CN113667729A - Rapid microorganism identification method based on nanopore sequencer - Google Patents
Rapid microorganism identification method based on nanopore sequencer Download PDFInfo
- Publication number
- CN113667729A CN113667729A CN202110863381.6A CN202110863381A CN113667729A CN 113667729 A CN113667729 A CN 113667729A CN 202110863381 A CN202110863381 A CN 202110863381A CN 113667729 A CN113667729 A CN 113667729A
- Authority
- CN
- China
- Prior art keywords
- dna
- primer
- sample
- nanopore
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid microorganism identification method based on a nanopore sequencer, belonging to the field of molecular biology, and the identification method comprises the following steps: step one, designing an autonomously designed primer covering a to-be-detected region of the ITS genes of bacteria and fungi, wherein the sequence is SEQ 01-04; mixing sequences combined with the Barcode primer annealing in the second round of amplification to form a primer pool; step three, receiving a sample and extracting DNA; step four, performing first round amplification and purification; performing second amplification and purification; step five, constructing a final library; step six, performing nanopore sequencing on the final library, and analyzing and confirming pathogenic microorganisms infected by the sample; the primer combination for covering the area to be detected of the ITS gene of bacteria and fungi designed by the invention is combined with a novel nanopore sequencing method, so that the rapid clinical diagnosis of pathogenic microorganisms of infectious diseases can be realized, and the primer combination has the advantages of high flux and rapid detection.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to a rapid microorganism identification method based on a nanopore sequencer.
Background
Clinically, there are a large number of cases in which detection of infectious pathogens is required, with at least 50 million cases per year being critically ill patients. At present, the clinical detection of pathogenic microorganisms is mainly carried out by the traditional bacteria culture identification method, and the process comprises the culture and separation of microorganisms, species identification and drug sensitivity test. The traditional pathogen detection method has the limitations of long pathogen period, low detection coverage, incapability of detecting part of pathogens or long time for detecting the pathogens, incapability of obtaining abundance information of the pathogens and the like. In recent years, the development of high-throughput gene sequencing technology enables the nucleic acid to be directly extracted from cerebrospinal fluid, pleural fluid, ascites, alveolar lavage fluid and other samples of patients, and almost all potential pathogens in the samples can be detected at one time in a short time.
However, the detection method in the market still cannot detect pathogenic microorganisms with low abundance, and in order to detect the high coverage rate of the bacterial species, a large amount of time is needed, the market needs a method capable of reducing the sequencing time, and the invention solves the problems by finding the self-designed primers covering the areas to be detected of the 16S genes of the bacteria and the ITS genes of the fungi and the novel nanopore sequencing technology.
Disclosure of Invention
In order to solve the defects of the prior art, the invention aims to provide a rapid identification method of microorganisms based on a nanopore sequencer, which realizes rapid genome comparison and species identification of microorganisms by designing a primer combination covering a region to be detected of the ITS genes of bacteria and fungi and combining a novel nanopore sequencing method, is convenient to realize rapid clinical diagnosis of pathogenic microorganisms of infectious diseases, and has the advantages of high throughput and rapid detection.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method for rapidly identifying microorganisms based on a nanopore sequencer comprises the following steps:
step one, designing an autonomously designed primer covering a to-be-detected region of the ITS genes of bacteria and fungi, wherein the sequence is SEQ 01-04;
step two, adding a AGGTCTTCACGATACGTCGAG base sequence to the 5 'end of the forward primer of SEQ01-04, adding a GTCCAATCAGTTGCAGCTTCAG base sequence to the 5' end of the reverse primer to obtain a sequence combined with the annealing time of the Barcode primer in the second round of amplification, and mixing the sequences combined with the annealing time of the Barcode primer in the second round of amplification to form a primer pool;
step three, receiving a sample and extracting DNA;
step four, adopting a primer pool to carry out first round amplification and purification; then selecting Barcode to carry out second round amplification and purification;
step five, constructing a final library;
and step six, performing nanopore sequencing on the final library, and analyzing and confirming pathogenic microorganisms infected by the sample.
In the method for rapidly identifying microorganisms based on the nanopore sequencer, in the second step, the sequence combined with the Barcode primer during annealing in the second round of amplification is determined according to the concentration ratio of 1: 1: 1: 1 are mixed to form a primer pool.
The method for rapidly identifying the microorganisms based on the nanopore sequencer comprises the following steps: alveolar lavage fluid, sputum, pleural effusion, cerebrospinal fluid or EDTA anticoagulation.
In the aforementioned method for rapidly identifying a microorganism based on a nanopore sequencer, the reaction system for the first round of amplification in the fourth step includes: 2 PCR mix 12.5. mu.L, primer pool 3. mu.L, template DNA 9.5. mu.L; the reaction procedure is as follows: a 105 ℃ hot cover; 3min at 95 ℃; 30sec at 95 ℃, 1min at 62 ℃, 1min at 72 ℃ and 25 cycles; 3min at 72 ℃; hold at 4 ℃;
and purifying by using magnetic beads.
In the aforementioned method for rapidly identifying a microorganism based on a nanopore sequencer, the reaction system for the second round of amplification in the fourth step includes: 2 PCRmix 12.5 uL, Barcode primer 3 uL, first round amplification purification product 10.5 uL; the reaction procedure is as follows: a 105 ℃ hot cover; 3min at 95 ℃; 30sec at 95 ℃, 30sec at 64 ℃, 1min at 72 ℃ and 12 cycles; 3min at 72 ℃; hold at 4 ℃;
and purifying by using magnetic beads.
In the method for rapidly identifying the microorganisms based on the nanopore sequencer, the concrete method for constructing the final library in the fifth step is as follows:
(1) library pooling to obtain library Mix DNA;
(2) and (3) repairing the tail end:
the end repairing reaction system is as follows: end prep Mix 415. mu.L, library Mix DNA X. mu.L, ddH2O50-X μ L; the PCR procedure was: heating the cover at 105 ℃, 15min at 25 ℃, 15min at 65 ℃ and Hold at 4 ℃;
(3) purifying magnetic beads;
(4) connecting a joint:
the joint connection reaction system is as follows: 25 mu L of DNA sample in the previous step, 10 mu L of connecting buffer, 5 mu L of Rapid DNA Ligase, 1 mu L of Adapter Mix and 9 mu L of ddH2O 9; the PCR procedure was: a 105 ℃ hot cover; 15min at 20 ℃; hold at 4 ℃;
(5) purifying magnetic beads;
(6) inspecting the quality of the product;
(7) the final library configuration system is: sequencing Buffer 18.8 μ L, Loading Beads 12.8 μ L, library X μ L, ddH2O 15.4-XμL。
In the method for rapidly identifying the microorganisms based on the Nanopore sequencer, in the sixth step, the Nanopore sequencer uses a MinION sequencer of Nanopore company, and a sequencing kit comprises the following steps: SQK-LSK109, sequencing chip: and R9.
In the method for rapidly identifying the microorganisms based on the nanopore sequencer, the nanopore sequencing is performed on the final library in the sixth step, and the specific steps of analyzing and confirming the pathogenic microorganisms infected by the sample are as follows:
a) performing quality inspection on the chip before the chip is mounted on a machine;
b) induction:
the configuration system of the inducer is as follows: flush Buffer 500 μ L, Flush Tether 15 μ L, ddH2O 200 μ L;
c) sample adding;
d) sequencing;
e) and (3) off-line data analysis:
and comparing the off-line data with the sequences in the database, analyzing the abundance of various strains in each sample, and determining the pathogenic microorganisms infected by the sample.
After the technical scheme is adopted, the invention has the advantages that:
according to the invention, the primer combination covering the area to be detected of the ITS genes of bacteria and fungi is designed to be matched with a nanopore sequencing technology, so that the nucleic acid of longer fragments of all pathogenic microorganisms possibly existing in a clinical sample can be detected at the same time, which is the capability that most detection means do not have at present;
the method is simple and convenient to operate, and has high flux, sensitivity, accuracy and comprehensiveness;
the invention can complete sequencing by matching with a nanopore sequencer MinION, and the sequencer is small and flexible, can perform real-time sequencing anytime and anywhere, can obtain a target sequence in tens of minutes as soon as possible, and can realize the purposes from the beginning of processing a sample to the obtaining of a detection report within one day.
Drawings
FIG. 1 is a schematic diagram of the library construction scheme of the present invention;
FIG. 2 is a graphical representation of the results of qPCR of Staphylococcus aureus for comparison with the results of detection of Staphylococcus aureus in the experiments of the present invention;
FIG. 3 is a graph of Candida albicans qPCR results for comparison with the Candida albicans detection results of the experiments of the present invention.
Detailed Description
The invention is described in detail below with reference to the figures and the embodiments.
The technical effect of the invention is verified according to the following method for rapidly identifying the microorganism based on the nanopore sequencer, and the method comprises the following steps:
step one, designing an autonomously designed primer covering a to-be-detected region of the ITS genes of bacteria and fungi, wherein the sequence is SEQ 01-04; the primer sequences are shown in the following table 1;
it should be noted that: since the 16S genes of bacteria and the ITS genes of fungi are universal fragments and have higher consistency to a certain extent, 16S genes of a great number of kinds of bacteria and ITS genes of fungi are downloaded and compared, primers are designed, and after an experiment of a positive sample is carried out, the primer combination can be found to be capable of simultaneously detecting nucleic acids of longer fragments of all pathogenic microorganisms possibly existing in a clinical sample, the accuracy is high, the primer combination has a synergistic effect, the amplification products of the primer combination are bacteria 16S-1200 bp, and fungi ITS-800 bp.
Watch (A)
Universal primer for gene region to be tested
Step two, adding a AGGTCTTCACGATACGTCGAG base sequence to the 5 'end of the forward primer of SEQ01-04, adding a GTCCAATCAGTTGCAGCTTCAG base sequence to the 5' end of the reverse primer to obtain a sequence combined with the annealing time of the Barcode primer in the second round of amplification, and mixing the sequences combined with the annealing time of the Barcode primer in the second round of amplification to form a primer pool; preferably, the concentration ratio of the primer pool is 1: 1: 1: 1.
step three, receiving a sample and extracting DNA;
in this experiment, alveolar lavage fluid is used as an example, and sample receiving and DNA extraction are performed
1, collecting and coding a sample, and recording the name and other information of the sample in an Excel table.
2, sample pretreatment
A500. mu.L sample was taken in a 2ml EP tube, 10. mu.L proteinase K, 5. mu.L lysozyme and 0.05mm zirconia milling beads were added and milling was performed using a mill for 90s per cycle for 3 cycles with a 15s rest between each cycle.
3, extraction of DNA
A clean 1.5mL EP tube was added with 500. mu.L of lysis buffer, 3. mu.L of internal control, and finally 400. mu.L of ground sample. Incubating at 75 deg.C for 10min, adding 400 μ L of anhydrous ethanol, mixing, adding 15 μ L of extracted magnetic beads, mixing, standing for 5 min. Placing the incubated EP tube on a magnetic frame and sucking away the supernatant, adding 600 mu L of washing solution, fully mixing, placing the tube on the magnetic frame again and sucking away the supernatant, adding 800 mu L of 80% ethanol prepared in situ, fully mixing, placing the tube on the magnetic frame again and sucking away the supernatant. When the beads were substantially dry, 65. mu.L of the eluent was added and incubated at room temperature for 5 min. The incubated EP tube was placed on a magnetic rack and the supernatant was aspirated.
4, detection of nucleic acid concentration
The extracted nucleic acid concentration was detected using qubit 4.0.
Step four, adopting a primer pool to carry out first round amplification and purification; then selecting Barcode to carry out second round amplification and purification;
1, set up the following procedure in table 2 on a PCR instrument.
TABLE 2
2, the reaction solution was prepared in a 0.2ml PCR tube according to the following Table 3, and then put into a PCR instrument to run the whole procedure.
TABLE 3
3, purifying the product
The purified magnetic beads at room temperature were mixed with the above product at a volume ratio of 3:5 and incubated at room temperature for 5 minutes. The test tube was placed on a magnetic stand, left to stand, and the supernatant was carefully washed out to avoid interfering with the magnetic beads. Adding 80% ethanol, and standing for 30 s; carefully sucking out the supernatant to avoid interfering the magnetic beads; adding 80% ethanol again, and standing for 30 s; carefully suck out the supernatant to avoid interfering the magnetic beads, and air-dry the magnetic beads. mu.L of the eluent was added thereto, and the mixture was allowed to stand at room temperature for 5 minutes. The tube was placed on a magnetic stand and allowed to stand, and 18. mu.L of supernatant was carefully washed out to avoid disturbing the magnetic beads, and the supernatant was transferred to a new 0.2ml PCR tube.
4, the following program was set on the PCR machine as shown in Table 4.
TABLE 4
5, the reaction solution was prepared in a 0.2ml PCR tube according to the following Table 5, and then put into a PCR machine to run the whole procedure.
TABLE 5
There are currently 96 barcodes commonly used in nanopore sequencing to distinguish different samples of the same batch, which is specifically shown in table 6 below:
TABLE 6 Nanopore Barcode sequences
1, product purification
The purified magnetic beads at room temperature were mixed with the above product at a volume ratio of 3:5 and incubated at room temperature for 5 minutes. The test tube was placed on a magnetic stand, left to stand, and the supernatant was carefully washed out to avoid interfering with the magnetic beads. Adding 80% ethanol, and standing for 30 s; carefully sucking out the supernatant to avoid interfering the magnetic beads; adding 80% ethanol again, and standing for 30 s; carefully suck out the supernatant to avoid interfering the magnetic beads, and air-dry the magnetic beads. mu.L of the eluent was added thereto, and the mixture was allowed to stand at room temperature for 5 minutes. The tube was placed on a magnetic stand and allowed to stand, and 18. mu.L of supernatant was carefully washed out to avoid disturbing the magnetic beads, and the supernatant was transferred to a new 0.2ml PCR tube.
2, quality inspection of amplification product
The concentration of the amplified product was detected using qubit4.0, while observing the size of the product band using agarose gel electrophoresis.
Step five, constructing a final library;
1, library pooling
And according to the detection result of the Qubit, calculating the loading amount of 50ng of each sample, performing pooling on the library according to the calculated volume, and fully mixing to obtain the library Mix.
2, end repair
The following table 7 procedure was set up on the PCR instrument.
TABLE 7
The end-repair reaction system is shown in Table 8 below:
TABLE 8
Note that: if the volume of the library pooling is larger than 50 μ L, a plurality of libraries with similar sample amount can be finely adjusted or mixed according to actual conditions.
3, purifying the product
The purified magnetic beads at room temperature were mixed with the above product at a volume ratio of 4:5 and incubated at room temperature for 5 minutes. The test tube was placed on a magnetic stand, left to stand, and the supernatant was carefully washed out to avoid interfering with the magnetic beads. Adding 80% ethanol, and standing for 30 s; carefully sucking out the supernatant to avoid interfering the magnetic beads; adding 80% ethanol again, and standing for 30 s; carefully suck out the supernatant to avoid interfering the magnetic beads, and air-dry the magnetic beads. mu.L of the eluent was added thereto, and the mixture was allowed to stand at room temperature for 5 minutes. The tube was placed on a magnetic stand and allowed to stand, and 18. mu.L of supernatant was carefully washed out to avoid disturbing the magnetic beads, and the supernatant was transferred to a new 0.2ml PCR tube.
4, joint connection
The following procedure was set up on a PCR instrument:
TABLE 9
The linker ligation reaction system is shown in table 10 below:
watch 10
Note that: AMX is a special joint for the Nanopore and can be adjusted according to the actual sample DNA loading amount.
5, purifying the product
The purified magnetic beads at room temperature were mixed with the above product at a volume ratio of 3:5 and incubated at room temperature for 5 minutes. The test tube was placed on a magnetic stand, left to stand, and the supernatant was carefully washed out to avoid interfering with the magnetic beads. 125. mu.L of Short Fragment Buffer (SFB), and standing for 30 seconds; carefully sucking out the supernatant to avoid interfering the magnetic beads; 125. mu.L of Short Fragment Buffer (SFB), and standing for 30 seconds; carefully suck out the supernatant to avoid interfering the magnetic beads, and air-dry the magnetic beads. mu.L of the eluent was added thereto, and the mixture was allowed to stand at room temperature for 5 minutes. The tube was placed on a magnetic stand and allowed to stand, and 18. mu.L of supernatant was carefully washed out to avoid disturbing the magnetic beads, and the supernatant was transferred to a new 0.2ml PCR tube.
Note that: if multiple libraries were previously mixed, the pooling was mixed prior to purification.
6, product quality inspection
The purified product was detected using qubit 4.0.
The final library configuration is shown in Table 11 below:
TABLE 11
Note that: the final library was constructed by calculating 100ng of product based on the measured concentration.
And step six, performing nanopore sequencing on the final library, and analyzing and confirming pathogenic microorganisms infected by the sample.
Using a MinION sequencer from Nanopore (sequencing kit: SQK-LSK109, sequencing chip: R9)
8, pre-processing quality inspection of chip
Taking out from a refrigerator with 4 ℃ in advance 1 hour before loading, and standing for 30min at room temperature; and inserting a data line, connecting with an upper computer to perform chip quality inspection, and confirming the number of available holes in the chip.
Note that: and if the number of the remaining available holes of the chip is too low, taking a new chip and repeating the steps.
9, inducing
The inducer formulation is as follows in table 12:
TABLE 12
Adding 800 mu L of prepared inducer into the chip, and standing for 5 minutes; the remaining inducer is added to the chip.
10, sample application
After induction was complete, the final library was added in its entirety from the wells. After the sample is added, all the covers of the chip are covered, the data lines are inserted, the chip is connected with an on-computer, and sequencing is started after an on-computer program is set.
11, sequencing
Note that: after the sequencing is started, a period of time should be waited until the voltage stabilizes and the barcode data is observed to be normal.
12, data of machine unloading
And comparing the off-line data with the sequences in the database, analyzing the abundance of various strains in each sample, and determining the pathogenic microorganisms infected by the sample.
Experiment one:
the detection results of the detection method of the invention on positive samples of known gram-positive bacteria staphylococcus aureus and candida albicans are shown in the following table 13, fig. 2 and 3: and (3) carrying out gradient dilution on the sample by 10 times, then extracting, and carrying out nanopore sequencing on the dilution solution by using the negative sample of the same type.
TABLE 13 nanopore sequencing results
And (4) analyzing results:
table 13 and FIG. 2 show the selection of positive samples of known gram-positive bacteria Staphylococcus aureusCarrying out 10-time gradient dilution on the negative samples of the same type, and respectively taking a sample stock solution, 10-time dilution and 10-time dilution2Dilution by fold, 103Dilution by fold, 104And (3) performing dilution extraction, and detecting the extracted DNA by using the method and the qPCR method respectively. Total reads in Table 13 represent the number of all the resulting sequences obtained using the sequencing of the invention, reads represent the number of sequences that could be matched to the gram-positive bacterium Staphylococcus aureus detected using the sequencing of the invention, and percentages are the ratio of the number of detected Staphylococcus aureus sequences to the Total number of sequences. The ratio of the sequence number of the staphylococcus aureus to the total sequence number is reduced with the increase of the dilution factor of the sample, but the staphylococcus aureus with low abundance can still be detected. FIG. 2 shows the qPCR results, which can be found when the sample is diluted to 104After doubling, no staphylococcus aureus could be detected by qPCR.
Table 13 and FIG. 3 shows that the positive samples selected from known Candida albicans were diluted 10-fold in gradient with the same type of negative samples, and the samples were taken as stock solution, diluted 10-fold, and diluted 10-fold2Double dilution extraction the extracted DNA was detected using the invention and qPCR methods, respectively. Total reads in Table 13 represent the number of all the resulting sequences obtained using the sequencing of the present invention, reads represent the number of sequences detected using the sequencing of the present invention that could match Candida albicans, and percentages are the ratio of the number of detected Candida albicans sequences to the Total number of sequences. As the dilution factor of the sample is increased, the ratio of the sequence number of the candida albicans to the total sequence number is reduced, but the candida albicans with low abundance can be detected. FIG. 2 shows the qPCR results, which can be found when the sample is diluted to 102After doubling, no candida albicans could be detected by qPCR.
According to the comparison result of the detection methods of the two groups of gram-positive bacteria staphylococcus aureus positive samples and candida albicans positive samples, the following results are obtained:
the primer combination covering the area to be detected of the ITS genes of bacteria and fungi is designed to be matched with a nanopore sequencing technology, so that the nucleic acid of longer fragments of all pathogenic microorganisms possibly existing in a clinical sample can be detected simultaneously, the detection is rapid and accurate, the detection method has no capability in the detection means on the market, and the method has wide market prospect.
Other embodiments of the present invention than the preferred embodiments described above, and those skilled in the art can make various changes and modifications according to the present invention without departing from the spirit of the present invention, should fall within the scope of the present invention defined in the claims.
Sequence listing
<110> Hangzhou shengting medical technology Co Ltd
<120> quick microorganism identification method based on nanopore sequencer
<141> 2021-07-29
<160> 100
<170> SIPOSequenceListing 1.0
<210> 1
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 1
aggtcttcac gatacgtcga gcctatgggc agctccag 38
<210> 2
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 2
gtccaatcag ttgcagcttc agtacggtta ccttgttacg actt 44
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 3
aggtcttcac gatacgtcga gtccgtaggt gaacctgc 38
<210> 4
<211> 44
<212> DNA
<213> Artificial Sequence
<400> 4
gtccaatcag ttgcagcttc aggcaatccc aaacaactcg actc 44
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 5
aagaaagttg tcggtgtctt tgtg 24
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 6
tcgattccgt ttgtagtcgt ctgt 24
<210> 7
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 7
gagtcttgtg tcccagttac cagg 24
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 8
ttcggattct atcgtgtttc ccta 24
<210> 9
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 9
cttgtccagg gtttgtgtaa cctt 24
<210> 10
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 10
ttctcgcaaa ggcagaaagt agtc 24
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 11
gtgttaccgt gggaatgaat cctt 24
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 12
ttcagggaac aaaccaagtt acgt 24
<210> 13
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 13
aactaggcac agcgagtctt ggtt 24
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 14
aagcgttgaa acctttgtcc tctc 24
<210> 15
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 15
gtttcatcta tcggagggaa tgga 24
<210> 16
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 16
caggtagaaa gaagcagaat cgga 24
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 17
agaacgactt ccatactcgt gtga 24
<210> 18
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 18
aacgagtctc ttgggaccca taga 24
<210> 19
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 19
aggtctacct cgctaacacc actg 24
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 20
cgtcaactga cagtggttcg tact 24
<210> 21
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 21
accctccagg aaagtacctc tgat 24
<210> 22
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 22
ccaaacccaa caacctagat aggc 24
<210> 23
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 23
gttcctcgtg cagtgtcaag agat 24
<210> 24
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 24
ttgcgtcctg ttacgagaac tcat 24
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 25
gagcctctca ttgtccgttc tcta 24
<210> 26
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 26
accactgcca tgtatcaaag tacg 24
<210> 27
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 27
cttactaccc agtgaacctc ctcg 24
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 28
gcatagttct gcatgatggg ttag 24
<210> 29
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 29
gtaagttggg tatgcaacgc aatg 24
<210> 30
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 30
catacagcga ctacgcattc tcat 24
<210> 31
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 31
cgacggttag attcacctct taca 24
<210> 32
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 32
tgaaacctaa gaaggcaccg tatc 24
<210> 33
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 33
ctagacacct tgggttgaca gacc 24
<210> 34
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 34
tcagtgagga tctacttcga ccca 24
<210> 35
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 35
tgcgtacagc aatcagttac attg 24
<210> 36
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 36
ccagtagaag tccgacaacg tcat 24
<210> 37
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 37
cagacttggt acggttgggt aact 24
<210> 38
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 38
ggacgaagaa ctcaagtcaa aggc 24
<210> 39
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 39
ctacttacga agctgaggga ctgc 24
<210> 40
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 40
atgtcccagt tagaggagga aaca 24
<210> 41
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 41
gcttgcgatt gatgcttagt atca 24
<210> 42
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 42
accacaggag gacgatacag agaa 24
<210> 43
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 43
ccacagtgtc aactagagcc tctc 24
<210> 44
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 44
tagtttggat gaccaaggat agcc 24
<210> 45
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 45
ggagttcgtc cagagaagta cacg 24
<210> 46
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 46
ctacgtgtaa ggcatacctg ccag 24
<210> 47
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 47
ctttcgttgt tgactcgacg gtag 24
<210> 48
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 48
agtagaaagg gttccttccc actc 24
<210> 49
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 49
gatccaacag agatgccttc agtg 24
<210> 50
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 50
gctgtgttcc acttcattct cctg 24
<210> 51
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 51
gtgcaacttt cccacaggta gttc 24
<210> 52
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 52
catctggaac gtggtacacc tgta 24
<210> 53
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 53
actggtgcag ctttgaacat ctag 24
<210> 54
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 54
atggactttg gtaacttcct gcgt 24
<210> 55
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 55
gttgaatgag cctactgggt cctc 24
<210> 56
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 56
tgagagacaa gattgttcgt ggac 24
<210> 57
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 57
agattcagac cgtctcatgc aaag 24
<210> 58
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 58
caagagcttt gactaaggag catg 24
<210> 59
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 59
tggaagatga gaccctgatc tacg 24
<210> 60
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 60
tcactactca acaggtggca tgaa 24
<210> 61
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 61
gctaggtcaa tctccttcgg aagt 24
<210> 62
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 62
caggttactc ctccgtgagt ctga 24
<210> 63
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 63
tcaatcaaga agggaaagca aggt 24
<210> 64
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 64
catgttcaac caaggcttct atgg 24
<210> 65
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 65
agagggtact atgtgcctca gcac 24
<210> 66
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 66
cacccacact tacttcagga cgta 24
<210> 67
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 67
ttctgaagtt cctgggtctt gaac 24
<210> 68
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 68
gacagacacc gttcatcgac tttc 24
<210> 69
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 69
ttctcagtct tcctccagac aagg 24
<210> 70
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 70
ccgatccttg tggcttctaa cttc 24
<210> 71
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 71
gtttgtcata ctcgtgtgct cacc 24
<210> 72
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 72
gaatctaagc aaacacgaag gtgg 24
<210> 73
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 73
tacagtccga gcctcatgtg atct 24
<210> 74
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 74
accgagatcc tacgaatgga gtgt 24
<210> 75
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 75
cctgggagca tcaggtagta acag 24
<210> 76
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 76
tagctgactg tcttccatac cgac 24
<210> 77
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 77
aagaaacagg atgacagaac cctc 24
<210> 78
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 78
tacaagcatc ccaacacttc cact 24
<210> 79
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 79
gaccattgtg atgaaccctg ttgt 24
<210> 80
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 80
atgcttgtta catcaaccct ggac 24
<210> 81
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 81
cgacctgttt ctcagggata caac 24
<210> 82
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 82
aacaaccgaa cctttgaatc agaa 24
<210> 83
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 83
tctcggagat agttctcact gctg 24
<210> 84
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 84
cggatgaaca taggatagcg attc 24
<210> 85
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 85
cctcatcttg tgaagttgtt tcgg 24
<210> 86
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 86
acggtatgtc gagttccagg acta 24
<210> 87
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 87
tggcttgatc taggtaaggt cgaa 24
<210> 88
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 88
gtagtggacc tagaacctgt gcca 24
<210> 89
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 89
aacggaggag ttagttggat gatc 24
<210> 90
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 90
aggtgatccc aacaagcgta agta 24
<210> 91
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 91
tacatgctcc tgttgttagg gagg 24
<210> 92
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 92
tcttctacta ccgatccgaa gcag 24
<210> 93
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 93
acagcatcaa tgtttggcta gttg 24
<210> 94
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 94
gatgtagagg gtacggtttg aggc 24
<210> 95
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 95
ggctccatag gaactcacgc tact 24
<210> 96
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 96
ttgtgagtgg aaagatacag gacc 24
<210> 97
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 97
agtttccatc acttcagact tggg 24
<210> 98
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 98
gattgtcctc aaactgccac ctac 24
<210> 99
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 99
cctgtctgga agaagaatgg actt 24
<210> 100
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 100
ctgaacggtc atagagtcca ccat 24
Claims (8)
1. A method for rapidly identifying microorganisms based on a nanopore sequencer is characterized by comprising the following steps:
step one, designing an autonomously designed primer covering a to-be-detected region of the ITS genes of bacteria and fungi, wherein the sequence is SEQ 01-04;
step two, adding a AGGTCTTCACGATACGTCGAG base sequence to the 5 'end of the forward primer of SEQ01-04, adding a GTCCAATCAGTTGCAGCTTCAG base sequence to the 5' end of the reverse primer to obtain a sequence combined with the annealing time of the Barcode primer in the second round of amplification, and mixing the sequences combined with the annealing time of the Barcode primer in the second round of amplification to form a primer pool;
step three, receiving a sample and extracting DNA;
step four, adopting a primer pool to carry out first round amplification and purification; then selecting Barcode to carry out second round amplification and purification;
step five, constructing a final library;
and step six, performing nanopore sequencing on the final library, and analyzing and confirming pathogenic microorganisms infected by the sample.
2. The method for rapidly identifying microorganisms based on the nanopore sequencer according to claim 1, wherein the sequence bound to the Barcode primer during annealing in the second round of amplification in the second step is determined according to a concentration ratio of 1: 1: 1: 1 are mixed to form a primer pool.
3. The method for rapidly identifying microorganisms based on the nanopore sequencer according to claim 1, wherein the sample comprises: alveolar lavage fluid, sputum, pleural effusion, cerebrospinal fluid or EDTA anticoagulation.
4. The method for rapidly identifying microorganisms based on the nanopore sequencer according to claim 1, wherein the reaction system for the first round of amplification in the fourth step comprises: 2 PCR mix 12.5. mu.L, primer pool 3. mu.L, template DNA 9.5. mu.L; the reaction procedure is as follows: a 105 ℃ hot cover; 3min at 95 ℃; 30sec at 95 ℃, 1min at 62 ℃, 1min at 72 ℃ and 25 cycles; 3min at 72 ℃; hold at 4 ℃;
and purifying by using magnetic beads.
5. The method for rapidly identifying microorganisms based on a nanopore sequencer according to claim 1, wherein the reaction system for the second round of amplification in the fourth step comprises: 2 PCRmix 12.5 uL, Barcode primer 3 uL, first round amplification purification product 10.5 uL; the reaction procedure is as follows: a 105 ℃ hot cover; 3min at 95 ℃; 30sec at 95 ℃, 30sec at 64 ℃, 1min at 72 ℃ and 12 cycles; 3min at 72 ℃; hold at 4 ℃;
and purifying by using magnetic beads.
6. The method for rapidly identifying microorganisms based on the nanopore sequencer according to claim 1, wherein the concrete method for constructing the final library in the fifth step is as follows:
(1) library pooling to obtain library Mix DNA;
(2) and (3) repairing the tail end:
the end repairing reaction system is as follows: end prep Mix 415. mu.L, library Mix DNA X. mu.L, ddH2O50-X μ L; the PCR procedure was: heating the cover at 105 ℃, 15min at 25 ℃, 15min at 65 ℃ and Hold at 4 ℃;
(3) purifying magnetic beads;
(4) connecting a joint:
the joint connection reaction system is as follows: 25 mu L of DNA sample in the previous step, 10 mu L of connecting buffer, 5 mu L of Rapid DNA Ligase, 1 mu L of Adapter Mix and 9 mu L of ddH2O 9; the PCR procedure was: a 105 ℃ hot cover; 15min at 20 ℃; hold at 4 ℃;
(5) purifying magnetic beads;
(6) inspecting the quality of the product;
(7) the final library configuration system is: sequencing Buffer 18.8 μ L, Loading Beads 12.8 μ L, library X μ L, ddH2O 15.4-XμL。
7. The method for rapidly identifying microorganisms based on the Nanopore sequencer according to claim 1, wherein in the sixth step, the Nanopore is sequenced by using a MinION sequencer of Nanopore corporation, and a sequencing kit: SQK-LSK109, sequencing chip: and R9.
8. The method for rapidly identifying microorganisms based on the nanopore sequencer according to claim 1, wherein the nanopore sequencing is performed on the final library in the sixth step, and the specific steps of analyzing and confirming the pathogenic microorganism infected by the sample comprise:
a) performing quality inspection on the chip before the chip is mounted on a machine;
b) induction:
the configuration system of the inducer is as follows: flush Buffer 500 μ L, Flush Tether 15 μ L, ddH2O 200 μ L;
c) sample adding;
d) sequencing;
e) and (3) off-line data analysis:
and comparing the off-line data with the sequences in the database, analyzing the abundance of various strains in each sample, and determining the pathogenic microorganisms infected by the sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110863381.6A CN113667729A (en) | 2021-07-29 | 2021-07-29 | Rapid microorganism identification method based on nanopore sequencer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110863381.6A CN113667729A (en) | 2021-07-29 | 2021-07-29 | Rapid microorganism identification method based on nanopore sequencer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113667729A true CN113667729A (en) | 2021-11-19 |
Family
ID=78540696
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110863381.6A Pending CN113667729A (en) | 2021-07-29 | 2021-07-29 | Rapid microorganism identification method based on nanopore sequencer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113667729A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114196779A (en) * | 2021-12-27 | 2022-03-18 | 武汉明德生物科技股份有限公司 | Pathogenic microorganism detection method and kit based on targeted sequencing |
| CN116144812A (en) * | 2022-12-27 | 2023-05-23 | 上海亿康医学检验所有限公司 | Method and kit for classifying and identifying endometrial microorganisms |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662958A (en) * | 2020-02-18 | 2020-09-15 | 武汉臻熙医学检验实验室有限公司 | Construction method of library based on nanopore sequencing platform, method for identifying microorganisms and application |
| CN112176032A (en) * | 2020-10-16 | 2021-01-05 | 广州市达瑞生物技术股份有限公司 | Primer combination for nanopore sequencing and library building of respiratory pathogens and application thereof |
| CN112501268A (en) * | 2020-11-23 | 2021-03-16 | 广州市达瑞生物技术股份有限公司 | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit |
| CN112646868A (en) * | 2020-12-23 | 2021-04-13 | 赣南医学院 | Method for detecting pathogenic molecules based on nanopore sequencing |
-
2021
- 2021-07-29 CN CN202110863381.6A patent/CN113667729A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111662958A (en) * | 2020-02-18 | 2020-09-15 | 武汉臻熙医学检验实验室有限公司 | Construction method of library based on nanopore sequencing platform, method for identifying microorganisms and application |
| CN112176032A (en) * | 2020-10-16 | 2021-01-05 | 广州市达瑞生物技术股份有限公司 | Primer combination for nanopore sequencing and library building of respiratory pathogens and application thereof |
| CN112501268A (en) * | 2020-11-23 | 2021-03-16 | 广州市达瑞生物技术股份有限公司 | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit |
| CN112646868A (en) * | 2020-12-23 | 2021-04-13 | 赣南医学院 | Method for detecting pathogenic molecules based on nanopore sequencing |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114196779A (en) * | 2021-12-27 | 2022-03-18 | 武汉明德生物科技股份有限公司 | Pathogenic microorganism detection method and kit based on targeted sequencing |
| CN116144812A (en) * | 2022-12-27 | 2023-05-23 | 上海亿康医学检验所有限公司 | Method and kit for classifying and identifying endometrial microorganisms |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102912036B (en) | Quickly detection and the method for qualification inanimate object | |
| CN113667729A (en) | Rapid microorganism identification method based on nanopore sequencer | |
| CN109762915B (en) | Detection method of bacterial drug resistance gene and special kit thereof | |
| CN111269995A (en) | Primer group, kit and detection method for detecting pathogen | |
| CN112501268A (en) | Nanopore sequencing-based primer group and kit for rapidly identifying respiratory microorganisms and application of primer group and kit | |
| CN110904250B (en) | Multiplex fluorescent quantitative PCR primer, kit and detection method for detecting multiple bacteria | |
| CN110452974B (en) | Library construction sequencing method for detecting full length of 16S rDNA of bacteria | |
| WO2019001187A1 (en) | Multi-liquid phase gene chip detection primer, kit and method for rapidly distinguishing five pathogens in mouse respiratory tracts | |
| CN116287357A (en) | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing | |
| CN110408629B (en) | Mycobacterium tuberculosis H37Rv encoding gene and application thereof | |
| CN113265452A (en) | Bioinformatics pathogen detection method based on Nanopore metagenome RNA-seq | |
| CN113430303A (en) | Rapid identification method for 23 respiratory RNA viruses based on nanopore sequencer | |
| CN105603081B (en) | Non-diagnosis-purpose qualitative and quantitative detection method for intestinal microorganisms | |
| CN111549109A (en) | High-throughput pathogen microorganism gene detection screening method | |
| CN115948607B (en) | Method and kit for simultaneously detecting multiple pathogen genes | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN108165562B (en) | Mycobacterium tuberculosis H37Rv encoding gene and application thereof | |
| CN108165561B (en) | Mycobacterium tuberculosis H37Rv encoding gene and application thereof | |
| CN116083555A (en) | Biomarker combination for predicting or detecting keratoconus, detection agent and application | |
| CN110423835A (en) | Primer composition for lower respiratory tract the pathogenic microorganism examination | |
| CN114196779A (en) | Pathogenic microorganism detection method and kit based on targeted sequencing | |
| CN112626215B (en) | AML prognosis related gene expression detection kit | |
| CN115478114A (en) | Specific primer group of mycobacteria and fungal gene and sequencing method of mycobacteria and fungal infection | |
| CN114196743A (en) | Rapid detection method for pathogenic microorganisms and kit thereof | |
| CN112501321B (en) | Method for molecular typing of mycobacterium tuberculosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |