CN113683666B - Engineering bacterium obtained by YH66-RS07020 gene modification and application thereof in valine preparation - Google Patents

Abstract

The present invention discloses an engineered bacterium obtained by genetic modification of YH66-RS07020 and its application in the preparation of valine. The present invention provides an application of a substance for inhibiting the expression of YH66-RS07020 gene or a substance for reducing the abundance of YH66-RS07020 protein or a substance for reducing the activity of YH66-RS07020 protein in increasing the valine production of bacteria. The present invention finds that the YH66-RS07020 protein has a negative regulation on the valine production of bacteria, that is, the YH66-RS07020 protein content increases and the valine production decreases, and the YH66-RS07020 protein content decreases and the valine production increases. Inhibiting the expression of YH66-RS07020 gene can increase the valine production, and overexpressing the YH66-RS07020 gene reduces the valine production. Further, the present invention discovers the YH66-RS07020 ^C251T protein and its encoding gene and application. The present invention has great application value for the industrial production of valine.

Description

The engineered bacteria obtained by YH66-RS07020 genetic modification and its application in the preparation of valine

Technical Field

The invention belongs to the field of biotechnology and relates to an engineered bacterium obtained by genetically modifying YH66-RS07020 and application thereof in preparing valine, and specifically the modification is C251T.

Background Art

Valine is one of the 20 amino acids that make up protein. It is one of the 8 essential amino acids and glycogenic amino acids for the human body. It works with two other high-concentration amino acids (isoleucine and leucine) to promote normal growth, repair tissues, regulate blood sugar, and provide the necessary energy. When participating in intense physical activities, valine can provide muscles with extra energy to produce glucose to prevent muscle weakness. Valine also helps remove excess nitrogen (potential toxins) from the liver and transports nitrogen needed by the body to various parts.

Valine is an essential amino acid, which means that the body cannot produce it on its own and must be supplemented through dietary sources. Its natural food sources include grains, dairy products, shiitake mushrooms, mushrooms, peanuts, soy protein and meat. Although most people can get enough from their diet, cases of valine deficiency are not uncommon. When valine is insufficient, the function of the central nervous system of the brain will be disordered, and ataxia and tremors of the limbs will occur. Through the dissection of brain tissue, it was found that there was red nuclear cell degeneration. Patients with advanced cirrhosis are prone to hyperinsulinemia due to liver damage, which leads to a decrease in branched-chain amino acids in the blood. The ratio of branched-chain amino acids to aromatic amino acids drops from 3.0-3.5 in normal people to 1.0-1.5. Therefore, injections of branched-chain amino acids such as valine are often used to treat liver failure and damage to these organs caused by alcoholism and drug abuse. In addition, valine can also be used as a therapeutic agent to accelerate wound healing. L-valine, also known as 2-amino-3-methylbutyric acid, has a CAS number of 72-18-4, an MDL number of MFCD00064220, and an EINECS number of 200-773-6. Currently, L-valine is mainly prepared by chemical synthesis. The limitations of chemical synthesis include high production costs, complex reactions, multiple steps, and many by-products.

Summary of the invention

The purpose of the present invention is to provide an engineered bacterium obtained by genetic modification of YH66-RS07020 and its application in the preparation of valine.

The present invention provides the use of a substance for inhibiting the expression of the YH66-RS07020 gene or a substance for reducing the abundance of the YH66-RS07020 protein or a substance for reducing the activity of the YH66-RS07020 protein;

The application is as follows (I) or (II) or (III):

(Ⅰ) Application in increasing bacterial valine production;

(II) Application in the production of valine;

(III) Application in increasing bacterial count.

The YH66-RS07020 gene is a gene encoding the YH66-RS07020 protein.

The YH66-RS07020 protein is as follows (a1) or (a2) or (a3):

(a1) the protein shown in Sequence 3 of the Sequence Listing;

(a2) a protein derived from bacteria that has more than 95% identity with (a1) and is associated with bacterial valine production;

(a3) A protein derived from (a1) which is related to bacterial valine production and is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the protein shown in (a1).

The term "identity" as used herein refers to sequence similarity to a natural amino acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

Specifically, the YH66-RS07020 gene is as follows (b1) or (b2) or (b3):

(b1) a DNA molecule whose coding region is as shown in Sequence 4 of the Sequence Listing;

(b2) a DNA molecule derived from bacteria and having more than 95% identity with (b1) and encoding the protein;

(b3) A DNA molecule that hybridizes with (b1) under stringent conditions and encodes the protein.

The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

The stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

The inhibition of YH66-RS07020 gene expression may be knocking out the YH66-RS07020 gene or mutating the YH66-RS07020 gene.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be a DNA molecule shown in Sequence 5 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be a DNA molecule shown in Sequence 8 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the recombinant plasmid pK18-YH66-RS07020 ^C251T or the recombinant plasmid pK18-ΔYH66-RS07020 in the examples.

The present invention also provides a recombinant bacterium obtained by inhibiting the expression of the YH66-RS07020 gene in the bacterium.

The inhibition of YH66-RS07020 gene expression in bacteria may be performed by knocking out the YH66-RS07020 gene in bacteria, or by mutating the YH66-RS07020 gene in bacteria.

The knockout may be a partial segment of a knockout gene, or the entire coding frame of a knockout gene.

Exemplarily, knocking out the YH66-RS07020 gene in bacteria may specifically include: deleting the DNA molecule shown in Sequence 4 of the sequence list from the bacterial genomic DNA.

For mutating the YH66-RS07020 gene in bacteria, a person skilled in the art can easily adopt known methods, such as targeted mutagenesis or gene editing.

Exemplarily, the YH66-RS07020 gene in the mutated bacteria can be specifically mutated such that the codon for the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA is mutated from a codon encoding A to a codon encoding other amino acid residues. Specifically, the other amino acid residue is V.

Exemplarily, the YH66-RS07020 gene in the mutated bacteria may be specifically caused by causing the following point mutation to occur in the YH66-RS07020 gene in the bacterial genomic DNA: the 251st nucleotide is mutated from C to other nucleotides (specifically T).

Exemplarily, the method of inhibiting the expression of the YH66-RS07020 gene in bacteria may be: introducing a substance for inhibiting the expression of the YH66-RS07020 gene into the bacteria.

The substance used to inhibit the expression of the YH66-RS07020 gene can specifically be a DNA molecule shown in Sequence 5 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be a DNA molecule shown in Sequence 8 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the recombinant plasmid pK18-YH66-RS07020 ^C251T or the recombinant plasmid pK18-ΔYH66-RS07020 in the examples.

The present invention also protects the use of the recombinant bacteria in preparing valine.

The present invention also protects a method for preparing valine, comprising the following steps: fermenting the recombinant bacteria.

Those skilled in the art can use the fermentation method in the prior art for fermentation. The fermentation method can also be optimized and improved by conventional experiments. The fermentation of bacteria can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium may contain: a carbon source, a nitrogen source, trace elements, and a combination thereof. During the culture, the pH of the culture can be adjusted. In addition, the culture may include preventing the generation of bubbles, such as by using a defoamer to prevent the generation of bubbles. In addition, the culture may include injecting gas into the culture. The gas may include any gas capable of maintaining aerobic conditions of the culture. During the culture, the temperature of the culture may be 20 to 45°C.

The method may further comprise the step of obtaining valine from the culture. The valine may be obtained from the culture by various methods, including but not limited to treating the culture with sulfuric acid or hydrochloric acid, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization and isoelectric precipitation.

In the fermentation, the formula of the exemplary fermentation medium is shown in Table 3, and the balance is water.

In the fermentation, exemplary fermentation control processes are shown in Table 4.

Exemplarily, during the fermentation, at the initial moment of completing the inoculation, the OD value of the system may be 0.3-0.5.

Exemplarily, during the fermentation process: ammonia water is used to adjust the pH; when there is foam in the fermentation system, an appropriate amount of antifoam (CB-442) is added; and the sugar content (residual sugar) of the system is controlled by adding 70% glucose aqueous solution.

The present invention also provides a method for increasing the valine production of bacteria, comprising the following steps: inhibiting the expression of the YH66-RS07020 gene in the bacteria or reducing the abundance of the YH66-RS07020 protein in the bacteria or reducing the activity of the YH66-RS07020 protein in the bacteria.

The inhibition of YH66-RS07020 gene expression in bacteria may be performed by knocking out the YH66-RS07020 gene in bacteria, or by mutating the YH66-RS07020 gene in bacteria.

The knockout may be a partial segment of a knockout gene, or the entire coding frame of a knockout gene.

Exemplarily, knocking out the YH66-RS07020 gene in bacteria may specifically include: deleting the DNA molecule shown in Sequence 4 of the sequence list from the bacterial genomic DNA.

For mutating the YH66-RS07020 gene in bacteria, a person skilled in the art can easily adopt known methods, such as targeted mutagenesis or gene editing.

Exemplarily, the YH66-RS07020 gene in the mutated bacteria can be specifically mutated such that the codon for the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA is mutated from a codon encoding A to a codon encoding other amino acid residues. Specifically, the other amino acid residue is V.

Exemplarily, the YH66-RS07020 gene in the mutated bacteria may be specifically caused by causing the following point mutation to occur in the YH66-RS07020 gene in the bacterial genomic DNA: the 251st nucleotide is mutated from C to other nucleotides (specifically T).

Exemplarily, the method of inhibiting the expression of the YH66-RS07020 gene in bacteria may be: introducing a substance for inhibiting the expression of the YH66-RS07020 gene into the bacteria.

The substance used to inhibit the expression of the YH66-RS07020 gene can specifically be a DNA molecule shown in Sequence 5 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be a DNA molecule shown in Sequence 8 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the sequence listing.

Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the recombinant plasmid pK18-YH66-RS07020 ^C251T or the recombinant plasmid pK18-ΔYH66-RS07020 in the examples.

The present invention also protects the application of the YH66-RS07020 protein in regulating the valine production of bacteria.

The regulation is negative regulation, that is, the protein content of YH66-RS07020 increases and the valine production decreases.

The regulation is negative regulation, that is, the protein content of YH66-RS07020 is reduced and the valine production is increased.

The present invention also protects the application of the YH66-RS07020 protein in regulating the bacterial quantity.

The regulation is negative regulation, that is, the YH66-RS07020 protein content increases and the bacterial count decreases.

The regulation is negative regulation, that is, the YH66-RS07020 protein content is reduced and the bacterial count is increased.

The present invention also protects a mutant protein named as YH66-RS07020 ^C251T protein, which is obtained by mutating the 84th amino acid residue of the YH66-RS07020 protein from A to other amino acid residues.

Specifically, the other amino acid residue is V.

Exemplarily, the mutant protein is shown in Sequence 1 of the Sequence Listing.

The present invention also protects the gene encoding the YH66-RS07020 ^C251T protein (named as the YH66-RS07020 ^C251T gene).

The present invention also protects an expression cassette having the YH66-RS07020 ^C251T gene, a recombinant vector having the YH66-RS07020 ^C251T gene, or a recombinant bacterium having the YH66-RS07020 ^C251T gene.

Specifically, the YH66-RS07020 ^C251T gene is as follows (c1) or (c2) or (c3):

(c1) a DNA molecule whose coding region is as shown in Sequence 2 of the Sequence Listing;

(c2) a DNA molecule derived from bacteria and having more than 95% identity with (c1) and encoding the protein;

(c3) A DNA molecule that hybridizes with (c1) under stringent conditions and encodes the protein.

The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

The stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

The present invention also protects the use of the YH66-RS07020 ^C251T protein, the YH66-RS07020 ^C251T gene, an expression cassette having the YH66-RS07020 ^C251T gene, a recombinant vector having the YH66-RS07020 ^C251T , or a recombinant bacterium having the YH66-RS07020 ^C251T in the preparation of valine.

The present invention also protects a method for increasing the valine production of bacteria, comprising the following steps: mutating the codon of the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA from a codon encoding A to a codon encoding other amino acid residues.

Specifically, the other amino acid residue is V.

The method specifically comprises the following steps: causing the YH66-RS07020 gene in the bacterial genomic DNA to undergo the following point mutation: the 251st nucleotide is mutated from C to other nucleotides (specifically T).

The method specifically comprises the following steps: introducing the DNA molecule shown in Sequence 5 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the sequence listing into bacteria.

Any of the above bacteria include, but are not limited to, the following: Corynebacterium bacteria, preferably Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, and Brevibacterium thiogenitalis.

Any of the above-mentioned bacteria is a bacterium capable of producing valine.

The term "bacteria having the ability to produce valine" means that the bacteria have the ability to produce and accumulate valine in a culture medium and/or in bacterial cells. Thus, valine can be collected when the bacteria are cultured in a culture medium.

The bacteria may be wild-type bacteria collected naturally or modified bacteria.

"Modified bacteria" refers to modified bacteria obtained by artificially mutating and/or inducing mutations in naturally collected wild-type bacteria.

Specifically, the Corynebacterium glutamicum may be Corynebacterium glutamicum CGMCC21260.

Corynebacterium glutamicum YPFV1 was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on November 30, 2020, with the deposit registration number CGMCC No. 21260. Corynebacterium glutamicum YPFV1, also known as Corynebacterium glutamicum CGMCC21260.

Any of the above valine means valine in a broad sense, including free valine, valine salts or a mixture of the two.

Specifically, the valine is L-valine.

Any of the above methods or applications can also be used for the preparation of downstream products of valine.

The YH66-RS07020 protein in Corynebacterium glutamicum is shown in Sequence 3 of the sequence table, and its encoding gene is shown in Sequence 4 of the sequence table. In the present invention, the YH66-RS07020 ^C251T protein shown in Sequence 1 of the sequence table is obtained by introducing point mutations, and the encoding gene of the YH66-RS07020 ^C251T protein is shown in Sequence 2 of the sequence table. Compared with the YH66-RS07020 gene, the difference of the YH66-RS07020 ^C251T gene is that the 251st nucleotide is mutated from C to T. Compared with the YH66-RS07020 protein, the difference of the YH66-RS07020 ^C251T protein is that the 84th amino acid residue is mutated from A to V.

The present invention finds that the YH66-RS07020 protein has a negative regulation on the valine production of bacteria, that is, the YH66-RS07020 protein content increases and the valine production decreases, and the YH66-RS07020 protein content decreases and the valine production increases. Inhibiting the expression of the YH66-RS07020 gene can increase the valine production, and overexpressing the YH66-RS07020 gene reduces the valine production. Further, the present invention finds the YH66-RS07020 ^C251T protein and its encoding gene and application. The present invention has great application value for the industrial production of valine.

DETAILED DESCRIPTION

The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. pK18mobsacB plasmid: Addgene Company; pK18mobsacB plasmid has a kanamycin resistance gene as a screening marker. pXMJ19 plasmid: BioVector plasmid vector strain cell gene collection center; pXMJ19 plasmid has a chloramphenicol resistance gene as a screening marker. NEBuilder enzyme: NEB Company. Unless otherwise specified, the culture medium in the examples is the culture medium with the formula in Table 1 (the balance is water, and the pH is 7.0). The culture medium without kanamycin is the culture medium shown in Table 1. The culture medium containing kanamycin is composed of the culture medium shown in Table 1 and kanamycin, and the content of kanamycin is 50μg/ml. Unless otherwise specified, the culture in the examples refers to static culture at 32°C. The single-strand conformational polymorphism polyacrylamide gel electrophoresis (sscp-PAGE) in the embodiment: the gel concentration used is 8%, and the composition of the electrophoresis gel is shown in Table 2; the electrophoresis conditions are: using 1×TBE buffer, 120V voltage, and electrophoresis time 10h.

Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

Table 1

Components Concentration in culture medium sucrose 10g/L Polypeptone 10g/L Beef extract 10g/L Yeast powder 5g/L Urea 2g/L Sodium chloride 2.5g/L Agar powder 20g/L

Table 2

Components Addition amount 40% Acrylamide 8mL _ddH2O 26mL glycerin 4mL 10×TBE 2mL TEMED 40μL 10% AP 600μL

Example 1. Acquisition of Corynebacterium glutamicum CGMCC21260

Corynebacterium glutamicum ATCC15168: Corynebacterium glutamicum with ATCC number 15168.

Corynebacterium glutamicum ATCC15168 was mutated to obtain Corynebacterium glutamicum YPFV1.

Corynebacterium glutamicum YPFV1 was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on November 30, 2020, with the deposit registration number CGMCC No. 21260. Corynebacterium glutamicum YPFV1, also known as Corynebacterium glutamicum CGMCC21260.

Example 2: Construction of recombinant bacteria YPV-013

P1: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AACGCCCGCATCGAAGACCT-3';

P2: 5'-GCCGTAGTCCATGAGTACCCAGACGGCGTGCTCG-3';

P3: 5'-CGAGCACGCCGTCTGGGTACTCATGGACTACGGC-3';

P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ATCCTAGAGGGGCACTTTTC-3'.

P5: 5'-CGGACTGTTTTCCAACTGGC-3';

P6: 5'-CCGGGGTTTGTTCCATGAGC-3'.

1. Construction of recombinant plasmid

1. Using Corynebacterium glutamicum ATCC15168 as a template, a primer pair consisting of primer P1 and primer P2 was used for PCR amplification, and the amplified product (674 bp) was recovered.

2. Using Corynebacterium glutamicum ATCC15168 as a template, a primer pair consisting of primer P3 and primer P4 was used for PCR amplification, and the amplified product (674 bp) was recovered.

3. The amplified product recovered in step 1 and the amplified product recovered in step 2 were used as templates to perform PCR amplification (Overlap PCR) using a primer pair consisting of primer P1 and primer P4 to recover the amplified product (1314 bp). The amplified product was sequenced as shown in Sequence 5 of the sequence table.

4. Take the pK18mobsacB plasmid, use the restriction endonuclease Xba I for single digestion, and recover the linearized plasmid.

5. The amplified product recovered in step 3 was co-incubated with the linearized plasmid recovered in step 4 (using NEBuilder enzyme, incubated at 50°C for 30 min) to obtain the recombinant plasmid pK18-YH66-RS07020 ^C251T . Sequencing verification showed that the recombinant plasmid pK18-YH66-RS07020 ^C251T contained the DNA molecule shown in sequence 5 of the sequence table.

2. Construction of recombinant bacteria YPV-013

1. The recombinant plasmid pK18-YH66-RS07020 ^C251T was used to electroporate Corynebacterium glutamicum CGMCC21260, and then cultured.

2. Pick the strain in step 1, culture it in a medium containing 15% sucrose, then pick a single colony, culture it in a medium containing kanamycin and a medium without kanamycin, and screen the strain that cannot grow on the medium containing kanamycin but can grow on the medium without kanamycin.

3. Take the strain screened in step 2, use the primer pair consisting of primer P5 and primer P6 to perform PCR amplification, and then recover the amplified product (278 bp).

4. Take the amplified product of step 3, denature at 95°C for 10 min and then ice bath for 5 min, and then perform sscp-PAGE. During electrophoresis, the amplified fragment of the recombinant plasmid pK18-YH66-RS07020 ^C251T (i.e., the amplified product of PCR amplification using the recombinant plasmid pK18-YH66-RS07020 ^C251T as a template and the primer pair consisting of primers P5 and P6) is used as a positive control, the amplified fragment of Corynebacterium glutamicum CGMCC21260 (i.e., the amplified product of PCR amplification using the primer pair consisting of primers P5 and P6) is used as a negative control, and water is used as a blank control. Due to different fragment structures and different electrophoresis positions, the strains whose electrophoresis positions are inconsistent with the negative control and consistent with the positive control are the target strains for screening (recombinant strains with successful allelic replacement).

5. According to the result of step 4, the amplified product of step 3 of the strain obtained by screening is sequenced and verified to obtain recombinant bacteria YPV-013. Compared with Corynebacterium glutamicum CGMCC21260, the difference of recombinant bacteria YPV-013 is only that the YH66-RS07020 gene shown in sequence 4 of the sequence table in the genome of Corynebacterium glutamicum CGMCC21260 is replaced by the YH66-RS07020 ^C251T gene shown in sequence 2 of the sequence table. There is only one nucleotide difference between sequence 2 and sequence 4, which is located at the 251st position. Recombinant bacteria YPV-013 is an engineering strain obtained by mutating the YH66-RS07020 gene in Corynebacterium glutamicum CGMCC21260 (single point mutation).

Example 2: Construction of recombinant bacteria YPV-015 and YPV-014

P7: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CATGACGGCTGACTGGACTC-3';

P8: 5'-TGAAATGTAAGATTCAAAGAAATCGGACTCCTTAAATGGG-3';

P9: 5'-CCCATTTAAGGAGTCCGATTTCTTTGAATCTTACATTTCA-3';

P10: 5'-TGGGTGGTAAATTTTTCCATGGAACTCACCGTCCTTACAG-3';

P11: 5'-CTGTAAGGACGGTGAGTTCCATGGAAAAATTTACCACCCA-3';

P12: 5'-CTATGTGAGTAGTCGATTTATTAAGCGTTAGTGCGTGGCT-3';

P13: 5'-AGCCACGCACTAACGCTTAATAAATCGACTACTCACATAG-3';

P14: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TGCATAAGAAACAACCACTT-3'.

P15: 5'-GTCCGCTCTGTTGGTGTTCA-3';

P16: 5'-AGAAGTTCGATGTCGGACTG-3'.

P17: 5'-CCAACGTGGACACCGACCAG-3';

P18: 5'-TGGAGGAATATTCGGCCCAG-3'.

1. Construction of recombinant bacteria YPV-015

1. Using the recombinant bacteria YPV-013 as a template, a primer pair consisting of primers P7 and P8 was used for PCR amplification, and the amplified product (806 bp) was recovered.

2. Using the recombinant bacteria YPV-013 as a template, a primer pair consisting of primer P9 and primer P10 was used for PCR amplification, and the amplified product (293 bp) was recovered.

3. Using the recombinant bacteria YPV-013 as a template, PCR amplification was performed using a primer pair consisting of primer P11 and primer P12, and the amplified product (634 bp) was recovered.

4. Using the recombinant bacteria YPV-013 as a template, a primer pair consisting of primer P13 and primer P14 was used for PCR amplification, and the amplified product (783 bp) was recovered.

5. Take the pK18mobsacB plasmid, use the restriction endonuclease Xba I for single digestion, and recover the linearized plasmid.

6. The amplified product recovered in step 1, the amplified product recovered in step 2, the amplified product recovered in step 3, the amplified product recovered in step 4 and the linearized plasmid recovered in step 5 were co-incubated (using NEBuilder enzyme, incubated at 50° C. for 30 min) to obtain recombinant plasmid 015. Sequencing verification showed that the recombinant plasmid 015 contained the DNA molecule shown in sequence 6 of the sequence table.

7. The recombinant plasmid 015 was used to electroporate the Corynebacterium glutamicum CGMCC21260, and then cultured. Then, each single colony was identified by PCR (using a primer pair consisting of primers P15 and P16). The strain that could amplify a 1454 bp band was a positive strain.

8. Pick the positive strain in step 7, culture it in a medium containing 15% sucrose, then pick a single colony, culture it in a medium containing kanamycin and a medium without kanamycin, and screen the strain that cannot grow on the medium containing kanamycin but can grow on the medium without kanamycin.

9. Take the strain screened in step 8, use the primer pair consisting of primer P17 and primer P18 to perform PCR amplification, and the strain that amplifies the 1335bp band is a positive strain in which the YH66-RS07020 ^C251T gene is integrated into the genome of Corynebacterium glutamicum CGMCC21260, and it is named recombinant strain YPV-015. Recombinant strain YPV-015 is an engineered strain that overexpresses the YH66-RS07020 ^C251T gene on the genome.

2. Construction of recombinant bacteria YPV-014

The templates were replaced by "recombinant bacteria YPV-013" with "Corynebacterium glutamicum ATCC15168", and the rest was the same as step 1.

The positive strain in which the YH66-RS07020 gene was integrated into the genome of Corynebacterium glutamicum CGMCC21260 was obtained, and it was named as recombinant bacteria YPV-014. Recombinant bacteria YPV-014 is an engineered strain that overexpresses the YH66-RS07020 gene on the genome. Compared with recombinant bacteria YPV-015, the difference of recombinant bacteria YPV-014 is only that: in the sequence of the exogenous DNA integrated into the genome of Corynebacterium glutamicum CGMCC21260, sequence 4 replaces sequence 2.

Example 3: Construction of recombinant bacteria YPV-017 and YPV-016

1. Construction of recombinant bacteria YPV-017

1. Using the recombinant bacteria YPV-013 as a template, a primer pair consisting of primers P19 and P20 was used for PCR amplification, and the amplified product (917 bp) was recovered. After sequencing, the amplified product was shown in Sequence 7 of the sequence table.

P19: 5'-GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCTCTTTGAATCTTACATTTCA-3';

P20: 5'- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TTAAGCGTTAGTGCGTGGCT-3'.

2. Take the pXMJ19 plasmid and perform single enzyme digestion with restriction endonuclease EcoR I to recover the linearized plasmid.

3. The amplified product recovered in step 1 was co-incubated with the linearized plasmid recovered in step 2 (using NEBuilder enzyme, incubated at 50°C for 30 min) to obtain the recombinant plasmid pXMJ19-YH66-RS07020 ^C251T . Sequencing verification showed that the recombinant plasmid pXMJ19-YH66-RS07020 ^C251T contained the DNA molecule shown in sequence 7 of the sequence table.

4. The recombinant plasmid pXMJ19-YH66-RS07020 ^C251T was electrotransfected into Corynebacterium glutamicum CGMCC21260 to obtain the recombinant bacterium YPV-017. The recombinant bacterium YPV-017 is an engineered strain that overexpresses the pXMJ19-YH66-RS07020 ^C251T gene through a plasmid.

2. Construction of recombinant bacteria YPV-016

Replace the template from "recombinant bacteria YPV-013" to "Corynebacterium glutamicum ATCC15168", and the rest is the same as step 1.

The recombinant bacteria YPV-016 was obtained. The recombinant bacteria YPV-016 was an engineered strain that overexpressed the YH66-RS07020 gene through a plasmid. Compared with the recombinant bacteria YPV-017, the difference between the recombinant bacteria YPV-016 and the recombinant bacteria YPV-017 was that in the sequence of the exogenous DNA overexpressed through the plasmid, sequence 4 replaced sequence 2.

Example 4: Construction of an engineered strain with YH66-RS07020 gene deleted from the genome

P21: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGTGCCGGCATGATCGCCCC-3';

P22: 5'-TTTCGCTATCAGACTGAAACTCTTTTTTCTAGCCTTCCTTA-3';

P23: 5'-TAAGGAAGGCTAGAAAAAGAGTTTCAGTCTGATAGCGAAA-3';

P24: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GTTGCCCTTCAAAACCACCG-3'.

P25: 5'-CGTGCCGGCATGATCGCCCC-3';

P26: 5'-GTTGCCCTTCAAAACCACCG-3'.

1. Construction of recombinant plasmid

1. Using Corynebacterium glutamicum ATCC15168 as a template, a primer pair consisting of primer P21 and primer P22 was used for PCR amplification, and the amplified product (upstream homology arm fragment, 787 bp) was recovered.

2. Using Corynebacterium glutamicum ATCC15168 as a template, a primer pair consisting of primer P23 and primer P24 was used for PCR amplification, and the amplified product (downstream homology arm fragment, 773 bp) was recovered.

3. The amplified product recovered in step 1 and the amplified product recovered in step 2 were used as templates to perform PCR amplification (Overlap PCR) using a primer pair consisting of primers P21 and P24, and the amplified product (1520 bp) was recovered. The amplified product was sequenced as shown in Sequence 8 of the sequence table.

4. Take the pK18mobsacB plasmid, use the restriction endonuclease Xba I for single digestion, and recover the linearized plasmid.

5. The amplified product recovered in step 3 was co-incubated with the linearized plasmid recovered in step 4 (using NEBuilder enzyme, incubated at 50°C for 30 min) to obtain the recombinant plasmid pK18-ΔYH66-RS07020. The recombinant plasmid pK18-ΔYH66-RS07020 was sequenced and verified to have the DNA molecule shown in sequence 8 of the sequence table.

2. Construction of recombinant bacteria YPV-018

1. The recombinant plasmid pK18-ΔYH66-RS07020 was used to electroshock transform Corynebacterium glutamicum CGMCC21260, and then cultured, and then PCR identification was performed on each single colony (primer pair composed of primers P25 and P26). The strain that can amplify 1446bp and 2040bp bands at the same time is a positive strain. The strain that only amplifies the 2040bp band is a starting strain that failed to transform, and the 2040bp fragment is shown in Sequence 9 of the sequence table.

2. Pick the positive strain in step 1, culture it in a medium containing 15% sucrose, then pick a single colony, culture it in a medium containing kanamycin and a medium without kanamycin, and screen the strain that cannot grow on the medium containing kanamycin but can grow on the medium without kanamycin.

3. Take the strain screened in step 2 and use the primer pair consisting of primer P25 and primer P26 for PCR amplification. The strain with only one amplification product of 1446 bp is a positive strain in which the YH66-RS07020 gene coding region is knocked out.

4. The strain screened in step 3 was again amplified by PCR using a primer pair consisting of primers P25 and P26 and sequenced, and the strain with correct sequencing was named recombinant bacteria YPV-018. Compared with the genomic DNA of Corynebacterium glutamicum CGMCC21260, the difference of recombinant bacteria YPV-018 was only the lack of the DNA molecule shown in sequence 4 of the sequence table.

Example 5: Fermentation to prepare L-valine

The test strains were: Corynebacterium glutamicum CGMCC21260, recombinant bacteria YPV-013, recombinant bacteria YPV-014, recombinant bacteria YPV-015, recombinant bacteria YPV-016, recombinant bacteria YPV-017 and recombinant bacteria YPV-018.

Fermentation tank: BLBIO-5GC-4-H fermentation tank (Shanghai Bailun Biotechnology Co., Ltd.).

The formula of the fermentation medium is shown in Table 3, with the remainder being water.

Table 3 Fermentation medium formula

Element content Ammonium sulfate 14g/L Potassium dihydrogen phosphate 1g/L Dipotassium hydrogen phosphate 1g/L Magnesium sulfate 0.5g/L Yeast powder 2g/L Ferrous Sulfate 18mg/L Manganese sulfate 4.2mg/L Biotin 0.02mg/L Vitamin B1 2mg/L Antifoam (CB-442) 0.5mL/L Glucose (sugar base) 40g/L

The fermentation control process is shown in Table 4.

At the initial moment of inoculation, the OD value of the system was 0.3-0.5.

During the fermentation process: ammonia water is used to adjust the pH; when there is foam in the fermentation system, an appropriate amount of antifoam (CB-442) is added; the sugar content (residual sugar) of the system is controlled by adding 70% glucose aqueous solution.

Table 4 Fermentation control process

After the fermentation is completed, the supernatant is collected and the L-valine yield in the supernatant is detected by HPLC.

The results are shown in Table 5. The L-valine production of the recombinant bacteria YPV-013 and the recombinant bacteria YPV-018 was significantly higher than that of Corynebacterium glutamicum CGMCC21260. The results showed that inhibiting the expression of the YH66-RS07020 gene could increase the L-valine production, while overexpressing the YH66-RS07020 gene reduced the L-valine production.

Table 5 L-valine fermentation experimental results

Strains OD ₆₁₀ L-Valine yield (g/L) Corynebacterium glutamicum CGMCC21260 98.1 82.4 Recombinant bacteria YPV-013 98.7 85.9 Recombinant bacteria YPV-014 97.9 80.9 Recombinant bacteria YPV-015 97.4 80.6 Recombinant bacteria YPV-016 97.3 79.7 Recombinant bacteria YPV-017 97.2 80.8 Recombinant bacteria YPV-018 99.7 85.3

The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Sequence Listing

<110> Heilongjiang Yipin Biotechnology Co., Ltd.

<120> Engineered bacteria obtained by genetic modification of YH66-RS07020 and its application in the preparation of valine

<130> GNCYX211994

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 197

<212> PRT

<213> Artificial Sequence

<400> 1

Met Glu Lys Phe Thr Thr His Thr Gly Val Gly Val Pro Leu Gln Arg

1 5 10 15

Ser Asn Val Asp Thr Asp Gln Ile Ile Pro Ala Val Tyr Leu Lys Arg

20 25 30

Val Thr Arg Thr Gly Phe Glu Asp Gly Leu Phe Ser Asn Trp Arg Gln

35 40 45

Asn Asp Pro Asn Phe Val Leu Asn Thr Asp Thr Tyr Lys Asn Gly Ser

50 55 60

Val Leu Val Ala Gly Pro Asp Phe Gly Thr Gly Ser Ser Arg Glu His

65 70 75 80

Ala Val Trp Val Leu Met Asp Tyr Gly Phe Arg Ala Val Phe Ser Ser

85 90 95

Arg Phe Ala Asp Ile Phe Arg Gly Asn Ser Gly Lys Ala Gly Met Leu

100 105 110

Ala Gly Ile Met Glu Gln Ser Asp Ile Glu Leu Leu Trp Lys Leu Met

115 120 125

Glu Gln Thr Pro Gly Leu Glu Leu Thr Val Asn Leu Glu Lys Gln Ile

130 135 140

Val Thr Ala Gly Asp Val Val Ile Ser Phe Glu Val Asp Pro Tyr Ile

145 150 155 160

Arg Trp Arg Leu Met Glu Gly Leu Asp Asp Ala Gly Leu Thr Leu Arg

165 170 175

Lys Leu Asp Glu Ile Glu Asp Tyr Glu Ala Lys Arg Pro Ala Phe Lys

180 185 190

Pro Arg Thr Asn Ala

195

<210> 2

<211> 594

<212> DNA

<213> Artificial Sequence

<400> 2

atggaaaaat ttaccaccca caccggcgtt ggcgttccac tgcagcgatc caacgtggac 60

accgaccaga tcatccccgc cgtctacctc aagcgcgtca cccgcacagg cttcgaagac 120

ggactgtttt ccaactggcg ccaaaacgac cccaactttg tcctcaacac cgacacctac 180

aagaacggct ccgttctcgt agcaggccct gactttggca ccggctcctc ccgcgagcac 240

gccgtctggg tactcatgga ctacggcttc cgcgctgtct tctcctcacg attcgccgac 300

atcttccgcg gcaactccgg aaaagctggc atgctcgccg gcatcatgga acagtccgac 360

atcgaacttc tgtggaagct catggaacaa accccgggcc tcgaactgac cgtgaacctg 420

gaaaagcaga tcgtcactgc aggcgacgta gtgatcagct tcgaagttga cccttacatt 480

cgctggcgtt tgatggaagg cctcgacgac gctggcctga ccctgcgcaa gctcgatgaa 540

attgaagact acgaggctaa gcgccctgcg tttaagccac gcactaacgc ttaa 594

<210> 3

<211> 197

<212> PRT

<213> Corynebacterium glutamicum

<400> 3

Met Glu Lys Phe Thr Thr His Thr Gly Val Gly Val Pro Leu Gln Arg

1 5 10 15

Ser Asn Val Asp Thr Asp Gln Ile Ile Pro Ala Val Tyr Leu Lys Arg

20 25 30

Val Thr Arg Thr Gly Phe Glu Asp Gly Leu Phe Ser Asn Trp Arg Gln

35 40 45

Asn Asp Pro Asn Phe Val Leu Asn Thr Asp Thr Tyr Lys Asn Gly Ser

50 55 60

Val Leu Val Ala Gly Pro Asp Phe Gly Thr Gly Ser Ser Arg Glu His

65 70 75 80

Ala Val Trp Ala Leu Met Asp Tyr Gly Phe Arg Ala Val Phe Ser Ser

85 90 95

Arg Phe Ala Asp Ile Phe Arg Gly Asn Ser Gly Lys Ala Gly Met Leu

100 105 110

Ala Gly Ile Met Glu Gln Ser Asp Ile Glu Leu Leu Trp Lys Leu Met

115 120 125

Glu Gln Thr Pro Gly Leu Glu Leu Thr Val Asn Leu Glu Lys Gln Ile

130 135 140

Val Thr Ala Gly Asp Val Val Ile Ser Phe Glu Val Asp Pro Tyr Ile

145 150 155 160

Arg Trp Arg Leu Met Glu Gly Leu Asp Asp Ala Gly Leu Thr Leu Arg

165 170 175

Lys Leu Asp Glu Ile Glu Asp Tyr Glu Ala Lys Arg Pro Ala Phe Lys

180 185 190

Pro Arg Thr Asn Ala

195

<210> 4

<211> 594

<212> DNA

<213> Corynebacterium glutamicum

<400> 4

atggaaaaat ttaccaccca caccggcgtt ggcgttccac tgcagcgatc caacgtggac 60

accgaccaga tcatccccgc cgtctacctc aagcgcgtca cccgcacagg cttcgaagac 120

ggactgtttt ccaactggcg ccaaaacgac cccaactttg tcctcaacac cgacacctac 180

aagaacggct ccgttctcgt agcaggccct gactttggca ccggctcctc ccgcgagcac 240

gccgtctggg cactcatgga ctacggcttc cgcgctgtct tctcctcacg attcgccgac 300

atcttccgcg gcaactccgg aaaagctggc atgctcgccg gcatcatgga acagtccgac 360

atcgaacttc tgtggaagct catggaacaa accccgggcc tcgaactgac cgtgaacctg 420

gaaaagcaga tcgtcactgc aggcgacgta gtgatcagct tcgaagttga cccttacatt 480

cgctggcgtt tgatggaagg cctcgacgac gctggcctga ccctgcgcaa gctcgatgaa 540

attgaagact acgaggctaa gcgccctgcg tttaagccac gcactaacgc ttaa 594

<210> 5

<211> 1314

<212> DNA

<213> Artificial Sequence

<400> 5

cagtgccaag cttgcatgcc tgcaggtcga ctctagaacg cccgcatcga agacctgcag 60

atcgccgctg acatcctcaa gggccacaaa atcgccgacg gcatgcgcat gatggtcgtg 120

ccttcctcca cctggatcaa gcaagaggcc gaagcactcg gactggacaa aatcttcacc 180

gacgctggcg ctgaatggcg taccgcaggc tgctccatgt gcctgggcat gaacccagac 240

caactgaagc caggcgagcg ctctgcatcc acctccaacc gaaacttcga aggacgccaa 300

ggaccaggag gccgcaccca cctggtatcc ccagcagtcg cagccgccac cgcaatccgc 360

ggcaccctgt cctcacctgc agatatctaa ggaaggctag aaaaagaatg gaaaaattta 420

ccacccacac cggcgttggc gttccactgc agcgatccaa cgtggacacc gaccagatca 480

tccccgccgt ctacctcaag cgcgtcaccc gcacaggctt cgaagacgga ctgttttcca 540

actggcgcca aaacgacccc aactttgtcc tcaacaccga cacctacaag aacggctccg 600

ttctcgtagc aggccctgac tttggcaccg gctcctcccg cgagcacgcc gtctgggtac 660

tcatggacta cggcttccgc gctgtcttct cctcacgatt cgccgacatc ttccgcggca 720

actccggaaa agctggcatg ctcgccggca tcatggaaca gtccgacatc gaacttctgt 780

ggaagctcat ggaacaaacc ccgggcctcg aactgaccgt gaacctggaa aagcagatcg 840

tcactgcagg cgacgtagtg atcagcttcg aagttgaccc ttacattcgc tggcgtttga 900

tggaaggcct cgacgacgct ggcctgaccc tgcgcaagct cgatgaaatt gaagactacg 960

aggctaagcg ccctgcgttt aagccacgca ctaacgctta agtttcagtc tgatagcgaa 1020

agcaccccgc aaccttcatt gtcgcggggt gcatttgtgc gtcttggtgg gcgagtggag 1080

tgggcatgtc tggaatagac caagaggccc tggattccct taaggtcttg gtctttttcg 1140

tacgttttga ggcctgggaa gtgcatatcc agaccaaggg accccggcaa gccaagaccc 1200

ttggtttaat atgacgttcc gccccgagca agccgaaacc attacctaga acgcatgaaa 1260

agtgcccctc taggatgggt accgagctcg aattcgtaat catggtcata gctg 1314

<210> 6

<211> 2396

<212> DNA

<213> Artificial Sequence

<400> 6

cagtgccaag cttgcatgcc tgcaggtcga ctctagcatg acggctgact ggactcgact 60

tccatacgag gttctggaga agatctccac ccgcatcacc aacgaagttc cagatgtgaa 120

ccgcgtggtt ttggacgtaa cctccaagcc accaggaacc atcgaatggg agtaggcctt 180

aaatgagcct tcgttaagcg gcaatcacct tattggagat tgtcgctttt cccatttctc 240

cgggttttct ggaacttttt gggcgtatgc tgggaatgat tctattattg ccaaatcaga 300

aagcaggaga gacccgatga gcgaaatcct agaaacctat tgggcacccc actttggaaa 360

aaccgaagaa gccacagcac tcgtttcata cctggcacaa gcttccggcg atcccattga 420

ggttcacacc ctgttcgggg atttaggttt agacggactc tcgggaaact acaccgacac 480

tgagattgac ggctacggcg acgcattcct gctggttgca gcgctatccg tgttgatggc 540

tgaaaacaaa gcaacaggtg gcgtgaatct gggtgagctt gggggagctg ataaatcgat 600

ccggctgcat gttgaatcca aggagaacac ccaaatcaac accgcattga agtattttgc 660

gctctcccca gaagaccacg cagcagcaga tcgcttcgat gaggatgacc tgtctgagct 720

tgccaacttg agtgaagagc tgcgcggaca gctggactaa ttgtctccca tttaaggagt 780

ccgatttctt tgaatcttac atttcataga gtgagacgct tgcaggttgg ggtttaaacg 840

ttgtggatat cgattccctg caggggagct gtataaagtg tgaggtaaat ctaaaacgca 900

ggacgtgaca tttttggcgc gttttaggtt atactgtctc agacaacgaa actcttgtcc 960

cacattgtga gatttgcttg ctagaatgtg ggctagaaat tcctgaaaat ttttacgcac 1020

tgtaaggacg gtgagttcca tggaaaaatt taccacccac accggcgttg gcgttccact 1080

gcagcgatcc aacgtggaca ccgaccagat catccccgcc gtctacctca agcgcgtcac 1140

ccgcacaggc ttcgaagacg gactgttttc caactggcgc caaaacgacc ccaactttgt 1200

cctcaacacc gacacctaca agaacggctc cgttctcgta gcaggccctg actttggcac 1260

cggctcctcc cgcgagcacg ccgtctgggt actcatggac tacggcttcc gcgctgtctt 1320

ctcctcacga ttcgccgaca tcttccgcgg caactccgga aaagctggca tgctcgccgg 1380

catcatggaa cagtccgaca tcgaacttct gtggaagctc atggaacaaa ccccgggcct 1440

cgaactgacc gtgaacctgg aaaagcagat cgtcactgca ggcgacgtag tgatcagctt 1500

cgaagttgac ccttacattc gctggcgttt gatggaaggc ctcgacgacg ctggcctgac 1560

cctgcgcaag ctcgatgaaa ttgaagacta cgaggctaag cgccctgcgt ttaagccacg 1620

cactaacgct taataaatcg actactcaca tagggtcggg ctagtcattc tgatcagcga 1680

attccacgtt cacatcgcca attccagagt tcacaaccag attcagcatt ggaccttcta 1740

gatcagcatt gtgggcggtg agatctccaa catcacagcg cgctgtgccc acaccggcgg 1800

tacaacttag gctcacgggc acatcatcgg gcagggtgac catgacttcg ccgatccctg 1860

aggtgatttg gatgttttgt tcctgatcca attgggtgag gtggctgaaa tcgaggttca 1920

tttcacccac gccagaggtg tagctgctga ggagttcatc gttggtgggg atgagattga 1980

catcgccgat tccagggtcg tcttcaaagt agatggggatc gatatttgaa ataaacaggc 2040

ctgcgagggc gctcatgaca actccggtac caactacacc gccgacaatc catggccaca 2100

catggcgctttttctgaggc ttttgtggag ggacttgtac atcccaggtg ttgtattggt 2160

tttgggcaag tggatcccaa tgaggcgctt cgggggtttg ttgcgcgaag ggtgcatagt 2220

agccctcaac gggggtgata gtgcttagat ctggttgggg ttgtgggtag agatcttcgt 2280

ttttcatggt ggcatcctca gaaacagtga attcagtggt gagtagtccg cggggtggaa 2340

gtggttgttt cttatgcagg gtaccgagct cgaattcgta atcatggtca tagctg 2396

<210> 7

<211> 917

<212> DNA

<213> Artificial Sequence

<400> 7

gcttgcatgc ctgcaggtcg actctagagg atcccctctt tgaatcttac atttcataga 60

gtgagacgct tgcaggttgg ggtttaaacg ttgtggatat cgattccctg caggggagct 120

gtataaagtg tgaggtaaat ctaaaacgca ggacgtgaca tttttggcgc gttttaggtt 180

atactgtctc agacaacgaa actcttgtcc cacattgtga gatttgcttg ctagaatgtg 240

ggctagaaat tcctgaaaat ttttacgcac tgtaaggacg gtgagttcca tggaaaaatt 300

taccacccac accggcgttg gcgttccact gcagcgatcc aacgtggaca ccgaccagat 360

catccccgcc gtctacctca agcgcgtcac ccgcacaggc ttcgaagacg gactgttttc 420

caactggcgc caaaacgacc ccaactttgt cctcaacacc gacacctaca agaacggctc 480

cgttctcgta gcaggccctg actttggcac cggctcctcc cgcgagcacg ccgtctgggt 540

actcatggac tacggcttcc gcgctgtctt ctcctcacga ttcgccgaca tcttccgcgg 600

caactccgga aaagctggca tgctcgccgg catcatggaa cagtccgaca tcgaacttct 660

gtggaagctc atggaacaaa ccccgggcct cgaactgacc gtgaacctgg aaaagcagat 720

cgtcactgca ggcgacgtag tgatcagctt cgaagttgac ccttacattc gctggcgttt 780

gatggaaggc ctcgacgacg ctggcctgac cctgcgcaag ctcgatgaaa ttgaagacta 840

cgaggctaag cgccctgcgt ttaagccacg cactaacgct taagttttgg cggatgagag 900

aagattttca gcctgat 917

<210> 8

<211> 1520

<212> DNA

<213> Artificial Sequence

<400> 8

cagtgccaag cttgcatgcc tgcaggtcga ctctagcgtg ccggcatgat cgccccagac 60

caaaccacct tcgactacgt tgaaggccgc gaaatggcac caaagggcgc cgactgggac 120

gaagcagttg cttactggaa gaccctgcca accgacgaag gcgcaacctt tgacaaggtc 180

gtagaaatcg atggctccgc actgacccca ttcatcacct ggggcaccaa cccaggccaa 240

ggtctgccac tgagcgaaac cgtgccaaac ccagaagact tcaccaacga caacgacaag 300

gcagcagccg aaaaggcact gcagtacatg gacctggtac caggaacccc actgcgcgac 360

atcaagatcg acaccgtctt cctgggatcc tgcaccaacg cccgcatcga agacctgcag 420

atcgccgctg acatcctcaa gggccacaaa atcgccgacg gcatgcgcat gatggtcgtg 480

ccttcctcca cctggatcaa gcaagaggcc gaagcactcg gactggacaa aatcttcacc 540

gacgctggcg ctgaatggcg taccgcaggc tgctccatgt gcctgggcat gaacccagac 600

caactgaagc caggcgagcg ctctgcatcc acctccaacc gaaacttcga aggacgccaa 660

ggaccaggag gccgcaccca cctggtatcc ccagcagtcg cagccgccac cgcaatccgc 720

ggcaccctgt cctcacctgc agatatctaa ggaaggctag aaaaagagtt tcagtctgat 780

agcgaaagca ccccgcaacc ttcattgtcg cggggtgcat ttgtgcgtct tggtgggcga 840

gtggagtggg catgtctgga atagaccaag aggccctgga ttcccttaag gtcttggtct 900

ttttcgtacg ttttgaggcc tgggaagtgc atatccagac caagggaccc cggcaagcca 960

agacccttgg tttaatatga cgttccgccc cgagcaagcc gaaaccatta cctagaacgc 1020

atgaaaagtg cccctctagg atgggttcta agcccctaac aggctcaaac ccaagcccat 1080

gcccgctcgc caaaccggag gccttaaacg cgctcctatt taaccggcag ggaactcgcc 1140

aggtaatcag cgccggtgaa cacaccgtcg tgaaagctca acacccacac gctgcccttt 1200

ttcgccttga tcttctcatc gatagggagg gtgccgttct cggagaacca tttgatcatt 1260

tccggaatga tgtcgccctg cccaacgatc atcggcacgc caccttgtgc aaccacgtcg 1320

gtgaagcgct tcttgcaggc ctcggggatcg gtttcccagg cgtcgtcgcc gaacagtcgg 1380

ttgacggaca cgtcgaggcc gagctcatcg gcaaggggga gcgcggtggc ttggcagcga 1440

tcgggcaccg ccgagtaaat tgcggtgggt ttgaagggca acgggtaccg agctcgaatt 1500

cgtaatcatg gtcatagctg 1520

<210> 9

<211> 2040

<212> DNA

<213> Artificial Sequence

<400> 9

cgtgccggca tgatcgcccc agaccaaacc accttcgact acgttgaagg ccgcgaaatg 60

gcaccaaagg gcgccgactg ggacgaagca gttgcttact ggaagaccct gccaaccgac 120

gaaggcgcaa cctttgacaa ggtcgtagaa atcgatggct ccgcactgac cccattcatc 180

acctggggca ccaacccagg ccaaggtctg ccactgagcg aaaccgtgcc aaacccagaa 240

gacttcacca acgacaacga caaggcagca gccgaaaagg cactgcagta catggacctg 300

gtaccaggaa ccccactgcg cgacatcaag atcgacaccg tcttcctggg atcctgcacc 360

aacgcccgca tcgaagacct gcagatcgcc gctgacatcc tcaagggcca caaaatcgcc 420

gacggcatgc gcatgatggt cgtgccttcc tccacctgga tcaagcaaga ggccgaagca 480

ctcggactgg acaaaatctt caccgacgct ggcgctgaat ggcgtaccgc aggctgctcc 540

atgtgcctgg gcatgaaccc agaccaactg aagccaggcg agcgctctgc atccacctcc 600

aaccgaaact tcgaaggacg ccaaggacca ggaggccgca cccacctggt atccccagca 660

gtcgcagccg ccaccgcaat ccgcggcacc ctgtcctcac ctgcagatat ctaaggaagg 720

ctagaaaaag aatggaaaaa tttaccaccc acaccggcgt tggcgttcca ctgcagcgat 780

ccaacgtgga caccgaccag atcatccccg ccgtctacct caagcgcgtc acccgcacag 840

gcttcgaaga cggactgttt tccaactggc gccaaaacga ccccaacttt gtcctcaaca 900

ccgacaccta caagaacggc tccgttctcg tagcaggccc tgactttggc accggctcct 960

cccgcgagca cgccgtctgg gcactcatgg actacggctt ccgcgctgtc ttctcctcac 1020

gattcgccga catcttccgc ggcaactccg gaaaagctgg catgctcgcc ggcatcatgg 1080

aacagtccga catcgaactt ctgtggaagc tcatggaaca aaccccgggc ctcgaactga 1140

ccgtgaacct ggaaaagcag atcgtcactg caggcgacgt agtgatcagc ttcgaagttg 1200

acccttacat tcgctggcgt ttgatggaag gcctcgacga cgctggcctg accctgcgca 1260

agctcgatga aattgaagac tacgaggcta agcgccctgc gtttaagcca cgcactaacg 1320

cttaagtttc agtctgatag cgaaagcacc ccgcaacctt cattgtcgcg gggtgcattt 1380

gtgcgtcttg gtgggcgagt ggagtgggca tgtctggaat agaccaagag gccctggatt 1440

cccttaaggt cttggtcttt ttcgtacgtt ttgaggcctg ggaagtgcat atccagacca 1500

agggaccccg gcaagccaag acccttggtt taatatgacg ttccgccccg agcaagccga 1560

aaccattacc tagaacgcat gaaaagtgcc cctctaggat gggttctaag cccctaacag 1620

gctcaaaccc aagcccatgc ccgctcgcca aaccggaggc cttaaacgcg ctcctattta 1680

accggcaggg aactcgccag gtaatcagcg ccggtgaaca caccgtcgtg aaagctcaac 1740

acccaacacgc tgcccttttt cgccttgatc ttctcatcga tagggagggt gccgttctcg 1800

gagaaccatt tgatcatttc cggaatgatg tcgccctgcc caacgatcat cggcacgcca 1860

ccttgtgcaa ccacgtcggt gaagcgcttc ttgcaggcct cgggatcggt ttcccaggcg 1920

tcgtcgccga acagtcggtt gacggacacg tcgaggccga gctcatcggc aagggggagc 1980

gcggtggctt ggcagcgatc gggcaccgcc gagtaaattg cggtgggttt gaagggcaac 2040

Claims (5)

1. Use of a substance for inhibiting YH66-RS07020 gene expression;

The application is as follows (I) or (II) or (III):

use of (i) to increase valine production in a bacterium;

(II) use in the production of valine;

(III) use in increasing bacterial load;

The YH66-RS07020 gene is a gene for encoding YH66-RS07020 protein; the YH66-RS07020 protein is a protein shown in a sequence 3 in a sequence table;

The substance for inhibiting YH66-RS07020 gene expression is a DNA molecule shown in a sequence 5 of a sequence table or a recombinant plasmid with the DNA molecule shown in the sequence 5 of the sequence table;

or the substance for inhibiting YH66-RS07020 gene expression is a DNA molecule shown in a sequence 8 of a sequence table or a recombinant plasmid with the DNA molecule shown in the sequence 8 of the sequence table;

the bacteria are corynebacterium glutamicum CGMCC21260.

2. A recombinant bacterium is obtained by inhibiting YH66-RS07020 gene expression in bacteria; the YH66-RS07020 gene is the YH66-RS07020 gene in claim 1;

The YH66-RS07020 gene in the inhibiting bacteria is expressed as a YH66-RS07020 gene in the knocked-out bacteria or a YH66-RS07020 gene in the mutant bacteria;

the YH66-RS07020 gene in the knocked-out bacteria is as follows: a DNA molecule shown in a sequence 4 of a deletion sequence table in bacterial genome DNA;

The YH66-RS07020 gene in the mutant bacteria is as follows: mutating the codon of the 84 th amino acid residue of YH66-RS07020 protein coded in bacterial genome DNA from the codon of A to the codon of V;

the bacteria are corynebacterium glutamicum CGMCC21260.

3. The use of the recombinant bacterium according to claim 2 for the preparation of valine.

4. A process for preparing valine comprising the steps of: fermenting the recombinant bacterium of claim 2.

5. A method for increasing valine production of a bacterium comprising the steps of: inhibiting YH66-RS07020 gene expression in bacteria;

the YH66-RS07020 gene is the YH66-RS07020 gene in claim 1;

The YH66-RS07020 gene in the inhibiting bacteria is expressed as a YH66-RS07020 gene in the knocked-out bacteria or a YH66-RS07020 gene in the mutant bacteria;

the YH66-RS07020 gene in the knocked-out bacteria is as follows: a DNA molecule shown in a sequence 4 of a deletion sequence table in bacterial genome DNA;

The YH66-RS07020 gene in the mutant bacteria is as follows: mutating the codon of the 84 th amino acid residue of YH66-RS07020 protein coded in bacterial genome DNA from the codon of A to the codon of V;

the bacteria are corynebacterium glutamicum CGMCC21260.