CN113652376A - Pathogenic vibrio harveyi and application thereof - Google Patents

Abstract

The invention provides a pathogenic vibrio harveyi and application thereof, wherein the vibrio harveyi is a novel vibrio harveyi strain with the preservation number of CGMCC No. 21205. The Vibrio harveyi RZFC-1 strain provided by the invention is obtained by screening from Chinese prawns; the Vibrio harveyi screened by the invention carries a virulence gene AP 4. Compared with the reported vibrio harveyi, the vibrio harveyi obtained by screening has stronger pathogenic capability; and the AP4 gene which is not existed in other Vibrio harveyi is amplified from the Vibrio harveyi. The strain can be used for screening products for preventing and controlling shrimp diseases and can also be used as an evaluation means of a functional feed additive for shrimps; and provides support for integration of prawn disease prevention and control technology and construction of a disease early warning system.

Description

Pathogenic vibrio harveyi and application thereof

Technical Field

The invention belongs to the technical field of aquatic disease microorganisms, and particularly relates to pathogenic vibrio harveyi and application thereof.

Background

In recent years, prawns as a crustacean and decapod breed with fast growth and strong adaptability have been rapidly developed at home and abroad, and are just one of the important aquatic resources in major distribution areas of asia, america and the like. The culture varieties of the Chinese prawns are used as the countries with the largest scale and the highest yield for culturing the prawns, and mainly comprise the litopenaeus vannamei, the penaeus chinensis, the penaeus monodon and the penaeus japonicus.

In recent years, due to the shortage of supply in the market, the cultivation area of each variety is rapidly expanded, and the yield reaches millions of tons. However, due to the lack of production experience and neglect of sustainable development concept, farmers excessively pursue economic benefits, and finally cause the occurrence or spread of various diseases such as bacterial diseases, virus diseases and the like, the prawn culture industry is in a chaotic state, and the economic loss reaches billions of yuan.

Researches show that various diseases such as bacteria, fungi, viruses, parasites and the like occur in different degrees in the prawn culture process, and vibriosis in bacterial diseases is one of important diseases which harm prawn breeding and culture, so that the screening and deep research of pathogenic bacteria have important significance for healthy culture.

Vibrio harveyi (Vibrio harveyi), also known as Vibrio harveyi, was named Vibrio harveyi by Baumann et al in 1980 and validated in 1981. Vibrio harveyi is a common conditional pathogen in the process of culturing seawater fish and shrimp, the bacterium has serious harm to cultured animals, especially prawns, and the disease occurrence peak period is mostly in spring and summer (water temperature is more than 22 ℃). Under the condition of proper external conditions, the Vibrio harveyi is propagated in large quantity and is infected through the wound or digestive tract of the animal until the viscera and the like are seriously diseased, thereby leading the cultured animal to die. So far, Vibrio harveyi is reported to be the main pathogenic bacterium for culturing prawns in many countries at home and abroad. In foreign countries, the disease has caused massive mortality in shrimp nursery larvae in countries and regions such as Thailand, India, Australia, Ecuador, Xiaunera, and the like. In China, the Vibrio harveyi is found to be the main pathogenic bacterium in Liu Wen, Chenyue faithful, Li Jun and the like, and can cause huge loss in each growth stage of the prawns.

At present, pathogenicity and pathogenic mechanism of vibrio harveyi strains are not clear, vibrio harveyi is little researched in a targeted way, and pathogenicity research of the vibrio harveyi is just started. Therefore, the method is extremely important for screening pathogenic bacteria aiming at disease symptoms and has important significance for the sustainable development of healthy culture.

Acute Hepatopancreas necroses Syndrome (AHPNS; or Acute Hepatopancreas Necross Disease, AHPND) is one of the most serious diseases affecting prawn culture in recent years. After the prawn has AHPND, the body color of the prawn is white, the prawn shell is softened, the food intake is obviously reduced, the activity is weakened, the activity is slow, the body surface of a small number of prawns has black spots, the color of the hepatopancreas is dull and white or the liver and pancreas is eroded red, the hepatopancreas of part of prawns are obviously atrophied or abnormally enlarged, the jejunum and the stomach are empty, the prawn can be ill and died after the prawn is put in the fry for 10 days, and the dying prawn rarely appears beside a pool or on the water surface.

In the prior art, different opinions exist on the pathogenesis of the acute hepatopancreatic necrosis of prawns, and vibrio infection is generally considered to be one of important causes. AHPND occurs in association with a variety of bacteria, so it is important to screen more specific AHPND pathogens. In China, Vibrio harveyi can cause acute hepatopancreas necrosis syndromes of Penaeus chinensis (Fenneropenaeus chinensis) and Penaeus vannamei (Litopenaeus vannamei), Penaeus elongatus (P.penicillatus) and Penaeus japonicus (P.japonica), which seriously jeopardize the development of aquaculture industry, but the report of Vibrio harveyi containing AP4 gene is not found.

Disclosure of Invention

The invention aims to provide pathogenic vibrio harveyi and application thereof, wherein the vibrio harveyi has specific properties compared with other reported vibrio harveyi and is a novel vibrio harveyi strain.

The invention provides a Vibrio harveyi (Vibrio harveyi) RZFC-1 which is preserved for 18 days 11 and 2020, is located in the China general microbiological culture Collection center of the China Committee for culture Collection of microorganisms of the institute of microbiology, No. 1 Xilu, Beijing area of oriented south, and No. 3 of the national institute of sciences, and the preservation number is CGMCC No. 21205.

The Vibrio harveyi RZFC-1 strain provided by the invention is obtained by screening from Chinese prawns;

the optimal growth conditions of the RZFC-1 strain provided by the invention are 30 ℃, the salinity is 3.0 percent and the pH is 8.0.

The nucleotide sequence of the virulence gene AP4 of the screened Vibrio harveyi RZFC-1 strain is as follows:

TAATTTCTTACGATTGGACTGTCGACCAAACGGAGGCGTCACAGAAGTAGACAGCAAACATACACCTATCATCCCGGAAGTCGGTCGTAGTGTAGACATTGAGAATACGGGACGTGGGGAGCTTACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGCGGCTGGAAAGTGGCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCTGATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGTCGTGGTTTCTGTACAATCTATTACCACTAAGAAGGTGCTCACATGACTAACGAATACGTTGTAACAATGTCATCTTTGACGGAATTTAACCCTAACAATGCTCGTAAAAGTTATTTATTTGATAACTATGAAGTTGATCCTAACTATGCTTTCAAAGCAATGGTTTCATTTGGTCTTTCAAATATTCCTTACGCGGGTGGTTTTTTATCAACGTTATGGAATATCTTTTGGCCAAATACGCCAAATGAGCCAGATATTGAAAACATTTGGGAACAATTACGTGACAGAATCCAAGATTTAGTAGATGAATCGATTATAGATGCCATCAATGGAATATTGGATAGCAAAATCAAAGAGACACGCGATAAAATTCAAGACATTAATGAGACTATCGAAAACTTCGGTTATGCTGCGGCAAAAGATGATTACATTGGTTTAGTTACTCATTACTTGATTGGACTTGAAGAGAACTTTAAGCGCGAGCTAGACGGTGATGAATGGCTTGGTTATGCGATATTGCCTCTATTAGCAACAACTGTAAGTCTTCAAATTACTTACATGGCTTGTGGTCTGGATTATAAGGATGAATTCGGTTTCACCGATTCTGATGTGCATAAGCTAACACGTAATATTGATAAGCTTTATGATGATGTATCGTCTTACATTACAGAACTCGCTGCGTGGGCTGATAACGACTCTTACAATAATGCAAACCAAGATAACGTGTATGATGAAGTGATGGGTGCTCGTAGTTGGTGTACGGTTCACGGCTTTGAACATATGCTTATTTGGCAAAAAATCAAAGAGTTGAAAAAAGTTGATGTGTTTGTTCACAGTAATTTAATTTCATATTCACCTGCTGTTGGTTTTCCTAGTGGTAATTTCAACTATATTGCTACAGGTACGGAAGATGAAATACCTCAACCCAATAAACCACTTT；

the vibrio harveyi provided by the invention can be used for evaluating the effect of products for preventing or treating shrimp vibriosis, and evaluating the effect of biological products for preventing or treating acute hepatopancreas necrosis from different levels by detecting different indexes such as immunity, metabolism and the like after prawn infection by attacking toxin.

Compared with the reported vibrio harveyi, the vibrio harveyi obtained by screening has stronger pathogenic capability; and the AP4 gene which is not existed in other Vibrio harveyi is amplified from the Vibrio harveyi. The strain can generate pathogenicity on litopenaeus vannamei, African penaeus monodon and Chinese prawn; can be used for screening products for preventing and controlling shrimp diseases and can also be used as a functional feed additive for shrimps; and provides support for integration of prawn disease prevention and control technology and construction of a disease early warning system.

Drawings

FIG. 1: a 16S rDNA phylogenetic tree of the strain; phylogenetic trees of the gyrB genes; HSP60 gene phylogenetic tree;

FIG. 2: plate culture of the strain;

FIG. 3: gram stain profile of the strain;

FIG. 4: AP4 gene amplification electropherogram, wherein lanes 1 and 2 are strain Y; lanes 3,4 are RZFC-1; lanes 5,6,7,8 are Vibrio harveyi 337376; lane 9 is a blank control; lane 10 is Marker;

FIG. 5: protein number maps in the thallus JT and the supernatant sq;

FIG. 6: growth curve graph of the strain;

FIG. 7: TIC map and m/z-rt distribution map;

FIG. 8: a primary KEGG metabolic enrichment map;

FIG. 9: heatmap and PCA plots;

FIG. 10: a differential metabolite KEGG bubble map;

FIG. 11: volcano plots of both strains.

Detailed Description

The present invention will be described in detail below with reference to examples and the accompanying drawings.

Example 1 isolation and purification of the Strain and biological identification of the 16S molecule

The manifestation of diseased penaeus chinensis is characterized by: the prawn body is white, the prawn shell is soft, the activity is weakened, and the action is slow; the color of the liver and the pancreas is pale and pale or the liver and the pancreas is erosive and red, and the liver and the pancreas of part of prawns are obviously atrophied or abnormally hypertrophic and necrotized, so that the jejunum and the stomach are empty.

The hepatopancreas of the sick Chinese prawn is picked up under aseptic condition, a sterile rod is adopted for grinding treatment, the grinded prawn is diluted by sterile water and coated on 2216E solid culture medium and TCBS culture medium, dominant single colony with consistent shape is picked up to be repeatedly carried out 2216E and TCBS culture medium streak culture (28 ℃,24 hours), finally the dominant colony is carried out purification culture, the dominant colony is preserved at minus 80 ℃ for standby, and then biological identification and molecular biological analysis are carried out. And the finally obtained strain is numbered as RZFC-1.

Pure cultured RZFC-1 strain is inoculated in 2216E culture medium, cultured for 20h at 28 ℃, and DNA is extracted according to the method of a broad-spectrum Genomic DNA miniprep Genomic DNA Extraction Kit (TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0). The reaction conditions and steps for PCR amplification and sequencing of the 16S rRNA gene are as follows: the reaction system contained: 10.5. mu.L of sterile water, 0.5. mu.L of each primer (16S rRNA universal primer 27F,1492R), 1. mu.L of template, and 12.5. mu.L of Premix TaqTM (Ex TaqTM Version 2.0plus dye). The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 94 deg.C for 1min, renaturation at 55 deg.C for 1min, extension at 72 deg.C for 2min, 30 cycles, and incubation at 72 deg.C for 6 min. The PCR amplification product was subjected to gene sequencing by Shanghai bioengineering technology. Homology analysis was performed by the Blast search system at NCBI.

The length of the 16S rRNA gene sequence amplified by the RZFC-1 (excluding a primer binding region) is 1423bp, homology search is carried out by NCBI Blast, and the searched sequence mainly comprises Vibrio harveyi (the similarity is 99 percent, and the coverage rate is 100 percent); the length of the gyrB gene sequence amplified by the RZFC-1 (excluding a primer binding region) is 1120bp, homology search is carried out on NCBI through Blast, and the gyrB gene sequence of the dominant strain naturally clusters with the gyrB gene sequence of the vibrio bacteria. Among the sequences retrieved, mainly Vibrio harveyi (Vibrio harveyi), the sequence coverage reached 99%. Phylogenetic trees of the strains are shown in FIG. 1. The length of the HSP60 gene sequence amplified by the RZFC-1 (excluding a primer binding region) is 523bp, homology search is carried out on NCBI through Blast, the HSP60 gene sequence of a dominant strain and the HSP60 gene sequence of Vibrio harveyi are naturally clustered, and the sequence coverage rate reaches 99%; the phylogenetic tree of its sequence is shown in FIG. 1.

The results are combined, the strain is determined to be Vibrio harveyi (Vibrio harveyi), which is named as RZFC-1 strain, and the strain is preserved in the China general microbiological culture Collection center of the institute of microbiology, China institute of sciences, No. 3, West Lu 1, Beijing, the sunward, with the preservation number of CGMCC No. 21205.

The RZFC-116S sequence is as follows (SEQ ID NO: 1):

CCCGGGGGGCGGCTACACATGCAGTCGAGCGGAACGAGTTATCTGAACCTTCGGGGAACGATAACGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTGGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATAATGCCTACGGGCCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTCGTGAGGAAGGTAGTGTAGTTAATAGCTGCATTATTTGACGTTAGCGACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAGATACTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAACTCTGAAACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCACCCTTATCCTTGTTTTAGCAAGCTATTAAAGT

the gyrB gene sequence is as follows (SEQ ID NO: 2):

ACGGAATACTTCATACAAGGTATCGGGCGGTCTTCACGGCGTAGGTGTTTCAGTAGTAAACGCACTGTCTGAAAAAGTGGTTCTGACTATCCACCGCGGCGGTCATATCCATACGCAAACTTACCATCACGGTGAGCCTCAAGCGCCACTAGCAGTAATTGGTGATACTGACCAAACTGGTACACAAATCCGTTTCTGGCCAAGTGCAGAAACATTCTCGAACACAGAATTTCACTACGACATCCTAGCGAAGCGTCTACGTGAACTTTCTTTCCTGAACTCTGGTGTTTCAATCAAACTGGTTGATGAGCGCGAAGCAGACAAGAGCGACCACTTCATGTTTGAAGGTGGTATCCAAGCGTTTGTTGAGCACCTAAACACCAACAAAACACCAATCATCGAGAAAATCTTCCACTTCGACTTTGAGCGCGAAGATGGTATCTCGGTAGAAGTGGCGATGCAGTGGAATGACGGTTTCCAAGAGAACATCTACTGTTTCACTAACAACATCCCACAACGCGACGGTGGTACTCACCTTGCGGGTTTCCGTGCAGCGCTAACGCGTACACTGAACTCTTTCATGGACAAAGAAGGCTTCTCTAAGAAAGCGAAAACAGCAACTTCTGGTGATGACGCGCGTGAAGGTCTAACTGCGGTTGTTTCGGTTAAAGTGCCTGATCCTAAGTTCTCAAGCCAAACTAAAGATAAACTGGTTTCTTCTGAAGTGAAGTCAGCGGTTGAATCAGCAATGGGTGAGAAACTGTCTGAGTTCCTAATTGAGAACCCGGCAGAAGCGAAGATGGTTTGTTCGAAAATCATCGATGCAGCTCGTGCTCGTGAAGCGGCGCGTAAAGCTCGTGAAATGACTCGTCGTAAAGGCGCACTAGACCTAGCAGGTCTGCCAGGCAAACTTGCAGACTGTCAGGAAAAAGATCCAGCACTCTCTGAACTATACATAGTGAGGGTGATTCGGCAGCGGCTCCGCAAAACAGGCCGTACCCGTAGAACCCAGCAATCCTACCGCTAAAGGTAAGATTCTTACCGTAGAAAAGCCGCGTTCCACCAAGAAGGCTTTCTTCCTCCAGAAGTAACCAACGCCTGATCACCTGCACTAGCGCTG

the HSP60 sequence is as follows (SEQ ID NO: 3):

CCGTACGACGTCTAAGCAGTTGCAGCGGGTATGAACCCAATGGACCTTAAGCGCGGTATCGACAAAGCAGTTATCGCAGCGGTTGAGCAACTAAAAGAGCTATCTGTTGAGTGTAACGACACTAAAGCTATCGCACAGGTTGGTACTATCTCTGCGAACTCTGACTCAAGCGTAGGTAACATCATTGCTGAAGCAATGGAAAAAGTTGGCCGCGACGGTGTTATCACGGTTGAAGAAGGTCAAGCACTACAAGATGAGCTAGACGTAGTAGAAGGTATGCAGTTCGACCGCGGTTACCTATCTCCTTACTTCATCAACAACCAAGAAGCAGGCAGCGTTGAGCTAGAAAACCCATTCATCCTTCTGATCGATAAGAAAGTATCGAACATCCGTGAACTTCTTCCAGCACTAGAAGCAGTAGCAAAAGCATCTCGCCCACTACTGATCATCGCTGAAGACGTAGAAGGTGAAGCACTAGCAACACTAGTTGTGAACAACATGCGTGGCATCTGGGAAAAGTTGA。

example 2 morphological Observation of RZFC-1

Inoculating the pure cultured RZFC-1 strain obtained by separation to a TCBS (trichloroacetic acid) plate and a 2216E plate, culturing at 28 ℃, and observing colony morphology and pigment generation; the single colony smear in the active growth phase is picked, dried and fixed on an alcohol lamp, gram staining is carried out, and the smear is observed under an oil microscope by an optical microscope.

The results show that: RZFC-1 on the TCBS culture medium is green and round, the surface is glossy, the bacterial colony is sticky, and a biomembrane is formed by liquid culture (figure 2).

Meanwhile, another Harvey arc strain Y obtained by screening is yellow on TCBS, the glossiness of a round colony is relatively poor, and a liquid culture biofilm forms. RZFC-1 was red and negative in gram stain and short rod-shaped as viewed under oil microscopy (FIG. 3). The Vibrio harveyi strain Y and the RZFC-1 strain are obtained by screening simultaneously, namely, the hepatopancreas of the sick Chinese prawn are picked up under the aseptic condition, a sterile rod is adopted for grinding, the grinded and diluted sterile water is coated and inoculated on a 2216E solid culture medium and a TCBS culture medium, dominant single colonies with consistent shapes are picked up and repeatedly subjected to 2216E and TCBS culture medium streak culture (28 ℃ and 24 hours), finally the dominant colonies are subjected to purification culture, the strains are preserved at-80 ℃ for standby, and biological identification and molecular biological analysis are subsequently carried out, so that the Vibrio harveyi strain Y is named.

Example 3 RZFC-1 pathogenicity study

The experimental study object selects strong-activity healthy Chinese prawn, Litopenaeus vannamei and African Penaeus monodon cultured in seawater. Respectively inoculating separated and purified dominant bacteria RZFC-1 and Y strains to 2216E culture medium, culturing at 28 deg.C for 20h, and diluting test bacteria liquid by 10 times series to concentration of 2.1 × 10⁷CFU/mL. Infecting a test bacteriumAdding 500mL of the solution into 20L of water, and soaking 20 penaeus chinensis for test; the same volume of sterile saline was used as a control. And (3) carrying out isolated culture in a test water tank, taking out the test prawn after soaking for 48h, completely changing water, temporarily culturing, observing the morbidity and mortality of the infected prawn every day, and taking the original infectious bacteria re-separated from the diseased prawn as a pathogenicity judgment index.

The results show that the apparent symptoms of the RZFC-1 experimental group of the prawns are activity reduction, gradual intestinal penetration, liver and pancreas chaos and whitening and death. The dominant strain is separated and purified from the hepatopancreas of the prawn with the disease symptoms, and the dominant strain and the RZFC-1 belong to the Vibrio harveyi through 16SRNA identification, and the biochemical properties are consistent. The cumulative mortality rate of 96h is respectively 0% of the control group and more than 60% of the RZFC-1 experimental group. The prawn performance of the Y and 337376 experimental groups is not obviously different from that of the control group, and the mortality rate is 0 percent.

Example 4 analysis of nutrient composition of RZFC-1 Strain

Culturing RZFC-1 in 2216E liquid culture medium for 24h, centrifuging at 5000rpm for 30min, collecting thallus, and determining crude protein content of thallus by Kjeldahl method; determining the crude fat content by a Soxhlet extraction method; measuring ash content after burning by a high-temperature furnace; the amino acid composition was analyzed by an S-433 Germany full-automatic amino acid analyzer.

The results show that: each 100g of the bacterial cells contains 4.50g of protein, less than 0.1g of fat and 4.8g of ash, and the sum of 18 hydrolyzed amino acids including aspartic acid, threonine and the like is 3.16 g.

Example 5 RZFC-1 Biochemical characterization

And (3) conventional physiological and biochemical identification: selecting appropriate amount of bacteria in sterile operation, inoculating into physiological and biochemical identification tube, culturing at 28 deg.C for 24 hr, and observing the result. The physiological and biochemical indexes comprise sucrose, arabinose, 3% NaCl glucose gas production, fiber two pond, 3% NaCl lactose, oxidase, mannitol, lysine decarboxylase, ornithine decarboxylase, VP test, arginine double hydrolase, nitrate reduction, phenol red glucose, methyl red and hemolytic test.

1) Identification results of Biolog GEN iii assay plates: the adjusted concentration of the bacterial solution was inoculated into a Biolog GEN III plate, and cultured at 28 ℃ for 48 hours, and the observation results are shown in Table 1.

Table 1: RZFC-1 physiological and biochemical characteristic table

2) And identifying the RZFC-1 strain GENIII, inoculating the bacterial liquid with the adjusted concentration to a GENIII identification plate, culturing for 48h at 28 ℃, and observing results are shown in Table 2.

Table 2: GENIII identification plate substrate property results

The physiological and biochemical characteristics of the strain are basically consistent with those of vibrio through a biochemical identification tube test. The detection of the Biolog Gen III third generation identification plate shows that the identification result is basically consistent with the physiological and biochemical properties of vibrio and the sensitivity of vibrio to chemical substances, and the subsequent comprehensive molecular biology technology is used for identification.

Example 6 detection of virulence Gene of Vibrio harveyi RZFC-1

The extraction of bacterial genome DNA adopts a Takara kit method. A prawn hepatopancreas necrosis syndrome pathogenic bacteria virulence gene primer AP4 is designed according to a reference document and synthesized by Shanghai, and the virulence gene carrying conditions of RZFC-1 and RZFC-2 are detected by PCR. The 20. mu.L PCR reaction contained: premix Taq^TM(Ex Taq^TMVersion 2.0plus dye) 10. mu.L, forward and reverse primers 10. mu.M each 1. mu.L, ddH2O 7. mu.L, template 1. mu.L. The PCR reaction conditions are as follows: 5min at 94 ℃; 30S at 94 ℃, 30S for renaturation, 90S for 72 ℃ extension, and 30 cycles; finally, the extension is carried out for 10min at 72 ℃ and the product is stored at 4 ℃. And detecting the PCR amplification result through agarose gel electrophoresis, and performing TA cloning and sequencing on the amplification product by Shanghai worker.

TABLE 3 virulence gene detection primers and target product size information table

The result shows that the gene strip amplified by the RZFC-1 has AP 4. And Y and the existing Vibrio harveyi 337376 have no such band.

The PCR amplification product of the AP4 gene is subjected to Shanghai's artificial sequencing, and the sequence detection result is as follows (SEQ ID NO: 4):

TAATTTCTTACGATTGGACTGTCGACCAAACGGAGGCGTCACAGAAGTAGACAGCAAACATACACCTATCATCCCGGAAGTCGGTCGTAGTGTAGACATTGAGAATACGGGACGTGGGGAGCTTACCATTCAATACCAATGGGGTGCGCCATTTATGGCTGGCGGCTGGAAAGTGGCTAAATCACATGTGGTACAACGTGATGAAACTTACCATTTACAACGCCCTGATAATGCATTCTATCATCAGCGTATTGTTGTAATTAACAATGGCGCTAGTCGTGGTTTCTGTACAATCTATTACCACTAAGAAGGTGCTCACATGACTAACGAATACGTTGTAACAATGTCATCTTTGACGGAATTTAACCCTAACAATGCTCGTAAAAGTTATTTATTTGATAACTATGAAGTTGATCCTAACTATGCTTTCAAAGCAATGGTTTCATTTGGTCTTTCAAATATTCCTTACGCGGGTGGTTTTTTATCAACGTTATGGAATATCTTTTGGCCAAATACGCCAAATGAGCCAGATATTGAAAACATTTGGGAACAATTACGTGACAGAATCCAAGATTTAGTAGATGAATCGATTATAGATGCCATCAATGGAATATTGGATAGCAAAATCAAAGAGACACGCGATAAAATTCAAGACATTAATGAGACTATCGAAAACTTCGGTTATGCTGCGGCAAAAGATGATTACATTGGTTTAGTTACTCATTACTTGATTGGACTTGAAGAGAACTTTAAGCGCGAGCTAGACGGTGATGAATGGCTTGGTTATGCGATATTGCCTCTATTAGCAACAACTGTAAGTCTTCAAATTACTTACATGGCTTGTGGTCTGGATTATAAGGATGAATTCGGTTTCACCGATTCTGATGTGCATAAGCTAACACGTAATATTGATAAGCTTTATGATGATGTATCGTCTTACATTACAGAACTCGCTGCGTGGGCTGATAACGACTCTTACAATAATGCAAACCAAGATAACGTGTATGATGAAGTGATGGGTGCTCGTAGTTGGTGTACGGTTCACGGCTTTGAACATATGCTTATTTGGCAAAAAATCAAAGAGTTGAAAAAAGTTGATGTGTTTGTTCACAGTAATTTAATTTCATATTCACCTGCTGTTGGTTTTCCTAGTGGTAATTTCAACTATATTGCTACAGGTACGGAAGATGAAATACCTCAACCCAATAAACCACTTT。

example 7 extracellular product (ECP) Activity assay

The ECP is prepared by a flat glass paper method, and specifically, the strain RZFC-1 is inoculated and streaked on a TSA flat plate on which sterile glass paper is paved in advance, the strain is washed by sterile physiological saline after being cultured for 24 hours at 28 ℃, the strain is centrifuged at 6000rpm for 20min at 4 ℃, supernatant is collected, the supernatant is filtered by a 0.22 mu M microporous membrane, the supernatant is freeze-dried in a freeze-dryer, freeze-dried powder is collected and resuspended by proper amount of physiological saline, the protein concentration is determined by a BSA method, and the physiological saline is adjusted to 1mg/mL for standby. Skim milk plates (5% skim milk powder), rabbit blood plates (5% defibrinated rabbit blood), starch plates (0.2% soluble starch), urea plates (2% urea, 0.2% phenol red), tween 80 (1% tween 80) plates, lecithin plates (5% egg yolk liquid) and DNA plates (0.2% DNA and 0.01% toluidine blue) were prepared, and ECP prepared was inoculated onto the plates using the oxford cup method, 200 μ L per well, after 24h incubation at 28 ℃, the production of transparent circles was observed, and the production of proteases, hemolysins, amylases, urease, lipases and dnases in ECP was judged, with the results shown in table 4.

Table 4: RZFC-1 virulence gene and extracellular product detection result table

Example 8 liquid phase-Mass Spectrometry protein analysis of Vibrio harveyi RZFC-1

Sample preparation: RZFC-1 was cultured overnight in an inorganic salt medium (glucose 5g, glycine 3g, sodium chloride 19.45g, ferric citrate 0.1g, magnesium chloride 5.98g, calcium chloride 1.8g, potassium chloride 0.55g, disodium hydrogen phosphate 0.008g, sodium carbonate 0.16g, pH 7.6 + -0.2,1000 ml distilled water), and then cultured with cell JT and culture supernatant SQ collected separately, and protein analysis was performed by the LC-MS technique.

Sample treatment: the protein in the eluate was precipitated by acetone, washed with acetone and dried, and then 8M Urea/100mM Tris-HCl solution (pH 8.0) was added to the protein precipitate to dissolve the protein sufficiently. Centrifuging at 12000 Xg for 15 min, collecting supernatant, adding Dithiothreitol (DTT) to a final concentration of 10mM, and incubating at 37 deg.C for 1h to perform reduction reaction to open disulfide bond; subsequently, Iodoacetamide (IAA) was added to a final concentration of 40mM, and alkylation was performed at room temperature in the dark to block the thiol group. An appropriate volume of 100mM Tris-HCl solution (pH 8.0) was added, the protein concentration was quantified by the Bradford method, the Urea concentration was diluted to 2M or less, Trypsin was added to the amount of 50:1 protein to the amount of pancreatin, and digestion was carried out overnight with incubation and shaking at 37 ℃. The next day, TFA was added to stop the cleavage, the pH of the solution was adjusted to around 6.0, and the solution was centrifuged at 12000 Xg for 15 minutes and desalted using a C18 cartridge. And (3) after the desalting, draining the peptide fragment solution by a centrifugal concentrator, and freezing and storing the peptide fragment solution at the temperature of minus 20 ℃ for on-machine detection.

Detection and analysis: mass spectrometry was performed using a TripleTOF 5600+ LC-MS system from SCIEX. The samples were separated by a liquid phase eksiogen microLC 415 system with microliter flow rate. The peptide fragment sample was dissolved in loading buffer, aspirated by an autosampler, bound to a C18 capture column (5 μm,

300 μm × 5mm) and then eluted to an analytical column (3 μm,

300 μm × 15 mm). An analytical gradient was established using two mobile phases (mobile phase A: 3% DMSO, 0.1% formic acid, 97% H2O and mobile phase B: 3% DMSO, 0.1% formic acid, 97% ACN). The flow rate of the liquid phase was set to 5. mu.L/min. For mass spectrum DDA mode analysis, each scanning cycle comprises one MS full scan (scan range 350-1500 m/z, acquisition time 250MS), and then 40 MS/MS scans (scan range 100-1500 m/z, acquisition time 50 MS). The signal of the peptide fragment ions with the signal of more than 120cps (+ 2- +5) triggers MS/MS scanning. The exclusion time for MS/MS duplicate acquisitions was set at 18 s.

And (3) data analysis: the mass spectra data generated by TripleTOF 5600+ were retrieved by ProteinPilot (V4.5) using the database retrieval algorithm, Paragon. The database used for the search was the proteome reference database of Vibrio _ harveyi in UniProt. The search parameters are as follows: the Sample Type selects Identification; selecting Iodoacetamide from Cys Alkylation; digestion selects Trypsin; the Search efficiency is set to Rapid ID. And screening the retrieval result by taking Ununsed not less than 1.3 as a standard, deleting the retrieved items and the pollution protein in the anti-library, and using the remaining identification information for subsequent analysis. And (4) opening a corresponding txt file by using excel for viewing in a raw data folder according to the identification result before screening.

The protein with Ununsed more than or equal to 1.3 is screened out by mass spectrum detection of the sample, and the number of the identified protein in the sample is shown in figure 4. The scores, peptide fragments and spectra of the proteins are shown in Table 5. Based on the experience that the more abundant the protein, the more the spectrum number is collected, the amount of the spectrum number can be referred to roughly reflect the abundance or low of the protein in the sample.

Table 5: partial results table for protein identification

Example 9 growth of RZFC-1 Strain and Effect of its culture conditions (salinity, temperature, pH)

RZFC-1 growth curve: the OD was measured every 2 hours by culturing in 2216E medium at 28 ℃ and 120rpm for 24 hours_560nmValues, RZFC-1 growth curves were plotted. As shown in FIG. 6, the strain was in the logarithmic growth phase of the strain at 4h to 20h, and the strain growth was in the stationary phase after 20 h.

Inoculating RZFC-1 bacteria solution with the same volume with 2216E as basal medium, adjusting conditions of different salinity (0.5%, 1.0%, 2.0%, 3.0%), different temperature (28 deg.C, 30 deg.C, 32 deg.C), different pH (6.0/6.5/7.0/7.5/8.0), culturing for 24 hr under the same conditions, and determining OD_560nmThe values determine the RZFC-1 growth conditions. The results showed that the optimum growth conditions for RZFC-1 were 30 ℃, 3.0% salinity, 8.0 pH (Table 6)

Table 6: growth Condition Table of RZFC-1 Strain

Example 10 antagonistic Effect between RZFC-1 Strain and antibiotics

Different antibiotic (tetracycline, florfenicol, levofloxacin, sulfadiazine, terramycin, penicillin, streptomycin, gentamicin, kanamycin and azithromycin) standard substances are added into the TCBS culture plate, the final concentration of the antibiotic is 10 mu g/ml, the volume of each plate culture medium is 15ml, and a negative control (TCBS culture medium) and a positive control (the TCBS culture medium is coated with Vibrio harveyi RZFC-1) are set. The volume of the coating inoculated Vibrio harveyi RZFC-1 is 200 mul.

The result shows that penicillin and sulfadiazine have no inhibition on the growth of RZFC-1, kanamycin has inhibition, and tetracycline, levofloxacin, florfenicol, terramycin, streptomycin, gentamicin and azithromycin have obvious inhibition effect on the growth of RZFC-1.

Example 11 Effect of RZFC-1 on the immunization of prawn

Experiment design: the post-culture challenge test of the prawns in the culture base of the Shandong province marine organism research institute is carried out for 14 days. Selecting healthy litopenaeus vannamei with consistent and uniform specification (the initial body mass is about 8.2 +/-0.1 g.tail)^-1) Temporarily culturing in culture box (80cm × 60cm × 70cm, about 300L culture water body) for 1 week, and then randomly dividing into 2 groups of 3 replicates each, each of which is 100 replicates. In the experimental process, basic compound feed (provided by Qingdao Saigraining bioengineering Co., Ltd.) without any additive is fed, and the RZFC-1 challenge experiment is carried out after temporary culture for 7 d. The control group was injected with sterile physiological saline, and the dose of toxic-counteracting administration in the test group was 10 in the preliminary experiment⁷CFU/ml。

The culture conditions are as follows: in the test process, the feed feeding amount is 8-10% of the body mass, the feeding is carried out 5 times per day (6:00, 10:00, 14:00, 18:00 and 22:00), and the feeding amount is specifically adjusted according to the weather, the residual feed and the feeding conditions of the day. During the culture process, water is changed for 1 time at 10:00 am every day, the water change amount is 30 percent of the total water body, the water temperature is maintained at 28-29 ℃, the pH value is 8.0-8.5, the salinity is 35-36, and the dissolved oxygen amount is (7.5 +/-0.5) mg.L^-1The total ammonia nitrogen in the water body is less than 0.5 mg.L^-1。

The experimental method comprises the following steps:

at 7d of the experimental procedure, 0.2mL of blood was aspirated from the heart of each shrimp through a 1.0mL disposable syringe (6 shrimp blood samples were taken in each repetition) and mixed immediately after mixing5000 rpm/min at 4 DEG C^-1Centrifuging for 10min, collecting supernatant, storing at-80 deg.C, and testing. And (3) determining the glucose content, the free fatty acid content and the nitric oxide content in the serum of the 7 th experimental prawn by adopting a kit of the Nanjing institute of bioengineering. The activity of glutamine synthetase, succinate dehydrogenase and hexokinase in the 7 th serum sample is determined by adopting a kit of Nanjing institute of bioengineering. The phosphofructokinase activity, the acetyl coenzyme A carboxylase activity and the glucose-6-phosphatase activity are determined by adopting a Beijing Solarium kit.

Test procedure 7d 10 shrimps were taken from each parallel group, and intestinal samples were taken aseptically on ice, pre-cooled 0.85% saline was added at a ratio of 1:9(m/v), homogenized in an ice bath, centrifuged at 2500rpm for 10min, and the supernatant was used to determine the activity of digestive enzymes. The activities of amylase, lipase and trypsin are all measured by adopting the kit method of Nanjing institute of bioengineering. And (3) determining the contents of total protein, total cholesterol and triglyceride in the 7 th intestinal tract sample by using a kit of Nanjing institute of bioengineering. The total antioxidant capacity, the activities of catalase, superoxide dismutase and glutathione peroxidase were measured by using Nanjing institute of bioengineering kit.

In the 7 th day of the experiment, 10 shrimps were taken from each parallel group, a hepatopancreas sample was taken by aseptic technique on ice, pre-cooled 0.85% physiological saline was added at a ratio of 1:9(m/v), homogenized in ice bath, centrifuged at 2500rpm for 10min, and the supernatant was taken for use. The activity of adenosine deaminase, cholinesterase, glutamic-pyruvic transaminase and glutamic-oxalacetic transaminase in the 7 th hepatopancreatic sample is determined by adopting a kit of Nanjing institute of bioengineering.

The experimental results are as follows: the screened Vibrio harveyi RZFC-1 can obviously reduce the activities of glutamine synthetase and succinate synthetase in the serum of prawn, reduce the content of nitric oxide, reduce the activities of glucose-6-phosphatase and acetyl coenzyme A carboxylase, improve the content of glucose in the serum and promote the activities of hexokinase and phosphofructokinase. The vibrio harveyi influences the intestinal digestion function of the prawns and reduces the activities of lipase and pepsin; meanwhile, the activity of intestinal immunity indexes of the prawns is influenced, the contents of total proteins and triglyceride in the intestinal tracts are reduced, and the activities of the total oxidation resistance, superoxide dismutase, glutathione peroxidase and other activities related to the oxidation resistance function are reduced. The vibrio harveyi affects the hepatopancreatic function of the prawns, increases the liver burden, and improves the activities of glutamic-pyruvic transaminase and glutamic-oxalacetic transaminase.

Table 7: influence table of RZFC-1 on organism immunity index

Example 12 metabolome differential analysis of pathogenic RZFC-1 and avirulent strains Y of the same type

The difference of the RZFC-1 and the low-toxicity pathogen Y in the metabolome is analyzed, and the specific experimental process is as follows:

firstly, an organic reagent protein precipitation method is used for carrying out metabolite extraction on two samples RZFC-1 and Y (6 parallel samples respectively), and a Quality Control (QC) sample is prepared at the same time (prepared experiment samples with equal quantity are mixed to form the product). And (4) randomly sequencing and detecting the extracted samples, and respectively inserting QC samples in front of, in the middle of and behind the samples as experimental techniques for repeated evaluation. And respectively carrying out mass spectrum scanning detection on the sample in a positive and negative ion mode.

The information analysis process is as follows:

1) the MS convert software of Proteowizard is used to convert the raw data of mass spectrometer into readable data format mzXML.

2) And (3) performing peak extraction and quality control by using XCMS software, and performing addition ion annotation on the extracted substances by using CAMERA.

3) MetaX software is used for identifying metabolites (database matching identification is carried out on the primary mass spectrum information, and matching identification is carried out on the secondary mass spectrum information and an in-house standard database).

4) And (4) annotating the metabolites of the candidate identification substances by using databases such as HMDB, KEGG and the like, and explaining the physicochemical properties and the biological functions of the metabolites.

5) The metabolites were quantified and differential metabolites were screened using metaX software.

The results were analyzed as follows:

1. total ion flow map TIC and metabolite m/z-rt profiles (FIG. 7):

the TIC plot is plotted on the abscissa for time points and on the ordinate for the total intensity of all ions in the mass spectrum for each time point, each color representing a sample. The results in FIG. 7 show that the overall mass spectrum signal intensity of the sample has good stability and reliability.

The metabolic ion profile m/z-rt is plotted with retention time on the abscissa and m/z on the ordinate. Each point represents a substance, and the color represents the density of the substance in the area; darker colors correspond to a greater number of Feature numbers. Provides a basis for the identification of the subsequent metabolites.

2. Primary KEGG identification of metabolites

Through the first-level metabolite enrichment statistical result data, the differential metabolites are probably known, and a foundation is laid for the subsequent secondary metabolite analysis (figure 8).

3. Metabolite identification heatmap

As can be seen from FIG. 9, Heatmap and PCA, there was a clear difference in the amounts of metabolites of RZFC-1 and Y strains of Vibrio harveyi.

4. Differential metabolite comparison

Figure 10 enrichment analysis results for KEGG using ggplot2 are shown in a scatter plot: rich Factor represents the number of differential genes located in the KEGG/total gene factors located in the KEGG, the smaller the P value, the higher the enrichment degree of the KEGG, and FIG. 10 shows that the enrichment is mainly present in purine metabolism, cAMP signal metabolism, cGMP-PKG signal metabolism, and the like.

5. Differential metabolite analysis

The volcano plots in fig. 11 can conveniently and intuitively show the distribution of gene differential expression between two samples. In general, the abscissa is represented by log2(fold change), the more different genes are distributed at both ends, the ordinate is represented by-log 10(pvalue), and the negative logarithm of the P-value of significance is T-tested.

In conclusion, the strain can be used for screening prawn disease control products and can also be used as a prawn functional feed additive evaluation way; and provides support for integration of prawn disease prevention and control technology and construction of a disease early warning system.

Sequence listing

<110> Shandong province ocean science research institute (Qingdao national ocean science research center)

<120> a strain of vibrio harveyi with pathogenicity and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1114

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cccggggggc ggctacacat gcagtcgagc ggaacgagtt atctgaacct tcggggaacg 60

ataacggcgt cgagcggcgg acgggtgagt aatgcctggg aaattgccct gatgtggggg 120

ataaccattg gaaacgatgg ctaataccgc ataatgccta cgggccaaag agggggacct 180

tcgggcctct cgcgtcagga tatgcctagg tgggattagc tagttggtga ggtaagggct 240

caccaaggcg acgatcccta gctggtctga gaggatgatc agccacactg gaactgagac 300

acggtccaga ctcctacggg aggcagcagt ggggaatatt gcacaatggg cgcaagcctg 360

atgcagccat gccgcgtgtg tgaagaaggc cttcgggttg taaagcactt tcagtcgtga 420

ggaaggtagt gtagttaata gctgcattat ttgacgttag cgacagaaga agcaccggct 480

aactccgtgc cagcagccgc ggtaatacgg agggtgcgag cgttaatcgg aattactggg 540

cgtaaagcgc atgcaggtgg tttgttaagt cagatgtgaa agcccggggc tcaacctcgg 600

aattgcattt gaaactggca gactagagta ctgtagaggg gggtagaatt tcaggtgtag 660

cggtgaaatg cgtagagatc tgaaggaata ccggtggcga aggcggcccc ctggacagat 720

actgacactc agatgcgaaa gcgtggggag caaacaggat tagataccct ggtagtccac 780

gccgtaaacg atgtctactt ggaggttgtg gccttgagcc gtggctttcg gagctaacgc 840

gttaagtaga ccgcctgggg agtacggtcg caagattaaa actcaaatga attgacgggg 900

gcccgcacaa gcggtggagc atgtggttta attcgatgca acgcgaagaa ccttacctac 960

tcttgacatc cagagaactt tccagagatg gattggtgcc ttcgggaact ctgaaacagg 1020

tgctgcatgg ctgtcgtcag ctcgtgttgt gaaatgttgg gttaagtccc gcaacgagcg 1080

cacccttatc cttgttttag caagctatta aagt 1114

<210> 2

<211> 1120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acggaatact tcatacaagg tatcgggcgg tcttcacggc gtaggtgttt cagtagtaaa 60

cgcactgtct gaaaaagtgg ttctgactat ccaccgcggc ggtcatatcc atacgcaaac 120

ttaccatcac ggtgagcctc aagcgccact agcagtaatt ggtgatactg accaaactgg 180

tacacaaatc cgtttctggc caagtgcaga aacattctcg aacacagaat ttcactacga 240

catcctagcg aagcgtctac gtgaactttc tttcctgaac tctggtgttt caatcaaact 300

ggttgatgag cgcgaagcag acaagagcga ccacttcatg tttgaaggtg gtatccaagc 360

gtttgttgag cacctaaaca ccaacaaaac accaatcatc gagaaaatct tccacttcga 420

ctttgagcgc gaagatggta tctcggtaga agtggcgatg cagtggaatg acggtttcca 480

agagaacatc tactgtttca ctaacaacat cccacaacgc gacggtggta ctcaccttgc 540

gggtttccgt gcagcgctaa cgcgtacact gaactctttc atggacaaag aaggcttctc 600

taagaaagcg aaaacagcaa cttctggtga tgacgcgcgt gaaggtctaa ctgcggttgt 660

ttcggttaaa gtgcctgatc ctaagttctc aagccaaact aaagataaac tggtttcttc 720

tgaagtgaag tcagcggttg aatcagcaat gggtgagaaa ctgtctgagt tcctaattga 780

gaacccggca gaagcgaaga tggtttgttc gaaaatcatc gatgcagctc gtgctcgtga 840

agcggcgcgt aaagctcgtg aaatgactcg tcgtaaaggc gcactagacc tagcaggtct 900

gccaggcaaa cttgcagact gtcaggaaaa agatccagca ctctctgaac tatacatagt 960

gagggtgatt cggcagcggc tccgcaaaac aggccgtacc cgtagaaccc agcaatccta 1020

ccgctaaagg taagattctt accgtagaaa agccgcgttc caccaagaag gctttcttcc 1080

tccagaagta accaacgcct gatcacctgc actagcgctg 1120

<210> 3

<211> 523

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccgtacgacg tctaagcagt tgcagcgggt atgaacccaa tggaccttaa gcgcggtatc 60

gacaaagcag ttatcgcagc ggttgagcaa ctaaaagagc tatctgttga gtgtaacgac 120

actaaagcta tcgcacaggt tggtactatc tctgcgaact ctgactcaag cgtaggtaac 180

atcattgctg aagcaatgga aaaagttggc cgcgacggtg ttatcacggt tgaagaaggt 240

caagcactac aagatgagct agacgtagta gaaggtatgc agttcgaccg cggttaccta 300

tctccttact tcatcaacaa ccaagaagca ggcagcgttg agctagaaaa cccattcatc 360

cttctgatcg ataagaaagt atcgaacatc cgtgaacttc ttccagcact agaagcagta 420

gcaaaagcat ctcgcccact actgatcatc gctgaagacg tagaaggtga agcactagca 480

acactagttg tgaacaacat gcgtggcatc tgggaaaagt tga 523

<210> 4

<211> 1217

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taatttctta cgattggact gtcgaccaaa cggaggcgtc acagaagtag acagcaaaca 60

tacacctatc atcccggaag tcggtcgtag tgtagacatt gagaatacgg gacgtgggga 120

gcttaccatt caataccaat ggggtgcgcc atttatggct ggcggctgga aagtggctaa 180

atcacatgtg gtacaacgtg atgaaactta ccatttacaa cgccctgata atgcattcta 240

tcatcagcgt attgttgtaa ttaacaatgg cgctagtcgt ggtttctgta caatctatta 300

ccactaagaa ggtgctcaca tgactaacga atacgttgta acaatgtcat ctttgacgga 360

atttaaccct aacaatgctc gtaaaagtta tttatttgat aactatgaag ttgatcctaa 420

ctatgctttc aaagcaatgg tttcatttgg tctttcaaat attccttacg cgggtggttt 480

tttatcaacg ttatggaata tcttttggcc aaatacgcca aatgagccag atattgaaaa 540

catttgggaa caattacgtg acagaatcca agatttagta gatgaatcga ttatagatgc 600

catcaatgga atattggata gcaaaatcaa agagacacgc gataaaattc aagacattaa 660

tgagactatc gaaaacttcg gttatgctgc ggcaaaagat gattacattg gtttagttac 720

tcattacttg attggacttg aagagaactt taagcgcgag ctagacggtg atgaatggct 780

tggttatgcg atattgcctc tattagcaac aactgtaagt cttcaaatta cttacatggc 840

ttgtggtctg gattataagg atgaattcgg tttcaccgat tctgatgtgc ataagctaac 900

acgtaatatt gataagcttt atgatgatgt atcgtcttac attacagaac tcgctgcgtg 960

ggctgataac gactcttaca ataatgcaaa ccaagataac gtgtatgatg aagtgatggg 1020

tgctcgtagt tggtgtacgg ttcacggctt tgaacatatg cttatttggc aaaaaatcaa 1080

agagttgaaa aaagttgatg tgtttgttca cagtaattta atttcatatt cacctgctgt 1140

tggttttcct agtggtaatt tcaactatat tgctacaggt acggaagatg aaatacctca 1200

acccaataaa ccacttt 1217

Claims (8)

1. The Vibrio harveyi is characterized in that the preservation number of the Vibrio harveyi is CGMCC No. 21205.

2. The Vibrio harveyi of claim 1, wherein the Vibrio harveyi is selected from a Chinese prawn.

3. The Vibrio harveyi of claim 1, wherein the Vibrio harveyi contains a virulence gene AP 4.

4. The Vibrio harveyi of claim 1, wherein the Vibrio harveyi contains a virulence gene AP 4.

5. The Vibrio harveyi of claim 4, wherein the virulence gene AP4 has the nucleic acid sequence of SEQ ID NO. 4.

6. A method for culturing Vibrio harveyi according to claim 1, wherein the culturing temperature is 30 ℃, the salinity is 3.0%, and the pH is 8.0.

7. The use of the Vibrio harveyi of claim 1 in the preparation of a shrimp vibriosis detection model.

8. Use of Vibrio harveyi according to claim 1 in screening for a preparation for preventing or treating shrimp acute hepatopancreatic necrosis.

Images