiella pneumoniae342 (also called Klebsiella variotis) (GeneBank: CP000964.1; NC-011283) is shown in SEQ ID NO.1, and the amino acid sequence Genebank number is (A CI 11159.1). The protein RcsB is a transcriptional regulatory protein B in Rcs signaling pathway in klebsiella bacteria, and encodes the gene name RcsB. The gene reading frame of the recombinant DNA in the genome of Klebsiella pneumoniae342 is shown as SEQ ID NO. 2; the amino acid sequence number is (ACI 08132.1).
The invention also provides application of the modified klebsiella bacteria of the transcriptional regulatory protein RcsA or the transcriptional regulatory protein RcsB in the inactivated Rcs signal system in exogenous DNA transformation of the klebsiella bacteria. The conversion rate of the exogenous gene can be improved by knocking out the RcsA gene or RcsB gene in klebsiella.
The invention also provides application of the modified klebsiella bacteria of transcriptional regulatory protein RcsA or regulatory protein RcsB in the inactivated Rcs signal system in producing 1, 3-propanediol. The specific method comprises the following steps: inoculating the transformed klebsiella bacteria into a culture medium with glycerol as a main carbon source for fermentation culture, and producing the 1, 3-propanediol by the bacteria.
The invention also provides application of the modified klebsiella bacteria of the transcriptional regulatory protein RcsA or the transcriptional regulatory protein RcsB in the inactivated Rcs signal system in the production of 2, 3-butanediol. The specific method comprises the following steps: inoculating the transformed Klebsiella bacteria into a culture medium with saccharides such as glucose as a carbon source for fermentation culture, and producing 2, 3-butanediol by the bacteria.
The invention also provides application of the modified klebsiella bacteria of the transfer regulatory protein RcsA gene or regulatory protein RcsB gene in the over-expression Rcs signal system in extracellular polysaccharide production. The specific method comprises the following steps: inoculating the transformed Klebsiella bacteria into a culture medium which takes saccharides such as glucose and the like as carbon sources for fermentation culture, and accumulating extracellular polysaccharide in fermentation liquor by the bacteria. The extracellular polysaccharide refers to viscous polysaccharide or capsular polysaccharide secreted by microorganisms to the outside of cell walls, and is a natural macromolecular biopolymer.
Compared with the prior art, the invention has the beneficial effects that:
1, the invention modifies Klebsiella bacteria by inactivating transcription regulatory protein RcsA or regulatory protein RcsB. The transformation efficiency of the exogenous DNA in the transformed Klebsiella bacteria is improved. The improved yield of 1, 3-propanediol and 2, 3-butanediol produced by the Klebsiella bacteria is improved. The method provided by the invention has extremely high application value for molecular biological operation and industrial production;
2, the invention modifies Klebsiella bacteria by expressing a transcription regulatory protein RcsA or a regulatory protein RcsB. When the transformed klebsiella bacteria are fermented and cultured by taking glucose as a carbon source, the yield of extracellular polysaccharide in fermentation liquor is obviously improved. The extracellular polysaccharide produced by the method provided by the invention can be used as a thickening agent, a stabilizing agent, an emulsifying agent, a suspending agent, a gelling agent and the like to be applied to the fields of food, chemical industry, medical treatment and the like. The method provided by the invention has a guiding effect on the production of extracellular polysaccharide by taking Klebsiella bacteria as an original strain.
Detailed description of the preferred embodiments
The following describes the technical scheme of the present invention in detail by referring to examples.
The reagents and biological materials used hereinafter are commercial products unless otherwise specified.
Example 1
A strain expressing the transcriptional regulatory protein RcsA in the Rcs signal system in Klebsiella bacteria was constructed by using the method of constructing the expression plasmid.
The klebsiella pneumoniae CGMCC1.6366 strain (this strain is also referred to as TUAC01, AC 01), the CGMCC1.6366 strain has been disclosed in the literature (Journal of Microbiology & biotechnology.2012:1219-1226). The strain is a strain for producing 1, 3-propanediol, 2, 3-butanediol, acetoin and 2-ketogluconic acid. The bacteria are separated from soil, and the separation process and the characteristics are described in World Journal of Microbiology Biotech nology 2008, 24:1731-1740.
1) Linearization of expression plasmids. The circular expression plasmid was linearized by cleavage with specific enzymes at the Hind III and EcoRI restriction sites on the pDK plasmid.
2) Amplifying the rcsA fragment of the target gene. The Klebsiella pneumoniae CGMCC1.6366 genome DNA is used as a template, and rcsA-s are used as a template: TCCGCCAAAACAGCCAAGCTTATGTCAACGATGATTATGGATTTGTG (SEQ ID No. 3) and rcsA-a: TTCACACAGGAAACAGAATTCTCAGCGTAGATTCACCTGAATACC (SEQ ID No. 4) is used as a primer for PCR amplification to obtain a gene fragment of coding protein rcsA in Klebsiella pneumoniae CGMCC 1.6366.
3) The target gene is linked to a linearization vector. The amplified gene fragment rcsA was ligated into a double-enzyme-cleaved linear fragment according to the procedure of ClonExpress kit (commercial product). The recombinant products were transferred into DH 5. Alpha. Competent cells, and positive clones were selected by kanamycin-resistant plates. The plasmid extracted from the positive clone was pDK6-rcsA.
4) Transformation of plasmid in Klebsiella pneumoniae. Freshly prepared competent cells of Klebsiella electrotransport pneumobacteria were taken and added with plasmid pDK-rcsA for shock transformation. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was kp- (rcsA).
5) Transformation of plasmids in Klebsiella oxytoca. Freshly prepared competent cells of Klebsiella electrotransport acid-producing bacteria were taken and added to plasmid pDK-rcsA for shock transformation. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was ko- (rcsA).
6) Transformation of plasmid in klebsiella mutans. Freshly prepared competent cells of Klebsiella electrotransport were taken and added to plasmid pDK-rcsA for shock transformation. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was kv- (rcsA).
Example 2
The method for constructing the expression plasmid is utilized to construct a strain for expressing the regulatory protein RcsB in an Rcs signal system in Klebsiella bacteria.
1) Linearization of expression plasmids. The circular expression plasmid was linearized by cleavage with specific enzymes at the Hind III and EcoRI restriction sites on the pDK plasmid.
2) Amplifying the rcsB fragment of the target gene. The Klebsiella pneumoniae CGMCC1.6366 genome DNA is used as a template, and rcsB-s: TCCGCCAAAACAGCCAAGCTTATGAACACTATGAACGTAATTATTGCC (SEQ ID No. 5) and rcsB-a: TTCACACAGGAAACAGAATTCTTACTCTTTGTCCGTCGCGC (SEQ ID No. 6) is used as a primer for PCR amplification to obtain a gene fragment of encoding protein rcsB of Klebsiella pneumoniae CGMCC 1.6366.
3) The target gene is linked to a linearization vector. The amplified target gene fragment rcsB is connected with a linear fragment cut by double enzymes to form a loop. The recombinant products were transferred into DH 5. Alpha. Competent cells, and positive clones were selected by kanamycin-resistant plates. The plasmid extracted from the positive clone is pDK6-rcsB.
4) Transformation of plasmid in Klebsiella pneumoniae. The freshly prepared competent cells of Klebsiella electrotransport pneumobacillus CGMCC1.6366 are added with plasmid pDK-rcsB for electrotransport. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was kp- (rcsB).
5) Transformation of plasmids in Klebsiella oxytoca. Freshly prepared competent cells of Klebsiella electrotransport acid-producing bacillus M5a1 were taken and added with plasmid pDK-rcsB for electrotransport. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was ko- (rcsB).
6) Transformation of plasmid in klebsiella mutans. Freshly prepared competent cells of Klebsiella electrotransport bacteria S12 were taken and added with plasmid pDK-rcsB for electrotransport. The transformed bacterial solution was diluted appropriately and spread on a kanamycin-resistant plate, and cultured overnight at 37 ℃. The positive clone selected was kv- (rcsB).
Example 3
The Klebsiella pneumoniae strain with the transcription regulatory protein RcsA gene inactivated in an Rcs signal system is constructed by utilizing a gene recombination method to realize the inactivation of the transcription regulatory protein RcsA activity.
1) The gene sequences of the homologous arm genes and the resistance fragment gene are amplified at the upstream end and the downstream end of the rcsA gene. With rcsA-Q600-s: CCCGGGGATCCTCTAGAGATCGATCACACGCTGCCACTG (SEQ ID No. 7), rcsA-Q600-a: CCTACAGACCCATCCTCAATCAACACGT (SEQ ID No. 8) and rcsA-H600-s: TCCCCGGAATAACAAACTGGCGGTGGTCC (SEQ ID No. 9), rcsA-H600-a: CATGCCTGCAGGTCGACGATGGATTTTTTTCGCCCATCG (SEQ ID No. 10) is a specific primer, and DNA sequences of 600bp before and after rcsA genes are respectively obtained by PCR amplification by taking Klebsiella pneumoniae CGMCC1.6366 genome DNA as a template. With rcsA-FRT-s: ATTGAGGATGGGTCTGTAGGCTGGAGCTGCTTCG (SEQ ID No. 11), rcsA-FRT-a: CCAGTTTGTTATTCCGGGGATCCGTCGA (SEQ ID No. 12) is a specific primer, and PIJ773 plasmid is used as a template for PCR amplification to obtain an aac (3) IV gene fragment with FRT sites at two ends and apramycin resistance in the middle. In pMD18-T-s: ATCGTCGACCTGCAGGCA (SEQ ID No. 13) and pMD18-T-a: ATCTCTAGAGGATCCCCGGGT (SEQ ID No. 14) is a specific primer, and PCR amplification is performed using a plasmid pMD-18T simple (commercial product) as a template to obtain a linearized pMD18-T gene fragment.
2) Recombinant ligation of gene fragments was performed according to the procedure described in the ClonExpress kit. And (3) carrying out recombination connection on the gene fragment amplified in the step (1). Thereafter, the cells were transformed into DH 5. Alpha. Competent cells, and screened with an enramycin-resistant plate.
3) The positive clone DH5 alpha-T-aac (3) IV in the step 2 is extracted, and the plasmid pMD18T-aac (3) IV is used as a template, and rcsA-Q600-s and rcsA-H600-a are used as specific primers to amplify the DNA fragment A1. The DNA fragment A1 has at both ends the rcsA gene sequence which serves as homology arm. The middle of the DNA fragment A1 is provided with an enramycin resistance gene aac (3) IV, and the DNA fragment A1 is used for carrying out linear DNA fragment of rcsA gene recombination on chromosome CGMCC1.6366 of Klebsiella pneumoniae.
4) The prepared DNA fragment A1 is transferred into Klebsiella pneumoniae CGMCC1.6366 with pDK-red plasmid by electric shock transformation, and the resistance strain is screened by apramycin, so that the strain with RcsA protein recombined and inactivated on the chromosome of the strain is obtained, the screened resistance strain is named kp-DeltarcsA, and RcsA protein genes of the strain are inactivated by homologous recombination.
5) The prepared DNA fragment A1 was transferred into Klebsiella oxytoca M5A1 carrying pDK-red plasmid by electric shock transformation, and a resistant strain was selected by using apramycin, a strain in which RcsA protein on the chromosome of the strain was recombinantly inactivated was obtained by the selection, the resistant strain obtained by the selection was designated as ko-DeltarcsA, and the RcsA protein gene of the strain was inactivated by homologous recombination.
6) The prepared DNA fragment A1 is transferred into Klebsiella variabilis S12 with pDK-red plasmid by electric shock transformation, and the resistance strain is screened by apramycin, so that the strain with RcsA protein recombined and inactivated on the chromosome of the strain is obtained, the screened resistance strain is named as kv-DeltarcsA, and RcsA protein genes of the strain are inactivated by homologous recombination.
Example 4
The Klebsiella pneumoniae strain with the regulatory protein RcsB gene inactivated in an Rcs signal system is constructed by utilizing a gene recombination method to realize the inactivation of the regulatory protein RcsB activity.
The same procedure as in example 3 was used. The primers used were respectively: rcsB-Q600-s: CCCGGGGATCCTCTAGAGATCGATCACACGCTGCCACTG (SEQ ID No. 15), rcsB-Q600-a: CCTACAGACCCATCCTCAATCAACACGT (SEQ ID No. 16), rcsB-H600-s: TCCCCGGAATAACAAACTGGCGGTGGTCC (SEQ ID No. 17), rcsB-H600-a: CATGCCTGCAGGTCGACGATGGATTTTTTTCGCCCATCG (SEQ ID No. 18), rcsB-FRT-s: ATTGAGGATGGGTCTGTAGGCTGGAGCTGCTTCG (SEQ ID No. 19), rcsB-FRT-a: CCAGTTTGTTATTCCGGGGATCCGTCGA (SEQ ID No. 20).
The DNA fragment A2 was prepared with rcsB gene sequences at both ends, which served as homology arms. The DNA fragment A2 has an enramycin resistance gene aac (3) IV in the middle.
Homologous recombination is carried out by using the DNA fragment A2 and rcsB genes on the chromosome of Klebsiella pneumoniae CGMCC1.6366, and the obtained strain is named kp-DeltarcsB; homologous recombination is carried out on the DNA fragment A2 and the rcsB gene on the chromosome M5a1 of the Klebsiella oxytoca, and the obtained strain is named as ko-delta rcsB; the DNA fragment A2 was used to carry out homologous recombination with the rcsB gene on the S12 chromosome of Klebsiella mutabilis, and the obtained strain was named kv-DeltarcsB.
Example 5
The starting strains Klebsiella pneumoniae CGMCC1.6366, klebsiella acidophilus M5a1, klebsiella mutans S12 and the modified strains obtained in examples 1 and 2 were inoculated into 250ml conical flasks, respectively, which contained 50ml of fermentation medium, while the modified strains in examples 1 and 2 also required addition of IPTG at a final concentration of 1mmol/L at the time of cultivation. The rotation speed of the shaking flask cabinet is 200 revolutions per minute, and fermentation culture is carried out at the constant temperature of 37 ℃.
The culture medium comprises the following components: 30g/L glucose, 4g/L ammonium sulfate, 1.5g/L yeast extract, 0.69g/L dipotassium hydrogen phosphate, 0.25g/L potassium dihydrogen phosphate, 0.2g/L magnesium sulfate, 0.05g/L ferrous sulfate and 0.01g/L manganese sulfate.
After culturing for 24 hours, the extracellular polysaccharide is measured, the fermentation liquid for 24 hours is diluted by proper times, the bacteria are removed by centrifugation, 20ml of the supernatant is taken, 60ml of 95% ethanol is added, and the mixture is uniformly mixed. The polysaccharide was allowed to settle well by standing and centrifuged at 3500rpm/min for 10 minutes, the supernatant was discarded. The precipitate was washed with 75% ethanol until no reducing sugar reaction was observed. And (5) freeze drying and measuring. The measurement results of each strain are shown in tables 1, 2 and 3.
TABLE 1 Klebsiella pneumoniae and experimental results of producing extracellular polysaccharide by modified strain thereof
TABLE 2 Experimental results of production of extracellular polysaccharide by Klebsiella and its modified strain
| Strain | Extracellular polysaccharide (g/L) |
| Klebsiella oxytoca M5a1 | 1.93 |
| ko-(rcsA) | 9.61 |
| ko-(rcsB) | 2.51 |
TABLE 3 Experimental results of production of extracellular polysaccharide by Klebsiella variabilis and its modified strains
| Strain | Extracellular polysaccharide (g/L) |
| Klebsiella varioti S12 | 1.74 |
| kv-(rcsA) | 8.96 |
| kv-(rcsB) | 2.21 |
Extracellular polysaccharide, namely viscous polysaccharide or capsular polysaccharide secreted by microorganisms to the outside of cell walls, is a natural macromolecular biopolymer, is an important component of the current biopolymer market, and shows good development prospect. The measurement results of the extracellular polysaccharide in tables 1, 2 and 3 show that: increasing the expression level of RcsA or RcsB protein can significantly increase the content of bacterial exopolysaccharide. The extracellular polysaccharide contents in the fermentation broths of the kp- (rcsB), ko- (rcsB) and kv- (rcsB) strains were 3.03g/L, 2.51g/L and 2.21g/L, respectively, whereas the extracellular polysaccharide contents in the fermentation broths of the strains kp- (rcsA), ko- (rcsA) and kv- (rcsA) reached 10.33g/L, 9.61g/L and 8.96g/L, respectively. The study finds that: kp- (rcsA), ko- (rcsA) and kv- (rcsA) have the capability of synthesizing a large amount of extracellular polysaccharide, and are strains with the application prospect of industrially producing extracellular polysaccharide.
Example 6
The starting strains Klebsiella pneumoniae CGMCC1.6366, klebsiella acidophilus M5a1, klebsiella mutans bacterium S12 and the modified strains obtained in examples 3 and 4 were inoculated into 250ml conical flasks, respectively, containing 50ml of fermentation medium. The rotation speed of the shaking flask cabinet is 200 revolutions per minute, and fermentation culture is carried out at the constant temperature of 37 ℃.
The culture medium comprises the following components: 30g/L glucose, 4g/L ammonium sulfate, 1.5g/L yeast extract, 0.69g/L dipotassium hydrogen phosphate, 0.25g/L potassium dihydrogen phosphate, 0.2g/L magnesium sulfate, 0.05g/L ferrous sulfate and 0.01g/L manganese sulfate.
After the consumption of glucose, the metabolite 2, 3-butanediol in the fermentation broth was measured by high performance liquid chromatography. High performance liquid chromatography, HPX-87H chromatographic column, parallax and ultraviolet detector, mobile phase 0.005mol/L sulfuric acid water solution, flow rate 0.8ml/min, and column temperature box 65 deg.C. The fermentation results of each strain are shown in tables 4, 5 and 6.
TABLE 4 experimental results of production of 2, 3-butanediol by Klebsiella pneumoniae and its modified strains
| Strain | 2, 3-butanediol (g/L) |
| Klebsiella pneumoniae CGMCC1.6366 | 3.63 |
| kp-ΔrcsA | 4.42 |
| kp-ΔrcsB | 4.62 |
TABLE 5 experimental results of production of 2, 3-butanediol by Klebsiella and its modified strain
| Strain | 2, 3-butanediol (g/L) |
| Klebsiella oxytoca M5a1 | 4.05 |
| ko-ΔrcsA | 4.77 |
| ko-ΔrcsB | 4.82 |
TABLE 6 experimental results of production of 2, 3-butanediol by Klebsiella variabilis and its modified strains
| Strain | 2, 3-butanediol (g/L) |
| Klebsiella varioti S12 | 3.82 |
| ko-ΔrcsA | 4.71 |
| ko-ΔrcsB | 4.32 |
As shown in Table 4, table 5 and Table 6, 2, 3-butanediol was used as the main product of Klebsiella bacteria with glucose as substrate, and the yields in Klebsiella pneumoniae CGMCC1.6366, klebsiella acidophilus M5a1, klebsiella varioti bacillus S12 strains were 3.63g/L, 4.05g/L and 3.82g/L, respectively. The yields of 2, 3-butanediol in the fermentation broths of the strains modified as described in examples 3 and 4 are markedly increased. In Klebsiella pneumoniae, the content of 2, 3-butanediol in the fermentation broths of kp-DeltarcsA and kp-DeltarcsB strains is 4.42g/L and 4.62g/L, the conversion efficiency of glucose into 2, 3-butanediol is 20.0% and 22.4%, and the conversion rate of 2, 3-butanediol in wild bacteria is improved by 27.4% and 42.7% compared with 15.7%. In Klebsiella, the 2, 3-butanediol content in the fermentation broths of the ko- ΔrcsA and ko- ΔrcsB strains was 4.77g/L and 4.82g/L, the conversion efficiency of glucose into 2, 3-butanediol was 19.1% and 19.3%, whereas the conversion rate of 2, 3-butanediol in wild type bacteria was 16.2%, and the conversion rates of 2, 3-butanediol in the ko- ΔrcsA and ko- ΔrcsB strains were increased by 18% and 19.1%, respectively, as compared with wild type bacteria. In Klebsiella variotis, the wild-type bacteria, kv-DeltarcA and kv-DeltarcsB strains produced 3.81g/L, 4.71g/L and 4.32g/L of 2, 3-butanediol, respectively, with 2, 3-butanediol conversions of 15.2%, 18.8% and 17.3%, respectively, and the 2, 3-butanediol conversions in the kv-DeltarcsA and kv-DeltarcsB strains were increased by 23.7% and 13.8% compared to the wild-type bacteria.
Thus, deletion of the genes rcsA and rcsB increases the efficiency of glucose conversion to 2, 3-butanediol.
Example 7
The starting strains Klebsiella pneumoniae CGMCC1.6366, klebsiella acidophilus M5a1, klebsiella mutans bacterium S12 and the modified strains obtained in examples 3 and 4 were inoculated into 250ml conical flasks, respectively, containing 50ml of fermentation medium. The rotation speed of the shaking flask cabinet is 200 revolutions per minute, and fermentation culture is carried out at the constant temperature of 37 ℃.
The culture medium comprises the following components: 30g/L of glycerin, 4g/L of ammonium sulfate, 1.5g/L of yeast extract, 0.69g/L of dipotassium hydrogen phosphate, 0.25g/L of potassium dihydrogen phosphate, 0.2g/L of magnesium sulfate, 0.05g/L of ferrous sulfate and 0.01g/L of manganese sulfate. The method comprises the steps of carrying out a first treatment on the surface of the The prepared culture medium is sterilized at 115 deg.C for 15 min.
After the consumption of glycerol, the metabolite 1, 3-propanediol in the fermentation broth was determined by high performance liquid chromatography as outlined in example 6. The fermentation results of each strain are shown in tables 7, 8 and 9.
TABLE 7 experimental results of production of 1, 3-propanediol by Klebsiella pneumoniae and its modified strains
| Strain | 1, 3-propanediol (g/L) |
| Klebsiella pneumoniae CGMCC1.6366 | 11.36 |
| kp-ΔrcsA | 11.83 |
| kp-ΔrcsB | 11.99 |
TABLE 8 experimental results of production of 1, 3-propanediol by Klebsiella and its modified strain
| Strain | 1, 3-propanediol (g/L) |
| Klebsiella oxytoca M5a1 | 10.71 |
| ko-ΔrcsA | 11.36 |
| ko-ΔrcsB | 11.61 |
TABLE 9 experimental results of production of 1, 3-propanediol by Klebsiella variabilis and its modified strains
| Strain | 1, 3-propanediol (g/L) |
| Klebsiella varioti S12 | 10.51 |
| ko-ΔrcsA | 11.63 |
| ko-ΔrcsB | 11.02 |
As shown in Table 7, in Klebsiella pneumoniae, 11.36g/L, 11.83g/L and 11.99g/L of 1, 3-propanediol can be produced in wild-type bacteria, kp- ΔrcsA and kp- ΔrcsB strains, respectively, and the conversion efficiency of glycerol into 1, 3-propanediol is 37.0%, 38.9% and 39.9%, respectively. In Klebsiella acidogenic bacteria, 10.71g/L, 11.36g/L and 11.61g/L of 1, 3-propanediol can be produced in wild-type, ko- ΔrcsA and ko- ΔrcsB strains, respectively, the conversion efficiency of glycerol into 1, 3-propanediol is 35.7%, 37.8% and 38.7%, respectively, and in Klebsiella acidogenic bacteria, 10.51g/L, 11.63g/L and 11.02g/L of 1, 3-propanediol can be produced in wild-type, kv- ΔrcsA and kv- ΔrcsB strains, respectively, and the conversion efficiency of glycerol into 1, 3-propanediol is 35.0%, 38.8% and 36.7%, respectively. Thus, in Klebsiella bacteria, both gene rcsA and gene rcsB deletions result in an increased conversion of 1, 3-propanediol.
Example 8
The starting strains Klebsiella pneumoniae CGMCC1.6366, klebsiella acidogenic bacterium M5a1, klebsiella mutans bacterium S12 and the modified strains obtained in examples 3 and 4 were made into competent cells, respectively, and were transformed into pBECkp-spe plasmid by electric shock, which had spectinomycin resistance markers, comprising the following steps:
1) The strain was inoculated into a liquid LB medium tube to prepare electrotransduced competent cells.
2) 50. Mu.L of freshly prepared competent cells was added to plasmid pBECkp-spe and subjected to electrotransformation.
3) The bacterial liquid after electric transformation is properly diluted and coated on a plate containing spectinomycin resistance, and is cultured overnight at 37 ℃, and the colony number is counted and the transformation efficiency is calculated on the next day. The conversion efficiency was calculated as the ratio of the number of colonies grown on the resistant plate to the corresponding amount of DNA added.
The transformation efficiencies of the respective strains are shown in tables 10, 11 and 12.
TABLE 10 electric shock conversion efficiency test results of Klebsiella pneumoniae and modified strain thereof
| Strain | Conversion efficiency (CFU/. Mu.g DNA) |
| Klebsiella pneumoniae CGMCC1.6366 | 3.6×10 4 |
| kp-ΔrcsA | 7.6×10 4 |
| kp-ΔrcsB | 1.1×10 5 |
TABLE 11 electric shock conversion efficiency test results of Klebsiella oxytoca and modified strains thereof
| Strain | Conversion efficiency (CFU/. Mu.g DNA) |
| Klebsiella oxytoca M5a1 | 7.2×10 4 |
| ko-ΔrcsA | 4.4×10 5 |
| ko-ΔrcsB | 5.0×10 5 |
Table 12, results of electric shock transformation efficiency experiments on Klebsiella variabilis and its modified strain
As shown in tables 10, 11 and 12, there was a difference in exogenous transformation efficiency in Klebsiella bacteria in which the wild-type bacterium and the rcsA and rcsB genes were deleted, respectively. Taking Klebsiella pneumoniae as an example, the transformation efficiencies of wild bacteria, kp- ΔrcsA and kp- ΔrcsB are 3.6X10, respectively 4 、7.6×10 4 And 1.1X10 5 CFU/. Mu.g DNA. Thus, in klebsiella bacteria, the knockdown of the rcsA and rcsB genes increases the conversion rate of the exogenous gene.
The foregoing is only a part of the preferred embodiments of the present invention, and the present invention is not limited to the contents of the embodiments. It will be apparent to those skilled in the art that various changes and modifications can be made within the scope of the technical solution of the present invention, and any changes and modifications are within the scope of the present invention.
Sequence listing
<110> Shanghai higher institute of China academy of sciences
<120> Klebsiella bacteria engineered into Rcs signal system and use thereof
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 624
<212> DNA
<213> Klebsiella pneumoniae342 (Klebsiella pneumoniae 342)
<400> 1
tcaacgcaga ttcacctgaa tacctgaagt tacgttttcg gtcagccgaa cgatatggta 60
aatcacctgc ttattgtgcg tttgtatttt ctttttaata ttgcctttat gcgatgatac 120
cgtcttcgct ttgatgttca tttgcgttga aatttgtgac gtgccgtgcc cggccatcca 180
catttgcagc atatttgatt ctgttttact cagcgacaac gtcggtaaat ttaattgccc 240
caaactgcta tttttgtatt ttagataatt aaccagaata acatcaaggt cttttggcgt 300
tatcgatttc gaactgatca gcaggttttt ccgtacccgc aaatagcggt caaaatgaat 360
gtttgccagc gacataaaga taacaaacag cgtcgccggg ttttgcgtaa tgatctggcg 420
aataatgcca ttactttcat catcatgcac gaagcagtct tcattaagaa acaccactgc 480
cggacaacac gacgcgcaat gtttttgcaa atctgtcgcg caatggacct caacgatttc 540
ctgttttttt attccccgac tggtcagata acccgttaag cctaaccggg tataactgca 600
caaatccata atcatcgttg acat 624
<210> 2
<211> 651
<212> DNA
<213> Klebsiella pneumoniae342 (Klebsiella pneumoniae 342)
<400> 2
ttactcttta tccgtcgaac tcagcgagac ggaggagaga tagttcagca gcgcaatgtc 60
gttttccacg cccagcttca tcattgccga cttcttctgg ctactgatgg ttttgatgct 120
gcggttgagc tttttggcga tctcggtcac caggaagcct tcagcgaaca gacgcagcac 180
ttcgctctct ttcggcgaca ggcgtttatc gccatagccg ctggcgctga ttttttccag 240
cagacgagag acgctttccg gtgtgaattt cttccctttc tgcagcgcgg ccagcgcttt 300
tggcaggtcg gtcggcgctc cttgcttgag aacgatccct tcgatatcca aatccagcac 360
cgcgctgagg atcgccgggt tgttgttcat ggtcagaaca atgatcgaca gatccgggaa 420
gtggcgcttg atgtatttaa tcagcgtgat cccgtcgccg tatttatcac cgggcatgga 480
cagatcggtg atcagcacat gggcgtccag cttcggaaga ttgttgataa gggccgtgga 540
gtcttcaaac tcgccaacga cgttcaccca ctcaatttgc tcaagtgact tacgaatacc 600
gaacagtacg atcggatggt catcggcaat aattacgttc atagtgttca t 651
<210> 3
<211> 47
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tccgccaaaa cagccaagct tatgtcaacg atgattatgg atttgtg 47
<210> 4
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ttcacacagg aaacagaatt ctcagcgtag attcacctga atacc 45
<210> 5
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
tccgccaaaa cagccaagct tatgaacact atgaacgtaa ttattgcc 48
<210> 6
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ttcacacagg aaacagaatt cttactcttt gtccgtcgcg c 41
<210> 7
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cccggggatc ctctagagat cgatcacacg ctgccactg 39
<210> 8
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
cctacagacc catcctcaat caacacgt 28
<210> 9
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
tccccggaat aacaaactgg cggtggtcc 29
<210> 10
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
catgcctgca ggtcgacgat ggattttttt cgcccatcg 39
<210> 11
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
attgaggatg ggtctgtagg ctggagctgc ttcg 34
<210> 12
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
ccagtttgtt attccgggga tccgtcga 28
<210> 13
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
atcgtcgacc tgcaggca 18
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
atctctagag gatccccggg t 21
<210> 15
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
cccggggatc ctctagagat cgatcacacg ctgccactg 39
<210> 16
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
cctacagacc catcctcaat caacacgt 28
<210> 17
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
tccccggaat aacaaactgg cggtggtcc 29
<210> 18
<211> 39
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
catgcctgca ggtcgacgat ggattttttt cgcccatcg 39
<210> 19
<211> 34
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
attgaggatg ggtctgtagg ctggagctgc ttcg 34
<210> 20
<211> 28
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
ccagtttgtt attccgggga tccgtcga 28
Claims (4)
1. A method for producing 1, 3-propanediol by an engineered klebsiella bacterium, comprising: the modified Klebsiella bacteria are bacteria for inactivating a transcription regulatory protein RcsA or a regulatory protein RcsB in an Rcs signal system.
2. A method of producing 1, 3-propanediol from the engineered klebsiella bacterium of claim 1, the method comprising: inoculating the modified klebsiella bacteria of claim 1 into a culture medium with glycerol as a main carbon source for fermentation culture, and fermenting to produce the 1, 3-propanediol.
3. A method for producing 2, 3-butanediol by using an engineered klebsiella bacterium, which is characterized by comprising the steps of: the modified Klebsiella bacteria are bacteria for inactivating a transcription regulatory protein RcsA or a regulatory protein RcsB in an Rcs signal system.
4. A method of producing 2, 3-butanediol from the engineered klebsiella bacteria of claim 3, the method comprising: inoculating the modified Klebsiella bacteria of claim 3 into a culture medium with saccharides such as glucose as a carbon source for fermentation culture, and fermenting to produce 2, 3-butanediol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010420345.8A CN113684160B (en) | 2020-05-18 | 2020-05-18 | Klebsiella bacteria for modifying Rcs signal system and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010420345.8A CN113684160B (en) | 2020-05-18 | 2020-05-18 | Klebsiella bacteria for modifying Rcs signal system and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113684160A CN113684160A (en) | 2021-11-23 |
| CN113684160B true CN113684160B (en) | 2023-09-26 |
Family
ID=78575523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010420345.8A Active CN113684160B (en) | 2020-05-18 | 2020-05-18 | Klebsiella bacteria for modifying Rcs signal system and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113684160B (en) |
-
2020
- 2020-05-18 CN CN202010420345.8A patent/CN113684160B/en active Active
Non-Patent Citations (7)
| Title |
|---|
| KIRK L. McCALLUM等.The rcsA Gene of Klebsiella pneumoniae O1:K20 Is Involved in Expression of the Serotype-Specific K (Capsular) Antigen..《INFECTION AND IMMUNITY》.1991,494-502. * |
| Molecular cloning, expression and nucleotide sequence of the rcsA gene of Erwinia amylovora, encoding a positive regulator of capsule expression: evidence for a family of related capsule activator proteins.;M Coleman等;《J Gen Microbiol》;19900930;1799-1806 * |
| Rcs 信号系统对克雷伯氏肺炎杆菌荚膜合成的影响;孙少琦 等;《过程工程学报》;20200521;230-239 * |
| The rcsA Gene of Klebsiella pneumoniae O1:K20 Is Involved in Expression of the Serotype-Specific K (Capsular) Antigen.;KIRK L. McCALLUM等;《INFECTION AND IMMUNITY》;19910228;494-502 * |
| 刘情.产1，3-丙二醇克雷伯氏菌荚膜多糖合成弱化研究.中国优秀硕士学位论文全文数据 工业科技I辑.2018,摘要，第3-4页第1.2.2节，引用文献31. * |
| 周锡鹏等.肺炎克雷伯菌突变株ΔrcsB 的构建及其菌株超粘性与生物膜表型.第三军医大学学报.2016,摘要. * |
| 秦加阳等.一种简单的高产2,3-丁二醇发酵生产方法.生物加工过程.2005,摘要. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113684160A (en) | 2021-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112322565B (en) | Method for improving yield of 2' -fucosyllactose in recombinant escherichia coli | |
| US20230279456A1 (en) | Genetically Engineered Bacteria Producing Lacto-N-neotetraose and Production Method Thereof | |
| CN105368766B (en) | One plant of method for producing the genetic engineering bacterium of pentanediamine and its preparing pentanediamine | |
| CN112359005B (en) | Escherichia coli engineering bacterium with improved acid stress capability and application thereof | |
| US11732279B2 (en) | Method AMD strains for reducing byproduct fumaric acid in fermentation process of L-malic acid and use thereof | |
| US11970723B2 (en) | Strain producing D-allulose 3-epimerase and application thereof | |
| US11655488B1 (en) | Method and strains for reducing byproduct succinic acid in fermentation process of L-malic acid and use thereof | |
| CN104046586B (en) | One strain gene engineering bacterium and the application in producing (2R, 3R)-2,3-butanediol thereof | |
| CN114480465A (en) | Bacillus subtilis for producing 2' -fucosyllactose and application thereof | |
| CN113073074B (en) | Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof | |
| CN112442471B (en) | Escherichia coli engineering bacterium with strong acid stress resistance and application thereof | |
| CN108315289B (en) | Method for improving yield of glycolic acid in escherichia coli | |
| CN104894043A (en) | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof | |
| CN113234699A (en) | Alpha-1, 2-fucosyltransferase and application thereof | |
| CN113684160B (en) | Klebsiella bacteria for modifying Rcs signal system and application thereof | |
| WO2023115997A1 (en) | Recombinant corynebacterium glutamicum for producing isomaltulose, and application thereof | |
| CN112391329A (en) | Escherichia coli engineering bacterium with improved acid stress resistance and application thereof | |
| CN111172128A (en) | application of sucrose phosphorylase in preparation of 2-O- α -D-glucosyl-L-ascorbic acid | |
| CN114736918B (en) | Recombinant escherichia coli for producing salidroside by integrated expression and application thereof | |
| CN110055201A (en) | A kind of construction method of the recombined bacillus subtilis of high yield hyaluronic acid oligosaccharide | |
| CN112391330B (en) | Method for improving acid stress resistance of recombinant escherichia coli | |
| CN114806991A (en) | Engineering escherichia coli for improving yield of fucosyllactose and production method | |
| CN113528495A (en) | Bacillus subtilis for stably expressing chitobiose deacetylase and construction method and application thereof | |
| CN116064352A (en) | Construction method and application of Klebsiella engineering bacteria for high yield of 1, 3-propanediol | |
| CN112391331B (en) | Recombinant escherichia coli for overexpression of GatA gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |