CN113648318A

CN113648318A - Use of enhancing cellular thermogenesis and treating disease

Info

Publication number: CN113648318A
Application number: CN202010399851.3A
Authority: CN
Inventors: 丁秋蓉; 邱艳; 应浩
Original assignee: Shanghai Institute of Nutrition and Health of CAS
Current assignee: Shanghai Institute of Nutrition and Health of CAS
Priority date: 2020-05-12
Filing date: 2020-05-12
Publication date: 2021-11-16
Anticipated expiration: 2040-05-12
Also published as: CN113648318B

Abstract

The present invention provides the use of an agent for increasing UCP1 expression or activity in a cell, or for enhancing heat production in a cell, or for the manufacture of an agent for the treatment or prevention of a disease benefiting from thermogenesis of fat, for inhibiting weight gain in a subject, or for reducing fat content in a subject, said agent being selected from one or more of: (1) a compound of formula (I) or a pharmaceutically acceptable salt or solvate or analog thereof, wherein R1-R10 are each independently selected from the group consisting of hydrogen, halogen, hydroxyl, and alkyl, (2) an agent that upregulates expression or activity of a calcium channel-associated protein or subunit thereof, (3) a calcium channel activator, (4) an agent that upregulates expression or activity of calcineurin, and (5) an agent that upregulates expression or activity of NFAT.

Description

Use of enhancing cellular thermogenesis and treating disease

Technical Field

The present invention relates to the use of agents to enhance cellular thermogenesis and to treat diseases, and in particular to the use of agents to enhance cellular thermogenesis and to treat obesity and related metabolic diseases.

Background

Glyburide (Glyburide, also known as Glyburide) is a sulfonylurea hypoglycemic agent that has been approved by the FDA for the treatment of type 2 diabetes. Glibenclamide targets islet beta cells, and closes by binding to SUR1 subunit of ATP-sensitive potassium ion channel (KATP) on the cell membrane, thereby secreting insulin and lowering blood glucose. The research suggests that the exchange factor (Epac2) of the small molecule G protein Rap1 of guanine nucleotide is the direct binding target of sulfonylurea hypoglycemic compound and can promote insulin secretion. Caveolin (Caveolin) is believed to play an important role in transmembrane signal transduction caused by sulfonylurea hypoglycemic agents, Caveolin1(Cav1) is a main integral membrane protein of a cave-like invagination on the cell surface, Cav1 is expressed in a large amount in fat cells and plays an important role in the signal transduction process. Glibenclamide promotes Ca²⁺By voltage-gated calcium ion channels, intracellular Ca is further enabled²⁺Increased levels, and Ca entry into cells with higher glyburide concentrations²⁺The more, this can be inhibited by Nitrendipine (Nitrendipine), which is a calcium channel inhibitor. TRPV2 (a non-selective cation channel) was reported to play an important role in non-shivering thermogenesis in mouse brown adipose tissue. In addition, glyburide is believed to be useful in the treatment of cerebral ischemia and stroke, targeting the SUR1-TRPM4 ion channel.

Obesity is a chronic metabolic disease caused by various factors and is characterized by abnormal increase in the percentage of body fat to body weight due to increase in the volume and cell number of fat cells in the body and excessive deposition of fat in some parts. Current anti-obesity drugs limit energy intake mainly by reducing fat absorption or suppressing appetite, however clinical effects are not obvious and have side effects. There is no medicine for treating obesity by increasing energy utilization in clinic, and the energy of body is consumed in the form of heat energy by increasing thermogenesis function of brown adipose tissue BAT, so that it can be used as target for treating obesity and related metabolic diseases. The thermogenesis function of the brown fat is mostly realized by uncoupling protein UCP1, so that UCP1 is a marker protein of the brown fat and can be used as a target for treating obesity and related metabolic diseases.

Disclosure of Invention

The invention provides the use of a compound represented by the following formula (I) or a pharmaceutically acceptable salt or solvate thereof in increasing the expression or activity of UCP1 in a cell, or in enhancing the heat production of a cell, or in the preparation of an agent for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject,

R1-R10 are each independently selected from hydrogen, halogen, hydroxy and C1-C3 alkyl, R11 is pyrrole, pyrroline, phenyl substituted with one or more substituents selected from oxygen, C1-C3 alkyl, C1-C3 alkoxy, halogen, hydroxy.

In one or more embodiments, R1-R10 are each independently selected from hydrogen and halogen, and R11 is phenyl substituted with one or more substituents selected from halogen, C1-C3 alkoxy. In one or more embodiments, R1-R10 are each independently selected from hydrogen and halogen, and R11 is phenyl substituted with one or more substituents selected from chloro, methoxy. In one or more embodiments, R1-R10 are hydrogen and R11 is 2-methoxy-5-chlorophenyl.

In other one or more embodiments, R1-R10 are each independently selected from hydrogen and C1-C3 alkyl, and R11 is pyrroline substituted with one or more substituents selected from oxygen, C1-C3 alkyl. In one or more embodiments, R1-R10 are each independently selected from hydrogen and methyl, and R11 is pyrroline substituted with one or more substituents selected from oxygen, methyl, ethyl. In one or more embodiments, R1-R3 and R5-R10 are hydrogen, R4 is methyl, and R11 is 3-ethyl-4-methyl-2-oxo-3-pyrroline.

In one or more embodiments, the compound is a compound of formula (II)

Wherein R1-R10 are each independently selected from hydrogen, halogen, hydroxy, and C1-C3 alkyl.

In one or more embodiments, R1-R4 are each independently selected from hydrogen, halogen, hydroxy, and C1-C3 alkyl, and R5-R10 are hydrogen.

In one or more embodiments, R3-R6 are each independently selected from hydrogen, halogen, hydroxy, and C1-C3 alkyl, and R1-R2, R7-R10 are hydrogen.

In one or more embodiments, each of R1-R4 is independently selected from F and Cl, and R5-R10 are hydrogen.

In one or more embodiments, each of R1-R2 is independently selected from F and Cl, and R3-R10 are hydrogen.

In one or more embodiments, each of R3-R4 is independently selected from F and Cl, and R1-R2 and R5-R10 are hydrogen.

In one or more embodiments, R1-R10 are hydrogen.

In one or more embodiments, the compound is a compound of formula (III)

R1-R10 are each independently selected from hydrogen and C1-C3 alkyl.

In one or more embodiments, each R1-R10 is independently selected from hydrogen and methyl.

In one or more embodiments, R1-R3 and R5-R10 are hydrogen, and R4 is methyl.

In one or more embodiments, the compound is glyburide, glimepiride, gliquidone, tolbutamide, gliclazide.

In one or more embodiments, the disease that benefits from lipothermogenesis is a disease that benefits from brown lipogenesis. In one or more embodiments, the disease that benefits from lipothermogenesis is obesity and/or a metabolic disease.

In one or more embodiments, the metabolic disorder is a metabolic disorder and/or metabolic hyperactivity.

In one or more embodiments, the metabolic disease is selected from: type 2 diabetes, diabetic ketoacidosis, fatty liver, hyperuricemia, hyperosmolar syndrome, hypoglycemia, gout, protein-energy malnutrition, vitamin A deficiency, scurvy, vitamin D deficiency, osteoporosis, hyperlipidemia, metabolic encephalopathy, hepatic encephalopathy, and inborn errors of metabolism.

In one or more embodiments, the subject is a high-fat diet subject or a non-high-fat diet subject.

In one or more embodiments, the cell is an adipocyte. In one or more embodiments, the adipocytes are brown adipocytes and/or white adipocytes.

The invention also provides the use of an agent that upregulates the expression or activity of a calcium channel-associated protein or subunit thereof, or a calcium channel activator, in increasing the expression or activity of UCP1 in a cell, or in enhancing the production of heat by a cell, or in the preparation of an agent for treating or preventing a disease that benefits from brown adipogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject.

The agent that upregulates the expression of a calcium channel-associated protein or a subunit thereof is an expression vector for a calcium channel-associated protein or a subunit thereof.

The subunits of the calcium channel-associated protein are selected from: alpha is selected from subunit, alpha group, subunit, beta group, beta subunit and gamma subunit.

An agent that upregulates the activity of a calcium channel-associated protein or subunit thereof is an agonist of a calcium channel-associated protein or subunit thereof.

In one or more embodiments, the calcium channel activator is selected from nifedipine, amlodipine, lacidipine.

The invention also provides the use of an agent that upregulates the expression or activity of calcineurin in the improvement of the expression or activity of UCP1 in a cell, or in the enhancement of thermogenesis in a cell, or in the preparation of an agent for the treatment or prevention of a disease benefiting from lipogenesis, for inhibiting weight gain in a subject, or for reducing fat content in a subject.

The agent that upregulates the expression of calcineurin is an expression vector for calcineurin.

Agents that upregulate the activity of calcineurin are calcineurin agonists.

The invention also provides the use of an agent that upregulates the expression or activity of NFAT in increasing the expression or activity of UCP1 in a cell, or in enhancing the production of heat by a cell, or in the manufacture of an agent for treating or preventing a disease that benefits from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject.

In one or more embodiments, the agent that upregulates the expression of NFAT is an expression vector for NFAT.

In one or more embodiments, the agent that upregulates the activity of NFAT is an NFAT agonist.

In one or more embodiments, the NFAT is selected from NFAT1, NFAT2, NFAT3, and NFAT 4.

In one or more embodiments, NFAT1 is shown as NCBI gene accession number 18019.

In one or more embodiments, NFAT2 is shown as NCBI gene accession number 18018.

In one or more embodiments, NFAT3 is shown as NCBI gene accession No. 73181.

In one or more embodiments, NFAT4 is shown as NCBI gene accession number 18021.

The invention also provides a pharmaceutical composition comprising one or more of the following and other agents for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject, together with a pharmaceutically acceptable excipient:

(1)

R1-R10 are each independently selected from hydrogen, halogen, hydroxy and C1-C3 alkyl, R11 is pyrrole, pyrroline, phenyl substituted with one or more substituents selected from oxygen, C1-C3 alkyl, C1-C3 alkoxy, halogen, hydroxy,

(2) an agent that upregulates the expression or activity of a calcium channel-associated protein or a subunit thereof,

(3) an activator of a calcium ion channel, which is a calcium ion channel,

(4) an agent that upregulates the expression or activity of calcineurin,

(5) an agent that upregulates the expression or activity of NFAT.

In one or more embodiments, the compound is as described in the first aspect herein.

In one or more embodiments, the additional agent that treats or prevents a disease that benefits from lipothermogenesis, inhibits weight gain or reduces fat content in a subject is an agent that reduces fat absorption and/or an agent that inhibits appetite.

In one or more embodiments, the additional agent that treats or prevents a disease benefiting from lipogenesis, inhibits weight gain in a subject, or reduces fat content in a subject is selected from the group consisting of central anorectic drugs, appetite regulating hormones, lipase inhibitors, 5-HT2C receptor agonists, Ghrelin antagonists, MCHR1 antagonists, SGLT2 inhibitors, agents that reduce fat synthesis, agents that promote fat hydrolysis, enzymes on the lipid metabolism pathway.

In one or more embodiments, the additional agent that treats or prevents a disease benefiting from lipogenesis, inhibits weight gain in a subject, or reduces fat content in a subject is selected from bupropion, naltrexone, zonisamide, atomoxetine, metreleptin, TM-30339, Exenatide, Liraglutide, Albiglutide, Cetilistat, Pramlintide, Alkoxyphenoxythiozoles.

The present invention also provides a method of increasing in vitro UCP1 expression or activity in a mammalian tissue or cell, or enhancing thermogenesis in a mammalian tissue or cell, comprising one or more steps selected from:

(1) culturing the tissue or cell in the presence of a compound represented by the following formula (I) or a pharmaceutically acceptable salt or solvate thereof,

(2) up-regulating the expression or activity of a calcium channel-associated protein or subunit thereof in said tissue or cell,

(3) culturing said tissue or cell in the presence of a calcium channel activator,

(4) up-regulating the expression or activity of calcineurin of said tissue or cell,

(5) up-regulating the expression or activity of NFAT in said tissue or cell.

In one or more embodiments, the tissue is adipose tissue. In one or more embodiments, the adipose cells are brown adipose tissue and/or white adipose tissue.

In one or more embodiments, step (2) comprises transferring the expression vector of the calcium channel-associated protein or subunit thereof into the tissue or cell or culturing the tissue or cell in the presence of an agonist of the calcium channel-associated protein or subunit thereof.

In one or more embodiments, step (3) comprises transferring the expression vector for calcineurin into the tissue or cell or culturing the tissue or cell in the presence of an agonist of calcineurin.

In one or more embodiments, step (4) comprises transforming an expression vector for NFAT in the tissue or cell or culturing the tissue or cell in the presence of an agonist of NFAT.

In one or more embodiments, the method is non-therapeutic or non-diagnostic.

The present invention also provides a method of screening for a compound that enhances thermogenesis in a tissue or cell of a mammal, treats or prevents a disease benefiting from thermogenesis in fat, inhibits weight gain in a subject, or reduces fat content in a subject, comprising the steps of:

(1) incubating the tissue or cell in the presence of the compound,

(2) detecting UCP1 expression or activity in the tissue or cell,

wherein an up-regulation of UCP1 expression or activity indicates that the compound is a compound that enhances thermogenesis in said tissue or cell, treats or prevents a disease benefiting from thermogenesis in fat, inhibits weight gain in a subject, or reduces fat content in a subject.

In one or more embodiments, the detecting is detecting the amount or activity of mRNA or protein of UCP1 in the tissue or cell.

In one or more embodiments, methods for detecting the amount of mRNA or protein of UCP1 include, but are not limited to, Southern, RT-PCR, Western; methods for detecting the activity of UCP1 in the mRNA or protein content include, but are not limited to, cold stimulation experiments, hippocampal experiments.

Drawings

FIG. 1: ucp1-GFP mouse construction strategy.

FIG. 2: construction of the PCR results for Ucp1-GFP mice.

FIG. 3: ucp1-GFP adipocyte construction strategy.

FIG. 4: glibenclamide can promote UCP1 expression of brown fat cells in vitro.

FIG. 5: glimepiride can promote the expression of UCP1 in brown fat cells in vitro.

FIG. 6: the glibenclamide can promote the expression of UCP1 in white fat cells in vitro.

FIG. 7: the glibenclamide can inhibit the increase of the body weight of the mice under the condition of high-fat feeding.

FIG. 8: the reduction in body weight in the glyburide-treated high-fat diet mice was due to a reduction in fat content.

FIG. 9: the blood triglyceride level of mice treated with glyburide was significantly reduced on a high fat diet.

FIG. 10: glibenclamide treated mice have increased basal metabolism on a high fat diet.

FIG. 11: under high fat diet, the glibenclamide treated mice had significantly reduced adipose tissue weight compared to the control group (top left, bottom left), and significantly reduced adipose tissue cell size (right panel).

FIG. 12: under high-fat diet, the expression of UCP1 protein in brown adipose tissues of mice treated by glibenclamide is remarkably up-regulated compared with that of a control group.

FIG. 13: compared with the control group (solvent treatment), the mouse brown adipose tissue UCP1 protein expression of the glibenclamide treatment group is remarkably up-regulated, and is similar to the positive control CL-316243 treatment group (left panel). Hematoxylin-eosin (HE) staining also showed a significant decrease in cell size in the glyburide-treated mice, multiple lipid droplets within a single cell, and increased UCP1 staining (right panel).

FIG. 14: glibenclamide treated mice were better tolerant to cold (4 ℃) compared to the control group (solvent treatment) (right panel), and mice had a significant increase in oxidative phosphorylation-related proteins (left panel).

FIG. 15: the glibenclamide can up-regulate lipid metabolism related genes in fat cells and promote browning of the fat cells.

FIG. 16: glibenclamide significantly upregulated pATF2 in brown adipocytes, while downregulated pSTAT3 and pERK, compared to solvent (DMSO). It is suggested that glibenclamide may regulate UCP1 expression by activating ATF2 and inhibiting STAT3 and ERK signaling pathways.

FIG. 17: sgrnas (upper left one, upper left two, lower left one, and lower left two) were designed for exon 2 of kir6.1, exon 1 of kir6.2, exon 2 of Sur1, and exon 4 of Sur2, and the activity of each sgRNA in brown adipocytes was examined separately. The results showed that all 4 sgrnas had higher cleavage activity (upper right one, upper right two, lower right one, lower right two).

FIG. 18: there was no difference in mRNA and protein expression for Kir and Sur, Ucp1 knockout in brown adipocytes, respectively, and glibenclamide treatment in Kir and Sur knockout cells, Ucp1 in mRNA and proteinThere was also no difference in the level of expression. Suggesting that glyburide up-regulates UCP1 may not depend on ATP-sensitive potassium channel (K)_ATP)。

FIG. 19: only glyburide significantly promoted the expression of brown adipocyte Ucp1 at the mRNA and protein levels.

FIG. 20: only glibenclamide can promote the expression of UCP1 protein in white fat cells.

FIG. 21: sgrnas (left one and right two) were designed for exon 2 of Epac2 and exon 2 of Cav1, and the activity of each sgRNA in brown adipocytes was examined separately. The results showed that all 2 sgrnas had cleavage activity (left two, right one).

FIG. 22: there were no differences in the expression at the mRNA and protein levels for the Epac2 knockout, Ucp1 in brown adipocytes, and no differences in the expression at the mRNA and protein levels for Ucp1 treated with glyburide in Epac2 knockout cells. There was no difference in the expression of UCP1 protein when Cav1 was knocked out in brown adipocytes, and no difference in the expression of UCP1 protein when glyburide was added to Cav1 knocked out cells. The above results show that glyburide up-regulates UCP1 independent of Epac2 and independent of Cav 1.

FIG. 23: inhibition of Ca²⁺Can inhibit the glibenclamide from up-regulating UCP 1.

FIG. 24: glibenclamide upregulation of UCP1 was independent of Trpv 2.

FIG. 25: in brown adipocytes, both nitrendipine and cyclosporin a significantly inhibited glyburide-induced upregulation of Ucp1 at the mRNA and protein levels (levo-one, levo-two), and VIVIT also significantly inhibited glyburide-induced upregulation of Ucp1 at the mRNA level (right-one). Indicating that Ca is inhibited in brown adipocytes²⁺The Calcineurin-NFAT signal pathway can inhibit UCP1 up-regulation caused by glibenclamide.

FIG. 26: both nitrendipine and cyclosporin a can significantly inhibit the upregulation of UCP1 protein by glibenclamide or rosiglitazone in white adipocytes.

FIG. 27 is a schematic view showing: the mechanism by which glyburide regulates UCP1 expression.

Detailed Description

It is to be understood that within the scope of the present invention, the above-described technical features of the present invention and the technical features described in detail below (e.g., the embodiments) may be combined with each other to constitute a preferred embodiment.

The inventors have found that the compound of formula (I) or a pharmaceutically acceptable salt or solvate thereof can pass Ca²⁺The Calcineurin-NFAT signal path up-regulates UCP1, thereby promoting adipocyte thermogenesis and achieving the effect of treating or preventing obesity and metabolic diseases.

Herein, UCP1 is upregulated by at least 20%, at least 50%, at least 100%, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 3.5-fold, at least 4-fold, at least 45-fold, at least 5-fold, at least 5.5-fold, at least 6-fold, at least 6.5-fold, at least 7-fold, at least 7.5-fold, at least 8-fold, at least 85-fold, at least 9-fold, at least 95-fold, at least 10-fold, at least 15-fold, at least 20-fold.

The tissue and cells described herein may be any tissue and cells of a mammal, preferably adipose tissue and cells. Adipose tissue and cells include brown adipose tissue and cells and white adipose tissue and cells. The cell may be an isolated cell of an in vitro mature cell line or animal or a cell in vivo. Exemplary adipocytes are white or brown adipocytes obtained from mice. Methods for obtaining white or brown adipocytes from living organisms are well known in the art. Brown and white adipocytes have thermogenic effects and can be used for treating obesity and metabolic diseases. The compounds or agents described herein are therefore useful for treating or preventing diseases that benefit from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject. Herein, diseases benefiting from lipothermogenesis include diseases benefiting from brown or white lipogenesis, including obesity and/or metabolic diseases. The metabolic disease is metabolic disorder and/or metabolic hyperactivity, and includes type 2 diabetes, diabetic ketoacidosis, fatty liver, hyperuricemia, hyperosmolar syndrome, hypoglycemia, gout, protein-energy malnutrition, vitamin A deficiency, scurvy, vitamin D deficiency, osteoporosis, hyperlipidemia, metabolic encephalopathy, hepatic encephalopathy, and congenital metabolic disorder.

Accordingly, the present invention provides the use of a compound of formula (I) or a pharmaceutically acceptable salt or solvate thereof, for increasing the expression or activity of UCP1 in a cell, or for enhancing the production of heat by a cell, or for the manufacture of a medicament for treating or preventing a disease benefiting from the production of thermoadiposity, for inhibiting weight gain in a subject, or for reducing fat content in a subject,

wherein, R1-R10 are independently selected from hydrogen, halogen, hydroxyl and C1-C3 alkyl, R11 is pyrrole, pyrroline and phenyl substituted by one or more substituent groups selected from oxygen, C1-C3 alkyl, C1-C3 alkoxy, halogen and hydroxyl.

In one or more embodiments, the compound is a compound of formula (II)

In one or more embodiments, R1-R4 are each independently selected from hydrogen, halogen, hydroxy, and C1-C3 alkyl, R5-R10 are hydrogen; or, R3-R6 are each independently selected from hydrogen, halogen, hydroxy, and C1-C3 alkyl, R1-R2, R7-R10 are hydrogen; alternatively, R1-R4 are each independently selected from F and Cl, R5-R10 are hydrogen; alternatively, R1-R2 are each independently selected from F and Cl, R3-R10 are hydrogen; alternatively, R3-R4 are each independently selected from F and Cl, R1-R2 and R5-R10 are hydrogen; alternatively, R1-R10 are hydrogen. In the case where R1-R10 are hydrogen, the compound represented by formula (II) is glyburide.

In one or more embodiments, the compound is a compound of formula (III)

Wherein R1-R10 are each independently selected from hydrogen and C1-C3 alkyl.

In one or more embodiments, each R1-R10 is independently selected from hydrogen and methyl. In the case where R1-R3 and R5-R10 are hydrogen and R4 is methyl, the compound represented by the formula (III) is glimepiride.

Halogens described herein include, but are not limited to F, I, Br. The compound of formula (I) may have chemical modifications common in the art that do not affect the ability of the compound to increase the activity of UCP1 protein expression. The present invention also includes analogs or derivatives of glyburide, including but not limited to: glimepiride, gliquidone, tolbutamide, gliclazide.

As used herein, the term "alkyl", alone or in combination with other terms, refers to a saturated aliphatic alkyl group, including straight or branched chain alkyl groups of 1-20 carbon atoms. Preferably, alkyl means a medium alkyl group containing 1 to 10 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl, pentyl and the like. More preferably, it means a lower alkyl group having 1 to 4 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl and the like. The alkyl group may be substituted or unsubstituted. When substituted, the number of substituents is 1 or more, preferably 1 to 3, more preferably 1 or 2, and the substituents are independently selected from the group consisting of halogen, hydroxy, lower alkoxy, aryl.

As used herein, the terms "aryl", alone or in combination with other terms, refer to an aromatic cyclic group containing 6 to 14 carbon atoms (e.g., a six membered monocyclic, twelve membered bicyclic, or fourteen membered tricyclic ring system), with exemplary aryl groups including phenyl, naphthyl, biphenyl, indenyl, and anthracenyl. The "phenylene group" as used herein refers to a phenyl group having two substituents. The aryl group is optionally substituted with one or more substituents independently selected from halogen, alkyl, trihaloalkyl, hydroxy, mercapto, cyano, N-amino, mono-or dialkylamino, carboxy or N-sulfonamide. Specifically, the phenyl or phenylene group may be optionally substituted with 1 to 4 groups independently selected from the group consisting of C1-C3 alkyl, halogen, and hydroxyl.

The term "alkoxy" as used herein refers to-O- (unsubstituted alkyl) and-O- (unsubstituted cycloalkyl). Representative examples include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, cyclopropoxy, cyclobutoxy, cyclopentyloxy, cyclohexyloxy, and the like.

The term "substituted," as used herein, means that a compound has a substituent that contains at least one carbon, nitrogen, oxygen, or sulfur atom bearing one or more hydrogen atoms. If a substituent is described as "substituted," it is meant that a non-hydrogen substituent occupies a carbon, nitrogen, oxygen, or sulfur hydrogen position. For example, a substituted alkyl substituent refers to a group wherein at least one non-hydrogen substituent occupies a hydrogen position on the alkyl group. Further, monofluoroalkyl refers to an alkyl group substituted with one fluorine, and difluoroalkyl refers to an alkyl group substituted with two fluorines.

The compounds disclosed herein, or pharmaceutically acceptable salts thereof, may include one or more asymmetric centers and thus exist as enantiomers, diastereomers, and other stereoisomeric forms that may be defined, and may be classified as (R) -or (S) -, for amino acids, (D) -or (L) -, depending on stereochemistry. The present invention is intended to include all such possible isomers, as well as racemic and optically pure forms. The optically active (+) and (-), (R) -and (S) -or (D) -and (L) -isomers can be prepared by chiral synthons or chiral reagents, or can be prepared separately by common techniques such as high performance liquid chromatography using chiral columns. When a compound of the present invention contains an olefinic double bond or other geometric asymmetric center, it is intended that the compound includes both E and Z geometric isomers unless otherwise specified. Likewise, all tautomers are also included.

As used herein, "pharmaceutically acceptable salts" include acid and base salts.

By "pharmaceutically acceptable acid salt" is meant a salt that retains the biological activity and properties of the free base, without undesirable biological activity or other changes. Such salts may be composed of inorganic acids such as, but not limited to, hydrochloric, hydrobromic, sulfuric, nitric, phosphoric and similar acids. Such salts may also be composed of organic acids such as, but not limited to, acetic acid, dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphorsulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfonic acid, 1, 2-ethanedisulfonic acid, ethanesulfonic acid, isethionic acid, formic acid, fumaric acid (fiimaric acid), galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1, 5-disulfonic acid, 2-naphthalenesulfonic acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, and mixtures thereof, 1-naphthol-2-carboxylic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid and the like.

By "pharmaceutically acceptable basic salt" is meant a salt that retains the biological activity and properties of the free acid, without undesirable biological activity or other changes. These salts are prepared by adding an inorganic or organic base to the free acid. Salts obtained with inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Preferred inorganic salts are ammonium, sodium, potassium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary ammonium salts, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, danitol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benzphetamine, N' -dibenzylethylenediamine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamide resins, and the like. Preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

Crystallization typically results in the production of solvated products of the disclosed compounds. As used herein, the term "solvate" refers to a polymer comprising one or more molecules of the compounds disclosed herein and one or more molecules of a solvent. The solvent may be water, in which case the solvate may be a hydrate. Alternatively, the solvent may also be an organic solvent. Thus, the compounds disclosed in this patent may exist as hydrates, including monohydrates, dihydrate, hemihydrate, sesquihydrates, trihydrate, tetrahydrate, and similar structures, and also as corresponding solvated products. The compounds disclosed herein may be true solvates, while in other cases the compounds disclosed herein may also be mixtures retaining only a portion of the water or retaining water with some solvent.

As described above, the inventors have found that the compound of formula (I) can up-regulate UCP1 via the Ca2+ -Calcineurin-NFAT signaling pathway, thereby promoting adipocyte thermogenesis. Thus, the invention also provides the use of an agent that upregulates the expression or activity of a calcium channel-associated protein or subunit thereof, or a calcium channel activator, an agent that upregulates the expression or activity of calcineurin, and/or an agent that upregulates the expression or activity of NFAT, for increasing the expression or activity of UCP1 in a cell, or for increasing the production of heat by a cell, or for the preparation of an agent for treating or preventing a disease that benefits from lipothermogenesis, for inhibiting weight gain in a subject, or for reducing fat content in a subject.

Typically, the agent that upregulates the expression of a polypeptide or protein is an expression vector for the polypeptide or protein. For example, expression vectors suitable for expressing a calcium channel-associated protein or subunit thereof, calcineurin and/or NFAT in a host cell (e.g., an adipocyte) can be constructed using techniques conventional in the art and transferred into the host cell by conventional methods such that the expression vectors express the molecule in the host cell, thereby effecting upregulation of its expression. The expression vector contains other components required for expression of these genes in the host cell and those skilled in the art are aware of these components. In certain embodiments, the expression of genes upstream of these molecules can be modulated, thereby increasing the expression of such molecules. For example, in certain embodiments, a viral vector (e.g., a lentiviral vector) that expresses a calcium channel-associated protein or a subunit thereof, calcineurin, and/or NFAT, can be administered to a cell of the subject, thereby increasing the expression level of the gene in the cell of the subject. Based on the genes or amino acid sequences disclosed on NCBI, one skilled in the art can obtain expression vectors comprising coding sequences for calcium ion channel-associated proteins or subunits thereof, calcineurin and/or NFAT. The UCP1 expression of the cell over expressing the protein is up regulated, and the heat production of the cell is increased. The coding sequences for calcium channel-associated proteins or subunits thereof, calcineurin and/or NFAT are known to those skilled in the art. Illustratively, NFAT comprises NFAT1, NFAT2, NFAT3, and NFAT4, wherein NFAT1 is set forth as NCBI gene accession number 18019; NFAT2 is shown as NCBI gene accession number 18018; NFAT3 is shown as NCBI gene accession No. 73181; NFAT4 is shown as NCBI gene accession number 18021.

Typically, an agent that upregulates the activity of a polypeptide or protein is an agonist of the polypeptide or protein. Agonists of calcium channel-associated proteins or subunits thereof, calcineurin and/or NFAT to which the present invention relates are well known in the art. In addition, calcium channel activators may also be used in the methods of the invention to achieve upregulation of UCP1 expression and increased cellular thermogenesis. Calcium channel activators include, but are not limited to: nifedipine, amlodipine, lacidipine.

In another aspect, the invention provides a pharmaceutical composition comprising a compound or agent described herein and a pharmaceutically acceptable adjuvant and optionally other agents for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject. Herein, "pharmaceutically acceptable excipients" refer to carriers, diluents and/or excipients that are pharmacologically and/or physiologically compatible with the subject and the active ingredient, including but not limited to: pH adjusters, surfactants, carbohydrates, adjuvants, antioxidants, chelating agents, ionic strength enhancers, preservatives, carriers, glidants, sweeteners, dyes/colorants, flavoring agents, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents or emulsifiers. In some embodiments, the pharmaceutically acceptable excipients may include one or more inactive ingredients, including but not limited to: stabilizers, preservatives, additives, adjuvants, sprays, compressed air or other suitable gases, or other suitable inactive ingredients in combination with the pharmaceutically effective compound. More specifically, suitable pharmaceutically acceptable excipients may be excipients commonly used in the art for the administration of small molecule drugs or nucleic acids.

Typically, the pharmaceutical composition contains a therapeutically effective amount of a compound or agent as described herein. A therapeutically effective amount refers to a dose that achieves treatment, prevention, alleviation, and/or amelioration of a disease or disorder in a subject. The therapeutically effective amount may be determined based on factors such as the age, sex, condition and severity of the condition, other physical conditions of the patient, etc. A therapeutically effective amount may be administered as a single dose, or may be administered in multiple doses according to an effective treatment regimen. Herein, a subject or patient generally refers to a mammal, in particular a human.

The compounds or agents of the present invention may be administered alone or as a pharmaceutical composition. The compounds or agents of the invention may be administered in a manner suitable for the treatment (or prevention) of a disease. The amount and frequency of administration will be determined by various factors, such as the condition of the patient, and the type and severity of the patient's disease. Administration of the composition may be carried out in any convenient manner, including by injection, infusion, implantation or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodal, intraspinally, intramuscularly, by intravenous injection, or intraperitoneally.

The compounds or agents described herein can be used in combination with other agents useful for treating or preventing a disease that benefits from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject. Other agents for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain or reducing fat content in a subject include agents that reduce fat absorption and/or agents that inhibit appetite, e.g., central anorectic drugs, appetite regulating hormones, lipase inhibitors, 5-HT2C receptor agonists, Ghrelin antagonists, MCHR1 antagonists, SGLT2 inhibitors, agents that reduce fat synthesis, agents that promote fat hydrolysis, enzymes in the lipid metabolism pathway. Herein, the other agent that treats or prevents a disease benefiting from lipothermogenesis, inhibits weight gain in a subject, or reduces fat content in a subject may be selected from bupropion, naltrexone, zonisamide, atomoxetine, metreleptin, TM-30339, Exenatide, Liraglutide, Albiglutide, Cetilistat, Pramlintide, Alkoxyphenoxythiozoles. The person skilled in the art can determine the dosage of other agents to be administered.

The present invention also includes a method of increasing in vitro UCP1 expression or activity in a mammalian tissue or cell, or enhancing thermogenesis in a mammalian tissue or cell, comprising one or more steps selected from: (1) culturing the tissue or cell in the presence of a compound of formula (I) or a pharmaceutically acceptable salt or solvate thereof, (2) up-regulating the expression or activity of a calcium channel-associated protein or subunit thereof in the tissue or cell or culturing the tissue or cell in the presence of a calcium channel activator, (3) up-regulating the expression or activity of calcineurin in the tissue or cell, (4) up-regulating the expression or activity of NFAT in the tissue or cell. The compounds or reagents for carrying out these steps are as described above.

The invention also relates to methods of treating or preventing a disease that benefits from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject. The method comprises administering to a subject in need thereof a therapeutically effective amount of a compound, agent or pharmaceutical composition described herein. The invention also relates to a kit for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain in a subject, or reducing fat content in a subject, the kit comprising a compound, agent or pharmaceutical composition as described herein. The invention also relates to the use of a compound, agent or pharmaceutical composition described herein for the manufacture of a kit for treating or preventing a disease benefiting from lipothermogenesis, inhibiting weight gain or reducing fat content in a subject. In particular, an "effective amount" refers to an amount that is capable of producing a therapeutic function in a human or animal and that is acceptable to both animals and humans. For example, in a combination drug in a tablet, the content of the compound of formula (1) may be 10mg, 20mg, 50mg, 100mg, 200mg or more.

The administration mode of the drug in the present invention may include, but is not limited to, subcutaneous injection, transdermal injection, implantation, topical administration, intramuscular injection, sustained release administration, oral administration, and the like. Those skilled in the art know other agents required to administer a drug to a subject in different modes of administration, dosages, sites of administration, and the like. Such as dressings, solvents (e.g., water), and the like.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

The present invention also provides a method of screening for a compound that enhances thermogenesis in a tissue or cell (e.g., an adipose tissue or cell) of a mammal, comprising the steps of: (1) incubating a tissue or cell in the presence of the compound, (2) detecting UCP1 expression or activity in the tissue or cell, wherein an up-regulation of UCP1 expression or activity indicates that the compound is a compound that enhances thermogenesis in the tissue or cell. The detection is to detect the content or activity of UCP1 mRNA or protein in the tissue or cell. Methods for detecting the content of UCP1 mRNA or protein include, but are not limited to, Southern, RT-PCR, Western. The method for detecting the activity of the content of mRNA or protein of UCP1 comprises the following steps: cold stimulation experiments, hippocampal experiments, etc. The skilled person is aware of the reagents required to carry out the above process.

Examples

Example 1 mouse and cell construction

Construction of Ucp1-GFP mice

The experimental steps are as follows: the method of CRISPR-Cas9 gene editing is adopted to obtain a knock-in mouse with Ucp1 gene inserted into P2A-GFP. The design strategy is as follows: the GFP gene was inserted into the C-terminus of Ucp1 gene, a Ucp1 gene was constructed, and a transgenic mouse with P2A-EGFP was inserted (FIG. 1), and the resulting transgenic mouse was identified by PCR (FIG. 2). A single-stranded guide RNA (sgRNA) site is designed aiming at the exon 6 of Ucp1, and the sequence of the sgRNA is shown as SEQ ID NO. 1. Using mouse genome as template, primers Ucp1-5 arm-F (SEQ ID NO:2) and Ucp1-5 arm-R (SEQ ID NO:3) were used to amplify 5' homology arm by PCR; the 3' homology arm was PCR amplified using primers Ucp1-3 arm-F (SEQ ID NO:4), Ucp1-3 arm-R (SEQ ID NO: 5); meanwhile, the fragment 2A-GFP fragment was amplified using the primers 2A-GFP-F (SEQ ID NO:6) and 2A-GFP-R (SEQ ID NO: 7). The knock-in vector (template plasmid) for P2A-GFP was obtained by the enzymatic ligation method. And obtaining a progeny mouse by injecting and transplanting the fertilized egg male pronucleus. Ucp1-GFP positive mice were obtained by identifying (Ucp1-genotype-5 arm-F (SEQ ID NO:8), Ucp1-genotype-5 arm-R (SEQ ID NO: 9); Ucp1-genotype-3 arm-F (SEQ ID NO:10), Ucp1-genotype-3 arm-R (SEQ ID NO: 11)).

The experimental results are as follows: the PCR result aiming at the inserted part shows that the genome of the constructed transgenic mouse successfully amplifies a band, but the wild type mouse does not have the band, which indicates that P2A-EGFP is successfully inserted and the transgenic mouse is successfully constructed.

Construction of Ucp1-GFP adipocytes

The experimental steps are as follows: taking brown adipocytes as an example, a brown lipid Vascular stroma fraction SVF (Stromal Vascular fraction) was isolated from male mice at2 days after birth, and the resulting tissue was digested with a separation medium (123mM sodium chloride, 5mM potassium chloride, 1.3mM calcium chloride, 5mM glucose, 50mM HEPES, 4% BSA, 1.5mg/mL collagenase A, 2mg/mL neutral protease II). The digested tissue cells were filtered through a 70 μm filter plug, the resulting cells were cultured in primary culture medium (high-glucose DMEM containing 20% FBS), and retrovirus expressing T antigen was transfected, and screened by G418 to obtain monoclonal, after which the monoclonal cell amplification culture was stored in liquid nitrogen in separate tubes. In the same manner, we obtained Ucp1-GFP white adipocyte cell line (FIG. 3).

Example 2 in vitro validation

1) Glibenclamide and glimepiride can promote UCP1 expression of in vitro brown fat cells

The experimental steps are as follows: constructed Ucp1-GFP brown adipocytes were treated with glyburide (10. mu.M in DMSO) or glimepiride (10. mu.M in DMSO) during in vitro differentiation, with DMSO as a solvent as a control. Glibenclamide was added 7 days after cell differentiation and cells were harvested 1 day after addition. Total RNA from cells was extracted by Trizol (ThermoFisher) and inverted to cDNA, and the expression of marker gene Ucp1 and genes associated with brown fat differentiation was detected by qPCR. Meanwhile, the total protein of the cells was extracted with RIPA lysate (Millipore) and the expression of UCP1 protein was detected by western blot. The primers for the above qPCR were as follows: (5'-3')

Ucp1-F:GCATTCAGAGGCAAATCAGC(SEQ ID NO:12)；

Ucp1-R:GCCACACCTCCAGTCATTAAG(SEQ ID NO:13)；

Cidea-F:GAATAGCCAGAGTCACCTTCG(SEQ ID NO:14)；

Cidea-R:AGCAGATTCCTTAACACGGC(SEQ ID NO:15)；

Prdm16-F:CCGACTTTGGATGGGAGATG(SEQ ID NO:16)；

Prdm16-R:CACGGATGTACTTGAGCCAG(SEQ ID NO:17)；

Pgc1a-F:TCACGTTCAAGGTCACCCTA(SEQ ID NO:18)；

Pgc1a-R:TCTCTCTCTGTTTGGCCCTT(SEQ ID NO:19)；

Ppara-F:CATTTCCCTGTTTGTGGCTG(SEQ ID NO:20)；

Ppara-R:ATCTGGATGGTTGCTCTGC(SEQ ID NO:21)。

The results of the experiment are shown in fig. 4 and 5. Fig. 4 shows that glibenclamide treatment significantly upregulated the expression of marker gene Ucp1 at the mRNA and protein levels during brown adipocyte differentiation in vitro, while other genes associated with brown adipocyte differentiation (Cidea, Pgc1 α, Ppar α, Prdm16) were also significantly upregulated. FIG. 5 shows that glimepiride treatment can significantly up-regulate marker genes during in vitro differentiation of brown adipocytesUcp1Expression at the mRNA and protein levels.

2) The glibenclamide can promote the expression of UCP1 in white fat cells in vitro

The experimental steps are as follows: constructed Ucp1-GFP white adipocytes were treated with glyburide (10. mu.M in DMSO) during in vitro differentiation, with the solvent DMSO as a control. Glibenclamide was added 6 days after cell differentiation and cells were harvested 4 days after addition. RNA was extracted and inverted to cDNA, and expression of marker gene Ucp1 and genes associated with brown lipid differentiation were detected by qPCR. And simultaneously extracting protein, and detecting the expression of UCP1 protein by western blot.

The results of the experiment are shown in FIG. 6. Fig. 6 shows that glyburide treatment significantly upregulated the expression of marker gene Ucp1 at the mRNA and protein levels during white adipocyte in vitro differentiation, while other genes associated with brown lipid differentiation (Cidea, Pgc1 α) were also significantly upregulated.

Example 3 in vivo validation

1) The glibenclamide can inhibit the weight increase of mice under the condition of high-fat feeding

The experimental steps are as follows: 8-week-old C57BL/6J male mice (Slek) were gavaged with 2mg/kg glyburide per day under high-fat (60 kcal% fat) diet, and the control group was given an equal volume of solvent (4.5 wt% DMSO, 1 wt% Tween, water) per day. Food intake and body weight were counted weekly. Each group had 12 mice.

The results of the experiment are shown in FIG. 7. Figure 7 shows that the body weight of the mice treated with glyburide was significantly reduced compared to the control group under high fat diet. Mice showed significant differences in weight loss after 1 week of drug administration, and the differences increased with time (left panel). The body weight of the glyburide-treated mice decreased by 9% after 11 weeks of administration compared to the control mice (left and middle panels). There was no difference in food intake between the two groups of mice (right panel).

2) The reduction in body weight in glyburide-treated high-fat diet mice was due to a reduction in fat content

The experimental steps are as follows: mice were administered 2mg/kg glyburide daily on a high fat diet by gavage, and after 8 weeks the body fat and muscle content of the mice were examined by nuclear magnetic resonance apparatus nmr (echo mri). Each group had 12 mice.

The results of the experiment are shown in FIG. 8. Figure 8 shows that under high fat diet conditions, the glyburide-treated mice had a 29.52% reduction in body fat content compared to the control group, with no significant difference in muscle content. Indicating that the reduction in body weight in the mice administered was due to a reduction in fat content.

3) Significant reduction in triglyceride levels in blood of mice treated with glyburide on a high fat diet

The experimental steps are as follows: the mouse was administered 2mg/kg of glyburide per day by gavage under a high-fat diet, and after 11 weeks, the mouse was starved for 4 hours, blood was taken through the tail vein of the mouse, a blood sample was placed on ice, centrifuged at4 ℃ and 3000rpm for 15min, and the supernatant was taken. The triglyceride and cholesterol levels in the blood of mice were measured using triglyceride and cholesterol measurement kits (Shanghai Shensonggufu Co., Ltd.), respectively. Each group had 12 mice.

The results of the experiment are shown in FIG. 9. Fig. 9 shows that under high-fat diet conditions, the glyburide-treated mice had a 35.92% decrease in triglyceride levels in blood compared to the control (left panel), but no significant change in cholesterol levels in blood (right panel).

4) Increased basal metabolism of glibenclamide-treated mice on a high-fat diet

The experimental steps are as follows: mice were gavaged with 2mg/kg glyburide per day on a high fat diet, and after 11 weeks, oxygen consumption, carbon dioxide exhalation and exercise amount were measured by a metabolism cage (Columbus Instruments). Each group had 8 mice.

The results of the experiment are shown in FIG. 10. Fig. 10 shows that the oxygen consumption and carbon dioxide exhalation of the glyburide-treated mice were significantly increased (top left, bottom left), and both daytime and nighttime (top right, top right two) compared to the control group under high fat diet conditions. While there was no difference in the amount of activity of the mice (lower right).

5) Lipid droplet accumulation in adipose tissue of mice treated with glyburide on a high fat diet was reduced and UCP1 expression in brown fat was increased

The experimental steps are as follows: under a high-fat diet, 2mg/kg of glyburide was administered to the mice by gavage every day, and 11 weeks later, the brown adipose tissue, subcutaneous white adipose tissue and epididymal white adipose tissue of the mice were taken and weighed, respectively. At the same time, three fresh adipose tissues were fixed with 4% PFA (paraformaldehyde, national drug group chemical reagents, Inc.) overnight and stained with hematoxylin-eosin. And extracting proteins of mouse brown adipose tissues, and detecting the expression of UCP1 proteins by western blot.

The results of the experiment are shown in FIGS. 11 and 12. Fig. 11 shows that the glibenclamide-treated mice had significantly reduced adipose tissue weight (top left, bottom left) and significantly reduced adipose tissue cell size (right) compared to the control group on a high fat diet. Fig. 12 shows that under high fat diet, the glyburide-treated mouse brown adipose tissue UCP1 protein expression was significantly up-regulated compared to the control group.

6) By in-situ injection administration, the glibenclamide promotes the expression of mouse subcutaneous white fat UCP1

The experimental steps are as follows: the glibenclamide (1mg/kg) is injected and administered at subcutaneous inguinal fat of male mice of 7-8 weeks old through in-situ injection administration. Each mouse was injected into the groin at 50. mu.L each time, and a negative control and a positive control were prepared with 1mg/kg of CL-316243(Tocris) in a solvent. Mice were bred under conventional (rat and rat breeding feed, sparkang) dietary conditions. After 4 days, cold tolerance experiments were performed, and subcutaneous white adipose tissues were taken, and fresh adipose tissues were simultaneously stained with hematoxylin-eosin (HE) and UCP 1. Meanwhile, tissue protein is extracted, and UCP1 and oxidative phosphorylation related protein expression are detected.

The results of the experiment are shown in FIGS. 13 and 14. Fig. 13 shows that the expression of UCP1 protein was significantly up-regulated in the brown adipose tissue of mice in the glibenclamide-treated group compared to the negative control group, similarly to the positive control CL-316243-treated group (left panel). Hematoxylin-eosin (HE) staining also showed a significant decrease in cell size in the glyburide-treated mice, multiple lipid droplets within a single cell, and increased UCP1 staining (right panel). FIG. 14 shows that glyburide-treated mice were better tolerant to cold (4 ℃) and that the oxidative phosphorylation-related proteins were significantly increased in mice (left) compared to the negative control group (right panel).

Example 4 mechanism of action of Glibenclamide

1) Glibenclamide up-regulates lipid metabolism related genes in adipocytes and promotes browning of adipocytes

The experimental steps are as follows: to know the mechanism of action of glyburide in brown adipose and white adipocytes to up-regulate UCP1, we first performed RNAseq sequencing analysis on glyburide or DMSO-treated brown adipose and white adipocytes. Wherein, the brown fat cells are added with 10 mu M glibenclamide or DMSO for treatment after 7 days of cell differentiation, and the cells are collected after 1 day of addition; white adipocytes were treated with 10. mu.M glyburide or DMSO 6 days after cell differentiation, and harvested 4 days after cell addition. Then, total RNA of the cells was extracted, and the extracted RNA was subjected to RNAseq sequencing analysis (Shanghai Meiji pharmaceutical science Co., Ltd.). GO analysis was performed on genes enriched in glibenclamide treated brown adipocytes or white adipocytes.

The results of the experiment are shown in FIG. 15. Figure 15 shows that genes upregulated by glyburide are significantly enriched in lipid metabolism-associated pathways, non-shivering thermogenesis, steroid metabolism, adipocyte differentiation, and redox reactions (top left) in brown adipocytes compared to control (DMSO). In white adipocytes, genes upregulated by glyburide were significantly enriched in lipid metabolism-associated pathways, fatty acid catabolism, brown adipocyte differentiation, insulin response, and redox response (top right) compared to control (DMSO). There were 605 genes up-regulated by glyburide in brown adipocytes, 504 genes up-regulated by glyburide in white adipocytes (lower left), and 100 genes up-regulated in common in both cells, and these co-regulated genes were partially enriched in the lipid metabolism regulatory pathway (lower right). These results suggest that glyburide up-regulates genes involved in lipid metabolism in adipocytes, promoting browning of adipocytes.

2) Glibenclamide up-regulates pATF2, while down-regulating pSTAT3 and pERK

The experimental steps are as follows: to know which signaling pathways glibenclamide is specifically regulated in brown adipocytes, we followed by analysis of glibenclamide or DMSO-treated brown adipocyte proteins by western blots. Wherein the brown adipocytes were treated with 10. mu.M glyburide or DMSO 7 days after cell differentiation, and the cells were collected 1 day after addition. Extracting total protein of the cells, and detecting the expression of the corresponding signal protein.

The results of the experiment are shown in FIG. 16. Figure 16 shows that glyburide significantly upregulated pATF2 in brown adipocytes while downregulated pSTAT3 and pERK compared to solvent (DMSO). It is suggested that glibenclamide may regulate UCP1 expression by activating ATF2 and inhibiting STAT3 and ERK signaling pathways.

3) Glibenclamide upregulation of UCP1 independent of ATP-sensitive potassium ion channel (K)_ATP)

The experimental steps are as follows: in order to detect whether the target point of the glibenclamide up-regulated UCP1 is an ATP-sensitive potassium ion channel (K)_ATP) We first treated K in brown adipocytes_ATPThe Kir and SUR subunits of the channel were knocked out. We designed sgrnas against kir6.1, kir6.2, Sur1 and Sur2 genes and screened for highly active sgrnas:

Kir6.1：CGAAGAGCAGCCAGCTGCAG(SEQ ID NO:22)；

Kir6.2：GAAGATGCAGCCCAGCATGA(SEQ ID NO:23)；

Sur1：CAGGACAAAGAGCAGCATGA(SEQ ID NO:24)；

Sur2：CAAACGTCAGAATCCATCTC(SEQ ID NO:25)。

then Kir6.1-sgRNA and Kir6.2-sgRNA are simultaneously introduced into brown adipocytes and Sur1-sgRNA and Sur2-sgRNA are simultaneously introduced into brown adipogenic precursor cells through lentiviral vectors, and Kir (Kir6.1 and Kir6.2) and Sur (Sur 1 and Sur2) are knocked out in the brown adipogenic precursor cells respectively by using a CRISPR-Cas9 technology. The knockout cells were then differentiated according to standard differentiation protocols and Ucp1 expression was detected 8 days after cell differentiation. Cells knocked out for Kir or Sur were also tested for expression of Ucp1 under stimulation with glyburide (added 7 days after cell differentiation, 1 day treatment).

The results of the experiment are shown in FIGS. 17 and 18. Fig. 17 shows that sgrnas (upper left one, upper left two, lower left one, lower left two) were designed for exon 2 of kir6.1, exon 1 of kir6.2, exon 2 of Sur1, and exon 4 of Sur2, and the activity of each sgRNA in brown adipocytes was separately detected. The results showed that all 4 sgrnas had higher cleavage activity (upper right panel)One, the upper right two, the lower right one, and the lower right two). Fig. 18 shows that there was no difference in mRNA and protein expression for Kir and Sur, Ucp1 knockouts in brown adipocytes, respectively, and that Ucp1 did not differ in mRNA and protein levels for treatment with glyburide in Kir and Sur knockout cells. Suggesting that glyburide up-regulates UCP1 may not depend on ATP-sensitive potassium channel (K)_ATP)。

4) Up-regulation of UCP1 by glibenclamide is independent of Epac2 and Cav1

The experimental steps are as follows: to further verify whether glyburide up-regulated UCP1 passed K_ATPOr Epac2, we selected the following 4 compounds for validation:

compound (I)	Known target point	Structural information
			Glibenzoyl urea	K_ATP，Epac2	With core clusters of sulfonylureas
Gliclazide	K_ATP，not Epac2	With a larger core group of sulfonylureas
			Repaglinide	K_ATP，not Epac2	Non-sulfonylurea core groups
Nateglinide	K_ATP，not Epac2	Non-sulfonylurea core groups
			Tolbutamide	K_ATP，Epac2	With core groups of sulphonyl ureas

We first treated these 4 compounds separately during the differentiation of brown adipocytes (7 days after differentiation of cells, 10. mu.M concentration) for 1 day and examined Ucp1 expression. Meanwhile, the 4 compounds are respectively added in the differentiation process of white fat cells (the compounds are added after the cells are differentiated for 6 days, the action concentration is 10 mu M) for 4 days, and the expression of Ucp1 is detected. And simultaneously knocking Epac2 out of brown adipocytes, designing sgRNA aiming at the Epac2 gene, screening the sgRNA with high activity, introducing the Epac2-sgRNA into the brown adipocyte precursor cells through a lentiviral vector, and knocking Epac2 out of the brown adipocyte precursor cells by using a CRISPR-Cas9 technology. The knockout cells were then differentiated according to standard differentiation protocols and Ucp1 expression was detected 8 days after cell differentiation. Cells knocked out of Epac2 were also tested for expression of Ucp1 under stimulation with glyburide (added 7 days after cell differentiation, 1 day treatment). Furthermore, to examine whether glyburide upregulated UCP1 by Cav1, we knocked out Cav1 in brown adipocytes. We designed sgrnas against Cav1 gene and screened for highly active sgrnas:

Epac2：

Cav1：

cav1-sgRNA was then introduced into brown adipogenic precursor cells via lentiviral vectors, and the Cavl was knocked out in the brown adipogenic precursor cells using CRISPR-Cas9 technology. The knockout cells were then differentiated according to standard differentiation protocols and Ucp1 expression was detected 8 days after cell differentiation. Cells knocked out Cav1 were also tested for expression of Ucp1 under stimulation with glyburide (added 7 days after cell differentiation, 1 day treatment).

The results of the experiments are shown in fig. 19, 20, 21 and 22. Fig. 19 shows that only glyburide significantly promoted expression of brown adipocyte Ucp1 at the mRNA and protein levels. Fig. 20 shows that only glyburide can promote the expression of UCP1 protein in white adipocytes. Fig. 21 shows that sgrnas (left one and right two) were designed for exon 2 of Epac2 and exon 2 of Cav1, and the activity of each sgRNA in brown adipocytes was separately detected. The results showed that all 2 sgrnas had cleavage activity (left two, right one). Figure 22 shows that there was no difference in expression at the mRNA and protein levels for the Epac2, Ucp1 knockout in brown adipocytes, and no difference in expression at the mRNA and protein levels for Ucp1 treated with glyburide in Epac2 knockout cells. There was no difference in the expression of UCP1 protein when Cav1 was knocked out in brown adipocytes, and no difference in the expression of UCP1 protein when glyburide was added to Cav1 knocked out cells. The above results show that glyburide up-regulates UCP1 independent of Epac2 and independent of Cav 1.

5) Inhibition of Ca²⁺Can inhibit the glibenclamide from up-regulating UCP1

The experimental steps are as follows: to determine whether glyburide up-regulated UCP1 by intracellular Ca²⁺Horizontal regulation, we first validated calcium channel inhibitor Nitrendipine (Nitrendipine) and ATP-sensitive potassium channel activator Diazoxide (Diazoxide), respectively, in brown adipocytes differentiated in vitro. After 7 days of differentiation of the brown adipocytes, they were treated with nitrendipine (30. mu.M) or diazoxide (10. mu.M) under stimulation with glyburide, and Ucp1 expression was examined after 1 day.

The results of the experiment are shown in FIG. 23. Fig. 23 shows that only the calcium channel inhibitor nitrendipine significantly inhibited the glibenclamide-induced upregulation of UCP1 in brown adipocytes. Suggesting inhibition of Ca²⁺Can inhibit the glibenclamide from up-regulating UCP 1.

6) Glibenclamide upregulation of UCP1 independent of Trpv2

The experimental steps are as follows: to test whether the target of glyburide up-regulating UCP1 was TRPV2 (a non-selective cation channel), we first knocked out TRPV2 in brown adipocytes. We designed sgRNA aiming at Trpv2 gene and screened the sgRNA with high activity, then Trpv2-sgRNA (5'-CCCCATGGAGTCTCCCTTCC-3', SEQ ID NO:28) is introduced into brown fat precursor cells through a lentiviral vector, and Trpv2 is knocked out in the brown fat precursor cells by using CRISPR-Cas9 technology. The knockout cells were then differentiated according to standard differentiation protocols and Ucp1 expression was detected 8 days after cell differentiation. Meanwhile, the expression of Ucp1 of cells with knockout of Trpv2 under the stimulation of glibenclamide (10 mu M glibenclamide is added after 7 days of cell differentiation, and the cells are treated for 1 day) is detected.

The results of the experiment are shown in FIG. 24. Fig. 24 shows that there was no difference in the expression of UCP1 protein when Trpv2 was knocked out in brown adipocytes, and that there was no difference in the expression of UCP1 protein when glyburide was added to Trpv2 knocked out cells (left one). sgRNA (left two) was designed for exon 3 of Trpv2, and activity of sgRNA in brown fat was examined. The results showed that Trpv2-sgRNA had cleavage activity (right one). These results indicate that glyburide upregulates UCP1 independent of Trpv 2.

7) Glibenclamide up-regulates UCP1 through Ca²⁺Calcineurin-NFAT signal pathway

The experimental steps are as follows: to determine whether glyburide is likely to pass Ca²⁺The Calcineurin-NFAT signaling pathway regulates UCP1 expression. We selected Cyclosporine A (CsA) as an inhibitor of Calcineurin (Calcineurin) and VIVIVIT (MCE) as an inhibitor of NFAT for verification. VIVIT is a cell-penetrating peptide inhibitor of NFAT that selectively inhibits calcineurin-mediated dephosphorylation of NFAT. We first tested Ucp1 expression after 7 days of differentiation of brown adipocytes, treated with cyclosporin a or VIVIT (10 μ M) under glyburide stimulation, and 1 day later. Meanwhile, after 6 days of differentiation of white adipocytes, cyclosporin A (10. mu.M) was added under stimulation of glyburide or rosiglitazone, and Ucp1 expression was examined after 4 days.

The results of the experiment are shown in FIGS. 25 and 26. Fig. 26 shows that, in brown adipocytes,both nitrendipine and cyclosporin a significantly inhibited glyburide-induced upregulation of Ucp1 at the mRNA and protein levels (levo-one, levo-two), and VIVIT also significantly inhibited glyburide-induced upregulation of Ucp1 at the mRNA level (right-one). Indicating that Ca is inhibited in brown adipocytes²⁺The Calcineurin-NFAT signal pathway can inhibit UCP1 up-regulation caused by glibenclamide. Fig. 27 shows that both nitrendipine and cyclosporin a can significantly inhibit the upregulation of UCP1 protein by glibenclamide or rosiglitazone in white adipocytes.

Taken together, our studies showed that Ca inhibition by different inhibitors was performed in brown adipose and white adipocytes²⁺the-Calcineurin-NFAT signal pathway can prevent glibenclamide from up-regulating UCP1, and the glibenclamide is suggested to pass through Ca²⁺The Calcineurin-NFAT signaling pathway regulates the expression of UCP1 (fig. 27).

Sequence listing

<110> Shanghai Nutrition and health institute of Chinese academy of sciences

<120> use for enhancing cellular thermogenesis and treating diseases

<130> 202349

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

attgtaccac ataagcaact 20

<210> 2

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 2

gcttgatatc gaattattaa cttaaaatgg acagaccac 39

<210> 3

<211> 39

<212> DNA

<213> Artificial Sequence

<400> 3

agtagctccg ctacctgtgg tacaatccac tgtctgtct 39

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 4

ttctggagca atcgtgcaac ttggaggaag agatactgaa 40

<210> 5

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 5

tagaactagt ggatcagccc ctacaagaga agcatggcta 40

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 6

ggtagcggag ctactaactt cagc 24

<210> 7

<211> 46

<212> DNA

<213> Artificial Sequence

<400> 7

acgattgctc cagaactcaa atttacttgt acagctcgtc catgcc 46

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 8

tgccatttac tgtcagctct tg 22

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 9

agttcacctt gatgccgttc tt 22

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 10

gacaagcaga agaacggcat ca 22

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 11

ctggaacatt ggctcctccc ta 22

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

gcattcagag gcaaatcagc 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 13

gccacacctc cagtcattaa g 21

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 14

gaatagccag agtcaccttc g 21

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

agcagattcc ttaacacggc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

ccgactttgg atgggagatg 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 17

cacggatgta cttgagccag 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 18

tcacgttcaa ggtcacccta 20

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 19

tctctctctg tttggccctt 20

<210> 20

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 20

catttccctg tttgtggctg 20

<210> 21

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 21

atctggatgg ttgctctgc 19

<210> 22

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 22

cgaagagcag ccagctgcag 20

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 23

gaagatgcag cccagcatga 20

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 24

caggacaaag agcagcatga 20

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 25

caaacgtcag aatccatctc 20

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 26

cttcgtcaga tttgtttatg 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 27

gcttggggtc gcggttgacc 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 28

ccccatggag tctcccttcc 20

Claims

1. Use of an agent for increasing UCP1 expression or activity in a cell, or for enhancing heat production in a cell, said agent being selected from one or more of:

(1) a compound of formula (I) or a pharmaceutically acceptable salt or solvate or analogue thereof

Wherein R1-R10 are each independently selected from hydrogen, halogen, hydroxy and C1-C3 alkyl, R11 is pyrrole, pyrroline or phenyl substituted with one or more substituents selected from oxygen, C1-C3 alkyl, C1-C3 alkoxy, halogen, hydroxy,

(3) an activator of a calcium ion channel, which is a calcium ion channel,

(4) an agent that upregulates the expression or activity of calcineurin,

(5) an agent that upregulates the expression or activity of NFAT.

2. Use according to claim 1, characterized in that it has one or more characteristics selected from:

R1-R4 are each independently selected from hydrogen, halogen, hydroxy and alkyl, R5-R10 are hydrogen, or R3-R6 are each independently selected from hydrogen, halogen, hydroxy and alkyl, R1-R2 and R7-R10 are hydrogen,

the agent for up-regulating the expression of the calcium channel-associated protein or the subunit thereof is an expression vector for the calcium channel-associated protein or the subunit thereof,

the agent that upregulates the activity of a calcium channel-associated protein or subunit thereof is an agonist of a calcium channel-associated protein or subunit thereof,

the agent that upregulates the expression of calcineurin is an expression vector for calcineurin,

agents that upregulate the activity of calcineurin are calcineurin agonists,

the agent that upregulates the expression of NFAT is an expression vector for NFAT,

an agent that upregulates the activity of NFAT is an NFAT agonist.

3. Use according to claim 1 or 2, wherein the cells are adipocytes.

4. Use of an agent for the manufacture of an agent for treating or preventing a disease benefiting from thermogenesis of brown fat, inhibiting weight gain or reducing fat content in a subject, the agent being selected from one or more of:

(3) an activator of a calcium ion channel, which is a calcium ion channel,

(4) an agent that upregulates the expression or activity of calcineurin,

(5) an agent that upregulates the expression or activity of NFAT.

5. Use according to claim 4, characterized in that it has one or more characteristics selected from:

agents that upregulate the activity of calcineurin are calcineurin agonists,

an agent that upregulates the activity of NFAT is an NFAT agonist.

6. The use according to claim 4, wherein the disease benefiting from thermogenesis of fat is obesity and/or a metabolic disease,

preferably, the metabolic disease is selected from: type 2 diabetes, diabetic ketoacidosis, fatty liver, hyperuricemia, hyperosmolar syndrome, hypoglycemia, gout, protein-energy malnutrition, vitamin A deficiency, scurvy, vitamin D deficiency, osteoporosis, hyperlipidemia, metabolic encephalopathy, hepatic encephalopathy, and inborn errors of metabolism.

7. A pharmaceutical composition comprising one or more agents selected from the group consisting of:

(1) a compound represented by the following formula (I) or a pharmaceutically acceptable salt or solvate thereof,

(2) agents for upregulating expression or activity of calcium channel-associated proteins or subunits thereof

(3) An activator of a calcium ion channel, which is a calcium ion channel,

(4) an agent that upregulates the expression or activity of calcineurin,

(5) an agent that upregulates the expression or activity of NFAT.

8. The pharmaceutical composition of claim 7, wherein the pharmaceutical composition has one or more characteristics selected from the group consisting of:

agents that upregulate the activity of calcineurin are calcineurin agonists,

an agent that upregulates the activity of NFAT is an NFAT agonist,

other agents that treat or prevent a disease that would benefit from lipothermogenesis, inhibit weight gain or reduce fat content in a subject are agents that reduce fat absorption and/or agents that suppress appetite.

9. A non-therapeutic and non-diagnostic method for increasing UCP1 expression or activity in mammalian tissue or cells in vitro or for enhancing thermogenesis in mammalian tissue or cells comprising one or more steps selected from the group consisting of:

(2) up-regulating the expression or activity of a calcium channel-associated protein or subunit thereof in said tissue or cell

(5) up-regulating the expression or activity of NFAT in said tissue or cell,

preferably, the cell is an adipocyte; the tissue is adipose tissue.

10. A method of screening for a compound that enhances thermogenesis in a tissue or cell of a mammal, treats or prevents a disease benefiting from thermogenesis in fat, inhibits weight gain in a subject, or reduces fat content in a subject, comprising the steps of:

(1) incubating the tissue or cell in the presence of the compound,

(2) detecting UCP1 expression or activity in the tissue or cell,