CN113621619A - Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof - Google Patents
Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof Download PDFInfo
- Publication number
- CN113621619A CN113621619A CN202110802546.9A CN202110802546A CN113621619A CN 113621619 A CN113621619 A CN 113621619A CN 202110802546 A CN202110802546 A CN 202110802546A CN 113621619 A CN113621619 A CN 113621619A
- Authority
- CN
- China
- Prior art keywords
- gene
- bmpnd
- diapause
- silkworm
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43563—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
- C07K14/43586—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from silkworms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Abstract
The invention relates to an essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof, belonging to the technical research field of silkworms. The invention can change the silkworm eggs which should enter diapause into non-diapause eggs by targeting the Bmpnd-2 gene of the silkworm, reducing the expression quantity of the gene or destroying the Bmpnd-2 gene structure. The invention can be used for cultivating the silkworm materials and varieties with adjustable fertility in silkworm industry production, and provides a new idea for realizing pest control by regulating and controlling the egg diapause of lepidoptera insects.
Description
Technical Field
The invention belongs to the technical research field of silkworm, and particularly relates to an essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof.
Background
During the natural selection process, the insects form various survival strategies adapting to the periodic adverse environment. Diapause is a seasonal strategy in which insects actively stop developing at a particular stage of growth to pass through a hostile environment. The method is used for researching the genetic basis of the diapause of the insects, is helpful for understanding the reason causing the diapause of the insects, provides a new idea for the research of the diapause of the insects, can also provide a potential molecular target for the prevention and control of lepidoptera pests, and has important scientific significance and application value.
According to the stage of diapause, it can be divided into embryo diapause, larva diapause, pupa diapause and adult diapause. The silkworm is a typical embryo diapause insect, has various strains of first-pass, second-pass and polytropic, can provide rich materials for diapause research, and is an important model organism for researching embryo diapause.
The embryo diapause of silkworms is controlled by the maternal effect and the embryo self genotype together, and the current researches on the diapause of silkworms mainly focus on the maternal effect aspect that the diapause of offspring is influenced by different amounts of DH secreted by hypopharynx caused by the induction and the sex related genes of the maternal environment, the lipid and carbohydrate metabolism in diapause eggs and non-diapause eggs, and the like. And the research on how to regulate diapause is less for the offspring embryo self-genotype, namely what the diapause determining factor is after fertilization.
In the study of silkworm gene function, transgene, gene interference and gene knockout are generally realized by embryo injection. If the material is diapause eggs, the method of high oxygen, electric stimulation or mother generation incubation temperature (dichotomy) adjustment is needed to remove the diapause after injection, which can cause damage to the silkworm eggs or remove incomplete diapause; if the material is a multi-chemical non-diapause egg, the positive individuals need to be continuously subcultured, and the workload is large. Therefore, there is an urgent need to obtain an injection material which is genetically stable and has easily controlled diapause. The gene essential for diapause can be used as a molecular target for creating a silkworm material for injection with adjustable diapause.
In addition, silkworms are important lepidoptera model insects, diapause is a ubiquitous characteristic of lepidoptera agricultural and forestry pests, and the method researches related genes of the diapause of the silkworms and identifies conserved diapause regulatory genes of the lepidoptera insects so as to achieve the aim of controlling the pests by controlling the diapause of the insects.
Therefore, there is an urgent need to identify the essential genes for diapause of silkworms. Provides new understanding for the research of silkworm embryo diapause; providing a theoretical basis for creating adjustable diapause silkworm materials; provides a potential molecular target for the prevention and control research of lepidoptera pests.
Disclosure of Invention
In view of the above, the present invention provides an essential gene Bmpnd-2 for diapause of silkworm eggs, the second purpose of the present invention is to provide an application of the essential gene Bmpnd-2 for diapause of silkworm eggs in regulation and control of diapause of silkworm eggs, the third purpose of the present invention is to provide a method for inhibiting diapause of silkworm eggs, and the fourth purpose of the present invention is to provide a reagent or a compound containing the essential gene Bmpnd-2 for diapause of silkworm eggs for transcription, translation or function inhibition.
In order to achieve the purpose, the invention provides the following technical scheme:
1. a silkworm egg diapause essential gene Bmpnd-2, the nucleotide sequence of the gene comprises 1) and 2):
1)SEQ ID NO.1；
2) nucleotide sequence which has at least 70% of basic groups same as SEQ ID NO.1 and expresses protein with same function as the gene sequence.
As one of the preferred technical features, the amino acid sequence of the protein encoded by the gene includes 1) and 2):
1) shown as SEQ ID NO. 2;
2) a derived protein which is formed by substituting, deleting or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.2 and has the same function as the protein; or a derivative protein which has at least 50 percent of homology with the amino acid sequence of SEQ ID NO.2 and has the same function with the protein.
2. The application of the silkworm egg diapause essential gene Bmpnd-2 in regulation and control of silkworm egg diapause.
3. A method for inhibiting silkworm egg diapause is to reduce or inhibit the transcription and translation of a silkworm egg diapause essential gene Bmpnd-2 by taking a silkworm egg diapause essential gene Bmpnd-2 as a target.
As one of the preferred features, the methods of reducing or inhibiting include, but are not limited to, gene mutation, gene silencing, and gene knockout.
As one of the preferable technical characteristics, the gene knocking-out method is to adopt a CRISPR/Cas9 system to carry out gene editing and knock-out the Bmpnd-2 gene.
As one of the preferable technical characteristics, the gene editing method comprises the steps of selecting a sgRNA binding site according to a cDNA sequence of a Bmpnd-2 gene, synthesizing a sgRNA sequence, mixing the sgRNA and a Cas9 protein, and injecting the mixture into a newly-produced silkworm egg, wherein the sgRNA binding site sequences are SEQ ID NO. 3 and SEQ ID NO. 4.
As one of the preferable technical characteristics, the gene silencing method is to adopt specific small interfering RNA to silence Bmpnd-2 gene and down-regulate the expression of Bmpnd-2 gene of silkworm.
As one of the preferable technical characteristics, the small interfering RNA sequence is SEQ ID NO. 11, SEQ ID NO. 12.
4. Contains an agent or a compound for inhibiting the transcription, translation or function of a silkworm egg diapause essential gene Bmpnd-2.
The invention has the beneficial effects that:
the invention can change the silkworm eggs which should enter diapause into non-diapause eggs by targeting the Bmpnd-2 gene of the silkworm, reducing the expression quantity of the gene or destroying the Bmpnd-2 gene structure. The invention can be used for cultivating the silkworm materials and varieties with adjustable fertility in silkworm industry production, and provides a new idea for realizing pest control by regulating and controlling the egg diapause of lepidoptera insects.
Drawings
For the purposes of promoting a better understanding of the objects, aspects and advantages of the invention, reference will now be made to the following detailed description taken in conjunction with the accompanying drawings in which:
FIG. 1: structural schematic diagram of silkworm Bmpnd-2 gene and sgRNA target sequence.
FIG. 2: bmpd-2 mutation types in Bmpld-2 knockout Dazao homozygous lines.
FIG. 3: the Bmpnd-2 gene knockout Dazao homozygous line is subjected to the green-forcing at 25 ℃, and the offspring eggs do not enter diapause.
FIG. 4: is onpnd-2/+pnd-2And the expression level of Bmplnd-2 gene is reduced after siRNA injection in the C-4 and Dazao strains.
FIG. 5: is onpnd-2/+pnd-2After siRNA is injected into strains C-4 and Dazao, the silkworm eggs do not enter diapause.
Detailed Description
The invention will be further illustrated with reference to specific preferred embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not indicated in the examples, are generally carried out according to conventional conditions, such as those described in the molecular cloning protocols (third edition, sambrook et al), or according to the manufacturer's recommendations.
Example 1
Bmpnd-2 gene knockout system for CRISPR/Cas9 gene editing system
(1) selection of sgRNA binding site and synthesis of sgRNA
The sgRNA binding site existing in the cDNA sequence of Bmpnd-2 gene is predicted by using website CRISPRdirect (http:// crispr. dbcls. jp /), and compared with silkworm genome, two sgRNA binding site sequences with higher specificity are selected. The nucleotide sequence of the Bmpnd-2 gene is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO. 2. The structural schematic diagram of the bombyx mori Bmpnd-2 gene and the sgRNA target sequence are shown in figure 1.
The sgRNA recognizes the target sequence as follows:
sgRNA1：5’-CATTCCAAATCCTAAGGAAT-3’(SEQ ID NO:3)
sgRNA2：5’-ACCCTTTATGCTAGGAAACC-3’(SEQ ID NO:4)
according to the selected sgRNA target sequences, the following primers were synthesized:
sgRNA-F1：TAATACGACTCACTATAGGGCATTCCAAATCCTAAGGAATGTTTTAGAGCTAGAAATAGC(SEQ ID NO:5)
sgRNA-F2：TAATACGACTCACTATAGGGACCCTTTATGCTAGGAAACCGTTTTAGAGCTAGAAATAGC(SEQ ID NO:6)
sgRNA-R：
AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC(SEQ ID NO:7)
annealing extension was performed using PrimeSTAR GXL high fidelity polymerase, and after PCR was complete, gel recovery and purification were performed.
sgRNA was synthesized by in vitro transcription using a PCR-recovered purified product as a template and using a T7 in vitro transcription kit produced by Promaga, and purified.
sgRNA framework sequence (SEQ ID NO: 8):
NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT
(2) silkworm embryo microinjection and knockout homozygous line screening
Uniformly mixing sgRNA and Cas9 protein in a ratio of 2:1 to ensure that the final concentration of the gRNA is 1000 ng/mu L and the final concentration of Cas9 is 500 ng/mu L, reacting in a PCR instrument at 37 ℃ for 15min, injecting into newly-born silkworm eggs by using a microinjection instrument, sealing the silkworm eggs by using glue after injection, preserving moisture, placing in a 25 ℃ artificial climate incubator for incubation, and observing the development condition of the silkworm eggs at any time.
After silkworm eggs are hatched, when the newly-hatched silkworms are raised to the moth stage under appropriate conditions, wings of moths are cut off, genome DNA is extracted, and sgRNA target spot outer side primers Bmpnd-2-TS-F, Bmpnd-2-TS-R are designed to amplify and sequence and detect the genome sequence at the editing position.
Bmpnd-2-TS-F：ACTTTCGCAAGAAGTCGCG(SEQ ID NO:9)
Bmpnd-2-TS-R：GCTGTTGTCTACCTCAGACACG(SEQ ID NO:10)
After editing, the moth with the gene function lost is selected for mating, and the silkworm is continuously raised for several generations to screen Bmpnd-2 gene knockout homozygous line, and the mutation type is shown in figure 2.
(3) Hysteresis fertility observation of Bmpnd-2 gene knockout homozygous line silkworm
And (3) carrying out incubation on the screened homozygous strain silkworm eggs with the Bmpnd-2 gene knockout at the temperature of 25 ℃, and observing whether the offspring eggs enter diapause. The results indicate that the next generation egg no longer enters diapause, as shown in fig. 3.
Example 2
Small interfering RNA silencing Bmpnd-2 gene
(1) Selection and synthesis of Bmpnd-2 gene interference target site
Predicting siRNA sites in Bmpnd-2 gene cDNA sequences at http:// siderect2. rnai. jp/website, comparing the siRNA sites with silkworm genomes, and selecting 2 siRNA sequences with high specificity for synthesis. The siRNA target sequences are shown as follows:
siRNA1：5’-GCUAGGAAACCUGGAGAAA-3’(SEQ ID NO:11)
siRNA2：5’-CCCUUAACUUUGAGAUGAU-3’(SEQ ID NO:12)
(2) micro-injection of silkworm embryo
The synthesized siRNA is diluted to a final concentration of 500 ng/. mu.L, injected into newly-laid silkworm eggs (the injection should be carried out within 2h after the silkworm eggs lay), and the needle holes on the silkworm eggs after the injection are sealed by glue to prevent the loss of nutrient substances in the silkworm eggs. Fully moisturizing the silkworm eggs after injection, and carrying out incubation in an artificial climate incubator at 25 ℃.
(3) Bmpnd-2 expression detection and silkworm egg phenotype observation
After the injected silkworm eggs are subjected to incubation for 36h at 25 ℃, quantitative primers qBmpnd-2-F and qBmpnd-2-R are designed to carry out qRT-PCR detection to determine whether the expression of Bmpnd-2 is reduced after interference, and the detection of the expression quantity is shown in figure 4. The primer sequences are as follows:
qBmpnd-2-F：GCAGCTCCACCAGATCTTTACG(SEQ ID NO:13)
qBmpnd-2-R：GCCTCATTCACGCTCAGTTCC(SEQ ID NO:14)
after the silkworm eggs after injection are subjected to incubation at 25 ℃ for 6 days, the development state of the silkworm eggs is dissected and observed. The eggs cannot enter diapause as shown in fig. 5.
In the embodiments 1 and 2 of the invention, Bmpnd-2 gene is knocked out by using CRISPR/Cas9 mediated gene editing technology and Bmpnd-2 gene expression is reduced by using siRNA mediated gene editing technology, and the skilled person knows that any means which can knock out or knock down the Bmpnd-2 gene can achieve the purpose of the invention.
Finally, the above embodiments are only intended to illustrate the technical solutions of the present invention and not to limit the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions, and all of them should be covered by the claims of the present invention.
Sequence listing
<110> university of southwest
<120> one silkworm egg diapause essential gene Bmpnd-2 and application thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1530
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgttgacta ccgtgataat gttattcttg gcaaaaacgt cgctagctta cgaaatgcga 60
tgcagcgatc aaaaaaatga aagtgttagt tttatgccgt cgaacgacgg tgtcatgggt 120
cggtacgtag tggaggtatg catgaagtcc attccaaatc ctaaggaatg ggctctcgat 180
ctcatggtcg aagagcgcgc tcgcacgtac tcaaagaccc tttatgctag gaaacctgga 240
gaaacgcatt caatgttcaa agcctactat acagatgaaa atttcaaaga attgaattgt 300
acacacgtgt gcttgaccct taactttgag atgatattta gcagctgtta cttattggtg 360
tctgttttaa ctggagatta tactggcaca ccatatctta catatcacaa cattacaaat 420
aactacacaa gaaataactt tagtggagag cccatagtca gctactatgg gcatgaaaaa 480
tttgcaagca tcgatttcta tacagcagct ccaccagatc tttacgacat attcctctgt 540
ccgaaatcaa atttgcatgc gaactgcttg aatatgatga acaattgcac cataactttc 600
tccccggcga aggtccactg ttctctcagt gaggctggtt gccacatctt ggaactgagc 660
gtgaatgagg caccttggaa acatgggatg ttcaagaacc aatccaacac tatctatgag 720
ttttgctggc ggccgggctc ggcgcccacg gtgagcggct ggggaggcgg cgcggcgtgg 780
ctggcgggcg ccgtgctggc ggccgcggcg ctgctgctgc tgggctgccg gctccgcgcc 840
tcggcccact tccggaagcg cgtgctctac tactggacca ggaggagcga gacggcggcc 900
ccgcccccgc ccccgccccg cggcgccccc gtgctgctgc tgtacgcgcg cgagggcgcc 960
gccggacagc gcgtcgtcaa ctcgctgcgg gacctgctgc aggcgacttg cggggtcaag 1020
gtgcaggacg tgtacagcgc ggagtggcag cgcgcgtgcg gcgccgaccc cgccggagcc 1080
ctgcgcgccg ccctggagcc gcggggctgc gcgcggctgg tgctgctgca gacgccggcg 1140
ctgggcgcgc tgcacgccgc ccccgccgcg ccggacgccg ggccgctgct gggcgagcgc 1200
gtgctgtacc gcgcgccgca cttcgccgac acgctgctgc cctacgcgct gcgcctgctg 1260
gtgggcacgg cgcacctgcg cgcgccctac cgccgcctct acctggccac gctcaccgac 1320
ctggacacgg acgtgttccc gcagctcgtc ccctacgtgc gctaccgcct gcccgacgcg 1380
ctgcccgccc tgctgcgcga cctgggcgcg ggcccggagc cggctgcggg ggacgcgcac 1440
gaccagctgg cggccgccat ccaggagttc gtggtccacg tgaggaacaa ccccgactac 1500
ctcacggagg agctcgtgct ggtgtcgtga 1530
<210> 2
<211> 509
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Leu Thr Thr Val Ile Met Leu Phe Leu Ala Lys Thr Ser Leu Ala
1 5 10 15
Tyr Glu Met Arg Cys Ser Asp Gln Lys Asn Glu Ser Val Ser Phe Met
20 25 30
Pro Ser Asn Asp Gly Val Met Gly Arg Tyr Val Val Glu Val Cys Met
35 40 45
Lys Ser Ile Pro Asn Pro Lys Glu Trp Ala Leu Asp Leu Met Val Glu
50 55 60
Glu Arg Ala Arg Thr Tyr Ser Lys Thr Leu Tyr Ala Arg Lys Pro Gly
65 70 75 80
Glu Thr His Ser Met Phe Lys Ala Tyr Tyr Thr Asp Glu Asn Phe Lys
85 90 95
Glu Leu Asn Cys Thr His Val Cys Leu Thr Leu Asn Phe Glu Met Ile
100 105 110
Phe Ser Ser Cys Tyr Leu Leu Val Ser Val Leu Thr Gly Asp Tyr Thr
115 120 125
Gly Thr Pro Tyr Leu Thr Tyr His Asn Ile Thr Asn Asn Tyr Thr Arg
130 135 140
Asn Asn Phe Ser Gly Glu Pro Ile Val Ser Tyr Tyr Gly His Glu Lys
145 150 155 160
Phe Ala Ser Ile Asp Phe Tyr Thr Ala Ala Pro Pro Asp Leu Tyr Asp
165 170 175
Ile Phe Leu Cys Pro Lys Ser Asn Leu His Ala Asn Cys Leu Asn Met
180 185 190
Met Asn Asn Cys Thr Ile Thr Phe Ser Pro Ala Lys Val His Cys Ser
195 200 205
Leu Ser Glu Ala Gly Cys His Ile Leu Glu Leu Ser Val Asn Glu Ala
210 215 220
Pro Trp Lys His Gly Met Phe Lys Asn Gln Ser Asn Thr Ile Tyr Glu
225 230 235 240
Phe Cys Trp Arg Pro Gly Ser Ala Pro Thr Val Ser Gly Trp Gly Gly
245 250 255
Gly Ala Ala Trp Leu Ala Gly Ala Val Leu Ala Ala Ala Ala Leu Leu
260 265 270
Leu Leu Gly Cys Arg Leu Arg Ala Ser Ala His Phe Arg Lys Arg Val
275 280 285
Leu Tyr Tyr Trp Thr Arg Arg Ser Glu Thr Ala Ala Pro Pro Pro Pro
290 295 300
Pro Pro Arg Gly Ala Pro Val Leu Leu Leu Tyr Ala Arg Glu Gly Ala
305 310 315 320
Ala Gly Gln Arg Val Val Asn Ser Leu Arg Asp Leu Leu Gln Ala Thr
325 330 335
Cys Gly Val Lys Val Gln Asp Val Tyr Ser Ala Glu Trp Gln Arg Ala
340 345 350
Cys Gly Ala Asp Pro Ala Gly Ala Leu Arg Ala Ala Leu Glu Pro Arg
355 360 365
Gly Cys Ala Arg Leu Val Leu Leu Gln Thr Pro Ala Leu Gly Ala Leu
370 375 380
His Ala Ala Pro Ala Ala Pro Asp Ala Gly Pro Leu Leu Gly Glu Arg
385 390 395 400
Val Leu Tyr Arg Ala Pro His Phe Ala Asp Thr Leu Leu Pro Tyr Ala
405 410 415
Leu Arg Leu Leu Val Gly Thr Ala His Leu Arg Ala Pro Tyr Arg Arg
420 425 430
Leu Tyr Leu Ala Thr Leu Thr Asp Leu Asp Thr Asp Val Phe Pro Gln
435 440 445
Leu Val Pro Tyr Val Arg Tyr Arg Leu Pro Asp Ala Leu Pro Ala Leu
450 455 460
Leu Arg Asp Leu Gly Ala Gly Pro Glu Pro Ala Ala Gly Asp Ala His
465 470 475 480
Asp Gln Leu Ala Ala Ala Ile Gln Glu Phe Val Val His Val Arg Asn
485 490 495
Asn Pro Asp Tyr Leu Thr Glu Glu Leu Val Leu Val Ser
500 505
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cattccaaat cctaaggaat 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
accctttatg ctaggaaacc 20
<210> 5
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
taatacgact cactataggg cattccaaat cctaaggaat gttttagagc tagaaatagc 60
<210> 6
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
taatacgact cactataggg accctttatg ctaggaaacc gttttagagc tagaaatagc 60
<210> 7
<211> 80
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aaaagcaccg actcggtgcc actttttcaa gttgataacg gactagcctt attttaactt 60
gctatttcta gctctaaaac 80
<210> 8
<211> 100
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
nnnnnnnnnn nnnnnnnnnn gttttagagc tagaaatagc aagttaaaat aaggctagtc 60
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 100
<210> 9
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
actttcgcaa gaagtcgcg 19
<210> 10
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gctgttgtct acctcagaca cg 22
<210> 11
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gcuaggaaac cuggagaaa 19
<210> 12
<211> 19
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
cccuuaacuu ugagaugau 19
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gcagctccac cagatcttta cg 22
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gcctcattca cgctcagttc c 21
Claims (10)
1. An essential gene Bmpnd-2 for diapause of silkworm eggs, which is characterized in that the nucleotide sequence of the gene comprises 1) and 2):
1)SEQ ID NO.1；
2) nucleotide sequence which has at least 70% of basic groups same as SEQ ID NO.1 and expresses protein with same function as the gene sequence.
2. The silkworm egg diapause essential gene Bmpnd-2 as claimed in claim 1, wherein the amino acid sequence of the gene-encoded protein comprises 1) and 2):
1) shown as SEQ ID NO. 2;
2) a derived protein which is formed by substituting, deleting or adding one or more amino acid residues to the amino acid sequence of SEQ ID NO.2 and has the same function as the protein; or a derivative protein which has at least 50 percent of homology with the amino acid sequence of SEQ ID NO.2 and has the same function with the protein.
3. The use of the silkworm egg diapause essential gene Bmpnd-2 as defined in claim 1 or 2 for regulating silkworm egg diapause.
4. A method for inhibiting diapause of silkworm eggs, which comprises reducing or inhibiting the transcription and translation of the silkworm egg diapause essential gene Bmpnd-2 by targeting the silkworm egg diapause essential gene Bmpnd-2 of claim 1 or 2.
5. The method of claim 4, wherein the method of reducing or inhibiting includes, but is not limited to, gene mutation, gene silencing, and gene knock-out.
6. The method of claim 5, wherein the gene knockout is carried out by gene editing using CRISPR/Cas9 system to knock out Bmpnd-2 gene.
7. The method of claim 6, wherein the gene editing method comprises the steps of selecting a sgRNA binding site according to a cDNA sequence of Bmpnd-2 gene, synthesizing a sgRNA sequence, mixing the sgRNA and Cas9 protein, and injecting the mixture into a newly-produced silkworm egg, wherein the sgRNA binding site sequences are SEQ ID NO. 3 and SEQ ID NO. 4.
8. The method of claim 5, wherein the gene silencing is achieved by down-regulating bombyx mori expression of the Bmpnd-2 gene using specific small interfering RNAs to silence the Bmpnd-2 gene.
9. The method of claim 8, wherein the small interfering RNA sequences are SEQ ID NO 11, SEQ ID NO 12.
10. An agent or a compound for inhibiting the transcription, translation or function of the silkworm egg diapause essential gene Bmpnd-2 according to claim 1 or 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110802546.9A CN113621619B (en) | 2021-07-15 | 2021-07-15 | Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110802546.9A CN113621619B (en) | 2021-07-15 | 2021-07-15 | Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113621619A true CN113621619A (en) | 2021-11-09 |
| CN113621619B CN113621619B (en) | 2023-09-12 |
Family
ID=78379872
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110802546.9A Active CN113621619B (en) | 2021-07-15 | 2021-07-15 | Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113621619B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113481207A (en) * | 2021-07-15 | 2021-10-08 | 西南大学 | Essential gene Bmtret1 for diapause of silkworm eggs and application thereof |
| CN113897370A (en) * | 2021-10-29 | 2022-01-07 | 郑州轻工业大学 | Silkworm BmTRPM gene and application thereof |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5322928A (en) * | 1991-03-04 | 1994-06-21 | Shionogi Seiyaku Kabushiki Kaisha | Diapause hormone isolated from silkworm exhibiting improved diapause activity |
| WO2001027301A2 (en) * | 1999-10-15 | 2001-04-19 | The Rockefeller University | System for rapid generation of recombinant baculovirus-based expression vectors for silkworm larvae |
| JP2003088274A (en) * | 2001-09-19 | 2003-03-25 | National Institute Of Agrobiological Sciences | Method for introducing polynucleotide to silkworm producing dormant egg |
| EP1482035A1 (en) * | 2002-03-06 | 2004-12-01 | Toray Industries, Inc. | Process for producing physiologically active protein using genetically modified silkworm |
| CN101195833A (en) * | 2007-12-21 | 2008-06-11 | 西南大学 | Low-temperature incubation transgene method for cultivated silkworm diapause breed variety |
| CN101492680A (en) * | 2008-12-11 | 2009-07-29 | 西南大学 | Cultivated silkworm receptor protein gene Bmor3 and uses thereof |
| CN101503704A (en) * | 2009-03-17 | 2009-08-12 | 西南大学 | Transgenic method for cultivated silkworm diapause variety |
| CN106973868A (en) * | 2017-04-13 | 2017-07-25 | 西南大学 | Pole early stage corona releases method of cultivated silkworm diapause ovum Diapause and products thereof |
| CN107027718A (en) * | 2017-04-12 | 2017-08-11 | 广西壮族自治区蚕业技术推广总站 | The method that Diapause transgenic bombyx mori is made by instant corona |
| CN108610427A (en) * | 2018-05-15 | 2018-10-02 | 中国农业科学院植物保护研究所 | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause |
| CN111233989A (en) * | 2020-02-13 | 2020-06-05 | 中国农业科学院深圳农业基因组研究所 | Application of rice heavy metal transport protein OsHMA6 in reducing copper toxicity |
-
2021
- 2021-07-15 CN CN202110802546.9A patent/CN113621619B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5322928A (en) * | 1991-03-04 | 1994-06-21 | Shionogi Seiyaku Kabushiki Kaisha | Diapause hormone isolated from silkworm exhibiting improved diapause activity |
| WO2001027301A2 (en) * | 1999-10-15 | 2001-04-19 | The Rockefeller University | System for rapid generation of recombinant baculovirus-based expression vectors for silkworm larvae |
| JP2003088274A (en) * | 2001-09-19 | 2003-03-25 | National Institute Of Agrobiological Sciences | Method for introducing polynucleotide to silkworm producing dormant egg |
| EP1482035A1 (en) * | 2002-03-06 | 2004-12-01 | Toray Industries, Inc. | Process for producing physiologically active protein using genetically modified silkworm |
| CN101195833A (en) * | 2007-12-21 | 2008-06-11 | 西南大学 | Low-temperature incubation transgene method for cultivated silkworm diapause breed variety |
| CN101492680A (en) * | 2008-12-11 | 2009-07-29 | 西南大学 | Cultivated silkworm receptor protein gene Bmor3 and uses thereof |
| CN101503704A (en) * | 2009-03-17 | 2009-08-12 | 西南大学 | Transgenic method for cultivated silkworm diapause variety |
| CN107027718A (en) * | 2017-04-12 | 2017-08-11 | 广西壮族自治区蚕业技术推广总站 | The method that Diapause transgenic bombyx mori is made by instant corona |
| CN106973868A (en) * | 2017-04-13 | 2017-07-25 | 西南大学 | Pole early stage corona releases method of cultivated silkworm diapause ovum Diapause and products thereof |
| CN108610427A (en) * | 2018-05-15 | 2018-10-02 | 中国农业科学院植物保护研究所 | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause |
| CN111233989A (en) * | 2020-02-13 | 2020-06-05 | 中国农业科学院深圳农业基因组研究所 | Application of rice heavy metal transport protein OsHMA6 in reducing copper toxicity |
Non-Patent Citations (3)
| Title |
|---|
| NCBI: "PREDICTED:Bombyx mori uncharacterized LOC101744940(LOC101744940),transcript variant X2,mRNA" * |
| TOSHIKI HIRAKI等: "Crystallization and preliminary crystallographic studies of the metalloglycoprotein esterase A4 using a baculovirus expression system" * |
| 张盼: "家蚕着色非滞育卵pnd-2的遗传基础研究" * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113481207A (en) * | 2021-07-15 | 2021-10-08 | 西南大学 | Essential gene Bmtret1 for diapause of silkworm eggs and application thereof |
| CN113481207B (en) * | 2021-07-15 | 2023-04-07 | 西南大学 | Essential gene Bmtret1 for silkworm egg diapause and application thereof |
| CN113897370A (en) * | 2021-10-29 | 2022-01-07 | 郑州轻工业大学 | Silkworm BmTRPM gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113621619B (en) | 2023-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schmidt et al. | Genetic and molecular characterization of sting, a gene involved in crystal formation and meiotic drive in the male germ line of Drosophila melanogaster | |
| CN106191114B (en) | Breeding method for knocking out fish MC4R gene by using CRISPR-Cas9 system | |
| CN107012174A (en) | Application of the CRISPR/Cas9 technologies in silkworm zinc finger protein gene mutant is obtained | |
| Handler et al. | Prospects for gene transformation in insects | |
| Kotwica-Rolinska et al. | CRISPR/Cas9 genome editing introduction and optimization in the non-model insect Pyrrhocoris apterus | |
| CN113621619B (en) | Essential gene Bmpnd-2 for diapause of silkworm eggs and application thereof | |
| Long et al. | FLP recombinase-mediated site-specific recombination in silkworm, Bombyx mori | |
| CN106520792A (en) | Separated Adelphocoris suturalis gene and coded protein thereof | |
| CN108610427A (en) | Migratory locusts diapause hormone gene and its application in regulating and controlling Insect Diapause | |
| CN111961685A (en) | CRISPR Cas9 conditional gene knock-out mouse and establishment method | |
| Takasu et al. | Targeted mutagenesis in Bombyx mori using TALENs | |
| CN113481207B (en) | Essential gene Bmtret1 for silkworm egg diapause and application thereof | |
| CN103232977A (en) | Application of phiC31 recombinase system and piggyBac transposon and fixed point transgenetic system of silkworm and preparation method of fixed point transgenetic system | |
| Bai et al. | CRISPR/Cas9‐mediated mutagenesis of the white gene in an ectoparasitic wasp, Habrobracon hebetor | |
| Ye et al. | Sob gene is critical to wing development in Bombyx mori and Tribolium castaneum | |
| CN110791528B (en) | microRNA gene editing method for improving silk yield and optimizing silkworm variety | |
| CN109055386A (en) | Silkworm BmSCP1 gene and its recombinant expression carrier and application | |
| WO2013056664A1 (en) | Method and uses for bombyx mori silk fibroin heavy chain gene mutation sequence and mutant | |
| CN109694885B (en) | Method for preparing PI3K gamma whole-body knockout mode mouse based on CRISPR/Cas9 technology, application thereof and kit | |
| CN115851712B (en) | Application of glutamyl aminopeptidase in pest control | |
| JP5240699B2 (en) | Efficient method for producing transgenic silkworm | |
| CN115725590B (en) | Application and method of OSER1 gene in improving animal fertility or delaying reproductive aging | |
| CN115819543B (en) | Application of transcription factor Tbx20 promoter region G4 regulatory element in pest control | |
| Wisotzkey et al. | α/β hydrolase2, a predicated gene adjacent to mad in Drosophila melanogaster, belongs to a new global multigene family and is associated with obesity | |
| KR101359510B1 (en) | Hemocyte-specific promoter and its core active region of bombyx mori for regulation of tissue-specific stage gene expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |