CN113604488B - GST gene participating in anthocyanin transport and accumulation in peony and application thereof - Google Patents
GST gene participating in anthocyanin transport and accumulation in peony and application thereof Download PDFInfo
- Publication number
- CN113604488B CN113604488B CN202110852384.XA CN202110852384A CN113604488B CN 113604488 B CN113604488 B CN 113604488B CN 202110852384 A CN202110852384 A CN 202110852384A CN 113604488 B CN113604488 B CN 113604488B
- Authority
- CN
- China
- Prior art keywords
- peony
- accumulation
- anthocyanin
- transport
- gst gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
- C12N9/1088—Glutathione transferase (2.5.1.18)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/01018—Glutathione transferase (2.5.1.18)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a GST gene participating in anthocyanin transport and accumulation in peony and application thereof, wherein the GST gene participating in anthocyanin transport and accumulation is separated and identified from the peony (P.suffruticosa), plays an important role in anthocyanin transport and accumulation, can enrich a transgenic material library of peony red characters, and provides powerful support for future cultivation and regulation of molecular breeding of peony red character flowers.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a GST (Glutathione S-transferase) gene participating in transferring and accumulating anthocyanin in peony and application thereof.
Background
Plant flower color is one of important ornamental characters of ornamental plants, and flower color improvement is an important breeding target of gardeners. Peony (Paeonia suffruticosa) is a competitive product of the traditional famous flower in China, is well known as the king of flower, forms various color systems after long-term cultivation and breeding, and is popular in domestic and foreign markets.
However, for a long time, the breeding mode of peony mainly refers to cross between varieties, the randomness and blindness in the breeding process are high, and a great amount of time and energy are usually consumed to obtain an ideal variety through multi-generation breeding. In recent years, with the rapid development of scientific technology, targeted molecular breeding technology using transgenic technology has been widely applied to crops and horticultural flowers. The molecular breeding mainly comprises the step of over-expressing or knocking out genes controlling related phenotypic traits in a target plant through a transgenic technology, so that the plant obtains or loses corresponding phenotypes, and finally an ideal variety is obtained. Therefore, screening key genes for controlling related phenotypic traits is a prerequisite basis and an important resource for molecular breeding.
Anthocyanin (Anthocyannin) is the most important chromogenic substance in flavonoid, is a stable compound formed by Anthocyanin after a series of modifications such as hydroxylation, methoxylation, glycosylation and acylation, and can control the change of colors such as red, pink, violet, blue and the like of flowers, so that plants can present colorful colors. At present, the synthetic pathway of anthocyanin is clearly researched and has high conservation, and the regulation mechanism is also reported in a plurality of model and non-model plants. However, transport and accumulation of anthocyanin to vacuole are required for final presentation of flower color, and gene knockout and complementation tests prove that some members of GSTs (glutathione) families are involved in transport of anthocyanin and are efficient transporters for transporting anthocyanin from endoplasmic reticulum to vacuole. The maize Bronze2 (BZ 2) gene is the earliest discovered GST family member associated with anthocyanin transport, and anthocyanin accumulation in the cytoplasm was detected in BZ2 deletion mutants without being transported to the vacuole; arabidopsis AtGSTF12 (AtTT 19) was shown to be involved in the transport and accumulation of anthocyanidins/procyanidins; RAP in strawberry encodes a GST transporter, whose transient knockout results in reduced fruit coloration; the apple MdGSTF6 gene is proved to be involved in anthocyanin transport, and the phenotype of anthocyanin deletion can be recovered when the gene is over-expressed in an Arabidopsis TT19 mutant, and the like.
Although GST has been confirmed to be involved in the transport and accumulation of anthocyanin in various plants, the research is mostly focused on model plants or crops, and the research on ornamental flowers in the gene family is relatively deficient, especially in peony is rarely reported.
Therefore, the effect of supplementing GST genes in promoting anthocyanin transport and accumulation in peony is an important basis and precondition for future peony flower color molecule improvement breeding.
Disclosure of Invention
The invention aims to provide a GST gene participating in anthocyanin transport and accumulation in peony and application thereof, so as to improve the integrity of a pathway for controlling the red character of flowers in the peony.
The purpose of the invention is realized by the following technical scheme:
the GST gene involved in anthocyanin transport and accumulation is separated and identified from peony (P. Suffruticosa), and the CDS sequence of the GST gene involved in anthocyanin transport and accumulation is as follows:
ATGGTAGTTAAGGTGTATGGCTCAGCTAAAGCGGCTTGTCCACAAAGAGTGATGGTTTGCCTTCTGGAAAAGGAGGTGGAATTTGAAATTATACATGTTGATCTTGAATCTGGAGAGCACAAAAAGCCAGATTTCCTTGCTCGGCAGCCGTTTGGGCAAGTTCCAGCCATCGAGGATGGTGACTTGAAACTTTTTGAATCCAGGGCAATCATAAGATACTATGCAGCCAAGTTTGATAACCGCGGTTCAAACCTGTTGGGAACCACTTTGGAAGAGAGAGCTTTGATGGATCAATGGCTAGAAGTTGAAGCCCACAATTTCAATGATTTGGTTTACACTATTGTGCTTCAGATCGTAATTCTCCCCCGTATGGGACAAGGTACTGACTTGGCATTAGTCCGCACCTGTGAAGAAAAGCTTGAGAAAGTGCTTGATGTGTACGAGCAAAGGTTGTCAAAGAGCAGCTACCTGGCCGGAGACGATTTCACACTCGCTGATCTCAGTCATCTTCCTGGTCTCAGATACCTCATAAATGAAGCTGGAAAAGGATACCTGGTGACCGTGAGGAAGAATGTGAATGCATGGTGGGAGAATATATCAAATCGTCCTTCTTGGAAGAAATTAATGAATCTTGTTAATTAA。
the application of the GST gene participating in anthocyanin transport and accumulation in peony is realized by targeted regulation and control of a transgenic technology to carry out transgenic breeding.
Compared with the prior art, the function of the GST gene participating in anthocyanin transport and accumulation in the peony is verified through heterologous transformation to an Arabidopsis TT19 mutant and through virus-induced gene silencing (VIGS) technology in peony petals, and the GST gene can participate in anthocyanin transport and accumulation. In arabidopsis, overexpression in the arabidopsis TT19 mutant can restore its anthocyanin-deficient phenotype; in the peony, the target gene is silenced in a targeted manner, so that the accumulation of anthocyanin in the peony petals can be obviously reduced, and the pink petals are obviously lightened. Therefore, the GST gene can enrich and perfect the transgenic material library of the peony red character, and provides powerful support for molecular breeding of peony red character flowers in the future.
Sequence listing
GST Gene-CDS sequence of PsGSTF3.
Detailed Description
The technical solutions in the embodiments of the present invention are clearly and completely described below. It should be apparent that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments of the present invention without making any creative effort, shall fall within the protection scope of the present invention.
The technical scheme provided by the invention is that a GST gene participating in anthocyanin transport and accumulation is separated and identified from peony (P.suffruticosa), and the GST gene is named as PsGSTF3. The CDS sequences of GSTs genes which are confirmed to have anthocyanin transport and accumulation functions are not the same in different plants although they have similar functions. Therefore, GST participating in anthocyanin transport and accumulation is separated and identified in peony, so that a gene material library for peony transgenic molecule breeding can be enriched, and support is provided for future cultivation of peony with red character flowers.
The CDS sequence of the PsGSTF3 gene isolated and identified in the invention is:
ATGGTAGTTAAGGTGTATGGCTCAGCTAAAGCGGCTTGTCCACAAAGAGTGATGGTTTGCCTTCTGGAAAAGGAGGTGGAATTTGAAATTATACATGTTGATCTTGAATCTGGAGAGCACAAAAAGCCAGATTTCCTTGCTCGGCAGCCGTTTGGGCAAGTTCCAGCCATCGAGGATGGTGACTTGAAACTTTTTGAATCCAGGGCAATCATAAGATACTATGCAGCCAAGTTTGATAACCGCGGTTCAAACCTGTTGGGAACCACTTTGGAAGAGAGAGCTTTGATGGATCAATGGCTAGAAGTTGAAGCCCACAATTTCAATGATTTGGTTTACACTATTGTGCTTCAGATCGTAATTCTCCCCCGTATGGGACAAGGTACTGACTTGGCATTAGTCCGCACCTGTGAAGAAAAGCTTGAGAAAGTGCTTGATGTGTACGAGCAAAGGTTGTCAAAGAGCAGCTACCTGGCCGGAGACGATTTCACACTCGCTGATCTCAGTCATCTTCCTGGTCTCAGATACCTCATAAATGAAGCTGGAAAAGGATACCTGGTGACCGTGAGGAAGAATGTGAATGCATGGTGGGAGAATATATCAAATCGTCCTTCTTGGAAGAAATTAATGAATCTTGTTAATTAA。
the application of the GST gene participating in anthocyanin transport and accumulation in peony is realized by targeted regulation and control of a transgenic technology to carry out transgenic breeding.
Used in Arabidopsis thaliana, overexpression in Arabidopsis TT19 mutant can restore its anthocyanin-deficient phenotype.
When the anthocyanin-containing peony flower bud is used in peony, the accumulation of anthocyanin in peony petals is obviously reduced through targeted silencing of a target gene, and pink petals are obviously lightened.
The implementation process of transgenic breeding by using the GST gene provided by the invention is described below by taking the overexpression of the PsGSTF3 gene in the Arabidopsis TT19 mutant and the silencing of the PsGSTF3 gene in peony petals as examples respectively, so as to verify the feasibility of the corresponding transgenic breeding process.
The specific process that the function of the GST gene participating in anthocyanin transport and accumulation is respectively proved in Arabidopsis and peony is as follows:
1. heterologous transformation of Arabidopsis thaliana TT19 mutant with PsGSTF3 gene
1) Extracting total RNA from peony petals, and performing reverse transcription to obtain cDNA. Then, cloning by using a specific primer of PsGSTF3 to obtain a complete CDS sequence, and sequencing to ensure the integrity and accuracy of the sequence;
2) Constructing a complete CDS sequence of PsGSTF3 between two enzyme cutting sites (Hind 3 and XbaI) of a plant expression vector PHB in a seamless cloning mode, and sequencing;
3) The constructed expression vector was transferred to Agrobacterium GV3101, spread on LB plate containing 50. Mu.g/mL kanamycin, and placed in an incubator at 28 ℃ for 2-3 days in an inverted state. Randomly selecting a single colony, performing colony PCR, and identifying a correct agrobacterium tumefaciens monoclonal as a marker for later use;
4) Selecting correct agrobacterium tumefaciens monoclonal to be inoculated into 1.5mL of LB liquid culture medium containing corresponding antibiotics, carrying out shaking culture at 28 ℃ and 200rpm for 24 hours;
5) Inoculating the underswing agrobacterium culture into 100mL LB liquid culture medium containing antibiotics according to the proportion of 1%, performing shaking culture at 28 ℃ and 200rpm until OD600=1.0, performing 4000rpm, centrifuging for 15min, and collecting thalli;
6) Uniformly blowing the thalli by using a transformation Buffer, and suspending the thalli until OD600= 1.0;
7) Inverting all inflorescences into the bacterial liquid suspended by the transformation Buffer in advance for about 30 seconds, and repeatedly transforming for 7 days according to the method;
8) After 2-3 weeks, pouring less nutrient solution as much as possible to accelerate aging, collecting mature seeds in paper bags, and drying in a dryer for 7 days for later use;
9) The disinfected seeds were spotted on 1/2MS medium (containing screening antibiotics: 30 mu g/mL HYG) plate, and sealing;
10 Vernalization is carried out in a refrigerator at 4 ℃ for 48h, and the seeds are placed in a climatic chamber to start germination and growth. The plant growing environment is as follows: the relative humidity is 60%, the temperature is 23 ℃, the illumination period is 16h, and the illumination period is 8h in darkness; the illumination intensity is 80-200umol/M2/S;
11 Observing after 8-15 days, distinguishing positive seedlings, transplanting the positive seedlings into planting soil, observing phenotype at any time, and taking pictures.
2. Silencing PsGSTF3 gene in peony petals by using virus-induced gene silencing (VIGS) technology
1) Extracting total RNA from peony petals, carrying out reverse transcription to obtain cDNA, selecting a 272bp non-conservative domain base sequence of the PsGSTF3 gene, designing upstream and downstream specific primers, cloning a target sequence, and sequencing to ensure the accuracy of the sequence;
2) Constructing a 272bp base sequence of the PsGSTF3 gene between two enzyme cutting sites (BamHI and PSTI) of a plant expression vector pTRV2-GFP in a seamless cloning mode, and sequencing;
3) The constructed expression vector was transferred to Agrobacterium GV3101, spread on LB (kanamycin 50. Mu.g/mL, rifampicin 25. Mu.g/mL) plate, placed upside down in 28 ℃ incubator for 2-3 days. Randomly selecting a single colony, performing colony PCR, and identifying a correct agrobacterium tumefaciens monoclonal as a marker for later use;
4) Selecting correct agrobacterium tumefaciens for single cloning, inoculating the agrobacterium tumefaciens to 5mL of LB liquid culture medium containing corresponding antibiotics, shaking at 28 ℃ and 200rpm for 16-20h, and allowing the liquid to be completely separated without whitening;
5) Inoculating the small-shake Agrobacterium culture at a ratio of 1% into 100mL LB liquid medium (kana 100. Mu.g/mL, rifampicin 25. Mu.g/mL, MES 10mM, AS 200uM), shaking overnight at 28 deg.C and 200rpm, taking out when the bacterial liquid concentration reaches OD600=1.8, centrifuging at 5000rpm for 10min, and collecting the thallus;
6) Infection with agrobacterium buffer (MES 10mM; AS 100uM; mgC12 mM; sterile water as a solvent) suspended bacteria, and adjusting OD600=1.0 or so; respectively mixing pTRV1 with an agrobacterium infection buffer solution containing pTRV2-GFP (control) and pTRV2-GFP-PsGSTF3 in equal volume, respectively adding Silwet L-77 with the final concentration of 0.01% into the two mixed infection buffer solutions, and standing for 4h at the room temperature of 24 ℃ under a dark condition for later use;
7) The specific operation of infection is as follows: the test material is peony 'Zhao powder', unopened and compact buds are selected, bacteria liquid is injected into the buds, calyces and flower stems by using an injector, the usage amount of the bacteria liquid of each bud is about 3mL, and important information such as treatment groups and the like is marked in detail by hanging cards;
8) After injection, wrapping with black plastic bag, shading, taking off the shading bag after 24h, and growing in normal environment;
9) After about 7 days, phenotype can appear, and photographing and GFP fluorescence detection are carried out.
According to the implementation scheme, the transgenic material library for promoting anthocyanin transport and accumulation in the peony can be enriched, and the red character of the peony can be controlled in a targeted manner by utilizing the transgenic technology.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.
Sequence listing
<110> forestry research institute of China forestry science research institute
<120> GST gene participating in anthocyanin transport and accumulation in peony
<160>1
<170> SIPOSequenceListing 1.0
<210>1
<211>642
<212>DNA
<213> peony (P. Suffrutinosa)
<400>1
ATGGTAGTTAAGGTGTATGGCTCAGCTAAAGCGGCTTGTCCACAAAGAGTGATGGTTTGC 60
CTTCTGGAAAAGGAGGTGGAATTTGAAATTATACATGTTGATCTTGAATCTGGAGAGCAC 120
AAAAAGCCAGATTTCCTTGCTCGGCAGCCGTTTGGGCAAGTTCCAGCCATCGAGGATGGT 180
GACTTGAAACTTTTTGAATCCAGGGCAATCATAAGATACTATGCAGCCAAGTTTGATAAC 240
CGCGGTTCAAACCTGTTGGGAACCACTTTGGAAGAGAGAGCTTTGATGGATCAATGGCTA 300
GAAGTTGAAGCCCACAATTTCAATGATTTGGTTTACACTATTGTGCTTCAGATCGTAATT 360
CTCCCCCGTATGGGACAAGGTACTGACTTGGCATTAGTCCGCACCTGTGAAGAAAAGCTT 420
GAGAAAGTGCTTGATGTGTACGAGCAAAGGTTGTCAAAGAGCAGCTACCTGGCCGGAGAC 480
GATTTCACACTCGCTGATCTCAGTCATCTTCCTGGTCTCAGATACCTCATAAATGAAGCT 540
GGAAAAGGATACCTGGTGACCGTGAGGAAGAATGTGAATGCATGGTGGGAGAATATATCA 600
AATCGTCCTTCTTGGAAGAAATTAATGAATCTTGTTAATTAA 642
Claims (3)
1. A GST gene involved in anthocyanin transport and accumulation in peony, wherein a GST gene involved in anthocyanin transport and accumulation is isolated and identified from peony (P.suffruticosa), and the CDS sequence of the GST gene is as follows:
ATGGTAGTTAAGGTGTATGGCTCAGCTAAAGCGGCTTGTCCACAAAGAGTGATGGTTTGCCTTCTGGAAAAGGAGGTGGAATTTGAAATTATACATGTTGATCTTGAATCTGGAGAGCACAAAAAGCCAGATTTCCTTGCTCGGCAGCCGTTTGGGCAAGTTCCAGCCATCGAGGATGGTGACTTGAAACTTTTTGAATCCAGGGCAATCATAAGATACTATGCAGCCAAGTTTGATAACCGCGGTTCAAACCTGTTGGGAACCACTTTGGAAGAGAGAGCTTTGATGGATCAATGGCTAGAAGTTGAAGCCCACAATTTCAATGATTTGGTTTACACTATTGTGCTTCAGATCGTAATTCTCCCCCGTATGGGACAAGGTACTGACTTGGCATTAGTCCGCACCTGTGAAGAAAAGCTTGAGAAAGTGCTTGATGTGTACGAGCAAAGGTTGTCAAAGAGCAGCTACCTGGCCGGAGACGATTTCACACTCGCTGATCTCAGTCATCTTCCTGGTCTCAGATACCTCATAAATGAAGCTGGAAAAGGATACCTGGTGACCGTGAGGAAGAATGTGAATGCATGGTGGGAGAATATATCAAATCGTCCTTCTTGGAAGAAATTAATGAATCTTGTTAATTAA。
2. the application of GST gene participating in anthocyanin transport and accumulation in peony according to claim 1, characterized in that peony flower color molecule transgenic improvement breeding is performed through targeted regulation of transgenic technology.
3. The application of the GST gene participating in anthocyanin transport and accumulation in peony as claimed in claim 2, wherein the accumulation of anthocyanin in peony petals is significantly reduced by targeted silencing of a target gene, so that pink petals are significantly lightened.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110852384.XA CN113604488B (en) | 2021-07-27 | 2021-07-27 | GST gene participating in anthocyanin transport and accumulation in peony and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110852384.XA CN113604488B (en) | 2021-07-27 | 2021-07-27 | GST gene participating in anthocyanin transport and accumulation in peony and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604488A CN113604488A (en) | 2021-11-05 |
| CN113604488B true CN113604488B (en) | 2023-03-14 |
Family
ID=78305648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110852384.XA Active CN113604488B (en) | 2021-07-27 | 2021-07-27 | GST gene participating in anthocyanin transport and accumulation in peony and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604488B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012056811A1 (en) * | 2010-10-28 | 2012-05-03 | 株式会社雪国まいたけ | Method for selecting fungus body and kit |
| CN105936898A (en) * | 2016-07-20 | 2016-09-14 | 中国农业科学院茶叶研究所 | Tea tree violet bud related protein CsGST and encoding gene and application thereof |
| WO2018008617A1 (en) * | 2016-07-04 | 2018-01-11 | クミアイ化学工業株式会社 | Herbicide resistant transformed plant |
| CN109810990A (en) * | 2019-01-04 | 2019-05-28 | 南京农业大学 | Pear fruit anthocyanin transports correlation PyGSTf12 gene and its recombinant expression carrier and application |
-
2021
- 2021-07-27 CN CN202110852384.XA patent/CN113604488B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012056811A1 (en) * | 2010-10-28 | 2012-05-03 | 株式会社雪国まいたけ | Method for selecting fungus body and kit |
| WO2018008617A1 (en) * | 2016-07-04 | 2018-01-11 | クミアイ化学工業株式会社 | Herbicide resistant transformed plant |
| CN105936898A (en) * | 2016-07-20 | 2016-09-14 | 中国农业科学院茶叶研究所 | Tea tree violet bud related protein CsGST and encoding gene and application thereof |
| CN109810990A (en) * | 2019-01-04 | 2019-05-28 | 南京农业大学 | Pear fruit anthocyanin transports correlation PyGSTf12 gene and its recombinant expression carrier and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604488A (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022551B (en) | A kind of regulation arabidopsis seedling stage trophosome is big, early blossoming and the increased corn gene of grain weightZmGRAS37And its application | |
| CN116004656B (en) | Banana maturation associated gene MabHLH130 and application thereof | |
| CN107723297A (en) | Iris R3 MYBx1 genes and its application in pattern regulation | |
| US20120198589A1 (en) | Method for producing transgenic surface layer chimeric plant | |
| Li et al. | Establishment of virus-induced gene silencing system and functional analysis of ScbHLH17 in Senecio cruentus | |
| Yang et al. | Identification and expression analyzes of CC-type glutaredoxin in cucumber (Cucumis sativus L.) under abiotic stress | |
| Zhang et al. | Proline-rich protein MdPRP6 alters low nitrogen stress tolerance by regulating lateral root formation and anthocyanin accumulation in transgenic apple (Malus domestica) | |
| CN106967728A (en) | A kind of pumpkin adversity gene CmNAC1 and its application | |
| CN117925655A (en) | Upland cotton GhPIP5K2 and GhPIP5K22 genes and application thereof | |
| CN113604488B (en) | GST gene participating in anthocyanin transport and accumulation in peony and application thereof | |
| CN101948870B (en) | Method for reducing branch quantity of plant and improving chlorophyll and anthocyanin contents of plant | |
| CN110684757A (en) | Arabidopsis RabGAP3 gene for controlling vesicle development and recombinant construct and application thereof | |
| CN111116721A (en) | Plant stress resistance-related transcription factor PwNAC30, and coding gene and application thereof | |
| CN103348009B (en) | A kind of method for preparing fertility-lowered plant | |
| CN105063062A (en) | Wheat salt-resistant drought-resistant gene TaDHN3, and expression vector and applications thereof | |
| CN108841837A (en) | Application of the encoding gene of arabidopsis splicing factor SR45a spliceosome in negative regulation plant salt stress response | |
| CN101987867B (en) | Ethylene receptor NTHK1 interactive protein relevant to plant stress tolerance as well as coding gene and application thereof | |
| CN103667315A (en) | Salt-tolerant and drought-resistant gene TaDHN1 of wheat, recombinant plasmid and application | |
| CN107988238A (en) | View and admire collard anthocyanidin correlation R2R3-MYB genes BoMYB and its expression vector and application | |
| CN114560919A (en) | Transcription factor VcMYB108 related to plant drought tolerance, and coding gene and application thereof | |
| CN101824080B (en) | Picea wilsonii transcription factor PwHAP5 and coding gene and application thereof | |
| CN102382843B (en) | Sword-leaved cymbidium flowering integrator gene (CeFT gene) and application thereof | |
| CN103773777A (en) | Blooming induction gene and its use in arabidopsis thaliana plant | |
| Wang et al. | FLOWERING LOCUS T (FT) in Photosensitive Type Chrysanthemum Accelerates Flowering in Arabidopsis. | |
| KR102103189B1 (en) | Method for early selecting transgenic plant with salt tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |