CN113584189B - Exosome and application thereof as reference substance and standard substance - Google Patents

Abstract

The invention discloses an exosome and application thereof as a reference substance and a standard substance. The exosome comprises a protein shell, a specific marker and a nucleic acid, wherein the nucleic acid is wrapped inside the protein shell, the specific marker is located on the surface of the protein shell, and the diameter of the protein shell ranges from 20 nm to 200 nm. This class of exosomes has similar characteristics as exosomes: similar structure, similar size, similar surface specific antigens, exosomes can be extracted in the same way as exosomes are extracted. The preparation method prepares the exosome by the artificial synthesis method, can be used as a reference substance and a standard substance of the exosome, can realize industrial large-scale production, does not need an additional separation and enrichment process, and solves the problems of preparation, separation and enrichment of the reference substance of the exosome prepared industrially; in addition, the exosome is more stable relative to natural exosomes, can be stored at higher temperature, and can solve the problems of exosome transportation and storage.

Description

Exosome and application thereof as reference substance and standard substance

Technical Field

The invention belongs to the technical field of biomedical detection, and particularly relates to an exosome and application thereof as a reference substance and a standard substance.

Background

The exosome is a vesicle structure secreted by most cells, and the size of the exosome is 30-150 nm. Since exosomes carry many substances in cells, including proteins, nucleic acids, lipids, etc., exosomes are thought to play a key role in cellular communication. In addition, an increasing number of studies have shown that exosomes play important roles in diagnosis, therapy, drug loading, and prognosis of disease. However, the difficulty in preparing and storing exosomes limits the development progress, clinical application and development of commercial products.

Firstly, the preparation aspect of the exosome is as follows: at present, exosomes, particularly exosome standards, are prepared mainly by cell culture or collection and enrichment from some biological samples. However, the period for obtaining exosomes through cell culture is long, operation is required by professional personnel, contamination of cells is required to be avoided, and high requirements are imposed on cleanliness; in addition, the cost of large-scale cell culture is high, on one hand, professional equipment such as CellSTACK, Wave Bioreactor, Quantum and the like are needed, and the equipment is expensive; on the other hand, the culture of cells requires the consumption of large amount of fetal bovine serum, which also causes great reagent cost. Exosomes can also be collected and enriched by biological samples, but because of the individual differences of the biological samples, the consistency of the properties of the samples collected each time cannot be guaranteed, and the consistency of the properties of each batch of exosomes prepared by the samples cannot be guaranteed; furthermore, exosomes collected and enriched by biological samples pose ethical problems, in some countries, such as our country, where companies or individuals are prohibited from collecting human serum, plasma for experimental or production needs. Therefore, it is desired to develop a new technology for producing exosomes on a large scale in both scientific research and industrial fields.

Secondly, the enrichment aspect of exosomes: at present, there are many methods for separating and enriching exosome, such as ultra-high speed centrifugation, precipitation, chromatography, immunoaffinity magnetic bead method, microfluidic technology, ultrafiltration, etc. The exosome enriched by the precipitation method contains a large amount of impurities (more than 90% of the impurities are possible), and the purity cannot meet the purity of an exosome standard product; the speed of processing and enriching the exosomes by the chromatography is relatively slow, the concentration of the exosomes is too low to be effectively concentrated, the material cost of the chromatographic column is high, and the large-scale application of the chromatography in the aspect of industrial production of the exosomes is limited; the immunoaffinity magnetic bead method needs to consume a large amount of specific antibodies, so the cost is very high and the method cannot be applied to industry; the microfluidic technology is a technology for controlling micro-fluid, so that industrial-grade exosome separation cannot be realized; ultra-high speed centrifugation and ultrafiltration can be used for the production of large-scale exosomes, but the ultra-high speed centrifugation method is expensive in equipment and needs longer centrifugation time, and the centrifugation speed is increased to more than 100000 g (1 ten thousand times of the gravity of the earth), so that the sample processing capacity is limited and potential safety hazards are possibly brought; the ultrafiltration method can be used for concentrating exosome, but the concentrated solution contains a large amount of impurities with large molecular weight, and is generally used together with other exosome separation and concentration methods. Therefore, it is desirable to develop a new technology that does not require additional exosome isolation and enrichment, both in research and industrial fields.

Finally, in the aspect of storage and transportation of the exosome, the exosome is of a vesicle structure wrapped by a thin phospholipid bilayer, and is unstable and easy to break, so that the exosome needs to be stored at the temperature of minus 80 ℃. Some would freeze-dry exosomes by lyophilization, thereby achieving storage of exosomes at 4 ℃. However, lyophilization presents the following problems: 1. a suitable excipient needs to be fumbled; 2. the appropriate freeze-drying conditions need to be explored; 3. the freeze-dried exosome still needs to be stored at the temperature of minus 80 ℃ after being redissolved, namely the freeze-drying solves the problem of transportation of the exosome, but cannot solve the problem of storage after the exosome is redissolved; 4. the problem of the change of the character of the exosome after freeze-drying; 5. excipients may interfere with later detection; 6. the freeze-dried exosome is repeatedly frozen and thawed after being redissolved, and the exosome is cracked due to repeated freezing and thawing. Therefore, in both scientific research field and industrial field, it is desirable to develop a new and more stable exosome standard so as to solve the problem of exosome storage and transportation.

Disclosure of Invention

The invention aims to provide an exosome and application thereof as a reference substance and a standard substance. Aims to solve the technical problem that the preparation, separation and preservation of exosome reference substances and standard substances are difficult in industrialization.

The technical scheme adopted by the invention for solving the technical problems is as follows:

an exosome comprising a protein coat, a specific marker and a nucleic acid, the nucleic acid being encapsulated inside the white matter coat, the specific marker being located on the surface of the protein coat, the diameter of the protein coat being in the range of 20-200 nm.

As a preferred embodiment, the protein coat serves to protect the nucleic acids inside from degradation. The protein coat may be artificially synthesized or may be commercially available. The protein shell has a diameter similar to that of an exosome, and the diameter range is 20-200 nm.

As a preferred embodiment, the protein coat is a viral protein coat.

As a preferred embodiment, the virus is a pseudovirus, preferably an armored virus, lentivirus, adenovirus, retrovirus, bacteriophage.

As a preferred embodiment, the nucleic acid is an internal reference nucleic acid for detecting the presence or quantification of exosomes. The reference nucleic acid is DNA or RNA or comprises DNA and RNA simultaneously.

As a preferred embodiment, the specific marker is an antigen contained on the surface of the exosome.

As a preferred embodiment, the exosome surface comprises antigens comprising one or more of CD9, CD63, CD81, CD44, CD31, Rab5b, EpCAM, TSG101, HSP90, HSP70, ANXA5, FLOT1, ICAM1, ALIX, GM130, ICAM-1, SNAP, MHC I/II, HLA-G, Integrins, Claudins, Tim 4; preferably one or more antigens selected from the group consisting of CD9, CD63, and CD 81.

As a preferred embodiment, the exosome-like body further comprises: identifying a custom site for the presence of exosomes. The customized site for identifying the existence of the exosome refers to the modification of a fluorescent group, a quantum dot, gold, silver or other markers which can be detected and distinguished by an instrument on the surface of a protein shell.

As a preferred embodiment, the specific marker is attached to the surface of the protein coat based on a cross-linking reaction of chemical bonds and/or based on a cross-linking reaction of biological activity.

As a preferred embodiment, the cross-linking reaction of the chemical bond includes one or more of reaction of amino groups and aldehyde groups on the surface of the protein or reaction of amino groups and carboxyl groups, reaction of unsubstituted aryl azide on the surface of the protein with amino groups, reaction of carbodiimide on the surface of the protein with carboxyl groups or hydroxyl groups, reaction of hydrazide on the surface of the protein with aldehyde groups, ketone groups, carboxyl groups, reaction of imidoester on the surface of the protein with amino groups, reaction of iodoacetyl groups on the surface of the protein with sulfhydryl groups, reaction of isocyanate on the surface of the protein with hydroxyl groups, reaction of amino groups, reaction of maleimide on the surface of the protein with sulfhydryl groups, reaction of succinimide on the surface of the protein with amino groups, reaction of pyridyl disulfide on the surface of the protein with sulfhydryl groups, and reaction of vinyl sulfone on the surface of the protein with sulfhydryl groups.

As a preferred embodiment, the bioactive cross-linking reaction comprises one or more of a biotin-avidin reaction, an immunoaffinity reaction, immunoprecipitation, an aptamer-binding reaction.

The invention also provides a reference substance and/or a standard substance for extracting the exosome by applying the exosome. The exosome-like body is used for simulating an exosome and serving as a reference substance and/or a standard substance of the exosome. By mimicking an exosome is meant that the exosome has similar properties to the exosome and can be extracted using the means for extracting exosomes. Exosomes have similar traits to exosomes including: has a size similar to exosomes (diameter 20-200 nm); has an exosome-like structure: the nucleic acid is wrapped in the structure, so that the nucleic acid is free from the influence of nuclease and is more stable and not easy to degrade; the antigen of the exosome-like surface is derived from one or more of the antigens of the exosome surface; and exosomes can be extracted by means of exosome extraction.

Methods by which exosomes can be extracted by means of exosome extraction include size-based exosome separation methods such as ultracentrifugation, density gradient centrifugation, ultrafiltration, filtration, spin columns, chromatography, Deterministic Lateral Displacement (DLD), asymmetric field flow (AF 4), surface continuous acoustic wave (SAW), elastoviscous fluid, Dean flow, etc.; also included are immunoaffinity-based exosome capture techniques, precipitation methods, seed growth methods, and microfluidic methods of exosome capture using any one or more of the above techniques.

The reference substance used as the exosome refers to a standard substance which can be used for qualitatively identifying whether the exosome is successfully extracted or quantitatively testing the exosome extraction efficiency by using the exosome; the standard substance used as the exosome refers to a standard substance which can be used for identification, inspection and content measurement in an exosome extraction process by using the exosome.

Compared with the prior art, the invention has the beneficial effects that:

the preparation method disclosed by the invention is used for preparing the exosome by an artificial synthesis method, and the exosome is artificially synthesized, so that the industrial large-scale production can be realized, an additional separation and enrichment process is not required, and the preparation, separation and enrichment problems of an industrially prepared exosome reference substance are solved; in addition, the exosome is more stable relative to natural exosomes, can be stored at higher temperature, and can solve the problems of exosome transportation and storage.

2, the present invention develops a new exosome-like body with similar characteristics as exosomes: similar structure, similar size, similar surface specific antigen. The exosome can be conveniently synthesized artificially in a large scale, is easy to store, and can be used as a reference substance and/or a standard substance of the exosome. The exosome can be stored for a long time below-18 ℃, can be stored for more than 1 year at the temperature of 2-8 ℃, and can be stored for more than 3 months at room temperature (25 ℃).

Compared with a bacteriophage related to patent CN107002075A as a reference product of an exosome, the structure and function of the exosome are closer to real exosomes, the exosome has a specific antigen of the exosome, the structure is more complex, and the exosome is suitable for other exosome extraction methods such as an electrostatic adsorption method, a filtration method and a precipitation method and is also suitable for an immune affinity method.

Drawings

Fig. 1 is a schematic structural diagram of an exosome prepared in the embodiment of the present invention.

FIG. 2 shows the comparison of the different methods for exosome extraction and exosome-like in example 7 of the present invention.

FIG. 3A is a graph of the results and a correlation fit of nucleic acids extracted from an alphavirus source-like exosome (Bos _ LALBA) and an exosome standard in example 8 of the present invention.

FIG. 3B is a graph of the results and correlation fit of the nucleic acids extracted from lentivirus source exosomes (LBD37) and exosome standards in example 8 of the present invention.

FIG. 3C is a graph of the results and a correlation fit of nucleic acids extracted from phage source exosomes (DUF26) and exosome standards in example 8 of the present invention.

FIG. 4A is the result of protein extraction from the exosome of the alphavirus source type and the exosome standard in example 8 of the present invention and the correlation fit chart.

FIG. 4B is the result of protein extraction from lentivirus source exosomes and exosome standards and a correlation fit chart in example 8 of the present invention.

FIG. 4C is the result of protein extraction from phage source exosomes and exosome standards and a correlation fit chart in example 8 of the present invention.

FIG. 5 is a graph showing the storage stability of exosomes of example 9 of the present invention.

FIG. 6 is a graph showing the storage stability of a standard commercially available plasma-derived exosome in example 9 of the present invention.

FIG. 7 is a fluorescent analysis chart of classification and quantification of the extracted exosomes containing the customized site identifiers in example 10 of the present invention.

Detailed Description

The technical solution of the present invention will be described in detail with reference to examples. The reagents and biomaterials used below were all commercial products unless otherwise specified.

CD9 was purchased from NKMAX, trade name: recombinant human CD9 protein, cat #: ATGP 2970;

CD81 was purchased from NKMAX, trade name: recombinant human CD81 protein, cat #: ATGP 3661;

CD63 was purchased from orignee under the trade name: CD63 (NM — 001780) Human Recombinant Protein, cat No.: TP 301733;

ExoQuick is purchased from System Biosciences under The trade name of The organic ExoQuick, Cat #: EXOQ 20A-1;

ExoCap is purchased from MBL International under the trade name: ExoCap ™ Streptavidin CD9/CD63/CD81 Set, cat #: MEX-SA 123;

qEV from IZON, trade name: qEV2/70 nm;

exoRNeasy Midi Kit (50) was purchased from QIAGEN, cat #: 77900, respectively;

ExoDisc and ExoDiscovery ™ were purchased from LabSpiner, trade names: an ExoDisc ™ polypeptide-C; trade name: ExoDiscovery ™ polypeptide, cargo number: EX-R2001;

plasma-derived exosome standards were purchased from Novus Biologicals, trade name: plasma (human) Exosome Standards, cat # s: NBP 2-49838;

all nucleic acid sequences of the present invention were synthesized by Biotechnology engineering (Shanghai) Inc.;

commercially available armored virus was purchased from xiamen and zoology;

all cell lines were purchased from ATCC;

coli BL21 was purchased from Youbao;

the plasmid was purchased from Beijing Yi Qiao Shenzhou science and technology, Inc.;

culture medium, Lipo2000, IPTG, NHS, EDC, FBS, PBS, EZ-Link ™ NHS-Biotin purchased from Saimer Feishal;

LB agar plates were purchased from yunzhi organisms;

LB medium containing kanamycin was purchased from Biotechnology engineering (Shanghai) Co.Ltd;

cy5 biotin conjugate was purchased from AAT Bioquest.

Example 1: preparation of protein coat encapsulating nucleic acid (preparation of exosome-like raw material)

The pseudovirus is purchased from the market as the raw material of the synthetic exosome, the protein coat for wrapping the nucleic acid can be prepared by the prior art method, which does not belong to the protection scope of the invention and is only used as one of the raw materials of the synthetic exosome.

1. Designing a Gene of interest

a) The target gene of the present invention may be any gene, and in this example, the sequence information of Bos _ LALBA on NCBI is given by using Bos _ LALBA gene as an example (the nucleic acid sequence is not present in human, and therefore, the exosomes contained in human are not present in human): "NM-174378.2 Bos taurus lactalbumin alpha (LALBA), mRNA", Bos _ LALBA sequence is mRNA, and its reverse transcription cDNA sequence is as follows:

CCACCCAGGCTGAACAGTTAACAAAATGTGAGGTGTTCCGGGAGCTGAAAGACTTGAAGGGCTACGGAGGTGTCAGTTTGCCTGAATGGGTCTGTACCACG（SEQ ID NO:1）

b) an exemplary set of primers and probe sequences that can detect the target gene are as follows:

an upstream primer: 5'-CCACCCAGGCTGAACAGTTA-3' (SEQ ID NO: 2)

A downstream primer: 5'-CGTGGTACAGACCCATTCAGG-3' (SEQ ID NO: 3)

And (3) probe: 5'-GAGCTGAAAGACTTGAA-3' (SEQ ID NO: 4)

2. Sending the plasmid containing the target gene to a manufacturer to prepare a pseudovirus; (in the case of Xiamen-derived organisms, plasmid containing the target gene is sent to Xiamen-derived organisms, and thus the manufacturer can be entrusted with the commercial production of the Toba virus);

3. the obtained armored virus containing the target gene Bos _ LALBA (namely, the protein coat containing the target gene Bos _ LALBA) can be used as a raw material for preparing exosomes and is prepared in the next step.

Example 2: preparation of protein coat encapsulating nucleic acid (preparation of exosome-like raw material)

The slow virus method is adopted to artificially synthesize the protein coat which wraps the nucleic acid as a raw material for synthesizing the exosome, and the method is only one of the realization ways of wrapping the nucleic acid by the protein.

The specific method comprises the following steps:

1. culturing 293 cells, and starting to transfect the plasmids of the lentiviruses when the adherent area of the 293 cells exceeds more than half of the area of a culture dish;

2. taking two EP tubes, adding 100 μ L DMEM medium, 0.8 μ g virus vector core plasmid containing target gene and equivalent virus packaging plasmid into one EP tube, adding 100 μ L DMEM medium and 3 μ L Lipo2000 into the other EP tube, and standing for 5 min;

a) the target gene of the present invention may be any gene, and in this example, the sequence information of LBD37 at NCBI is as follows, taking LBD37 gene as an example: "NM-001354072.1 Glycine max LBD domain-ligation transcription factor (LBD37), mRNA", LBD37 sequence is mRNA, its reverse transcription cDNA sequence is as follows:

CGAACATCTTCGTCCAGCGATCTTTCGCTCGTTGTTGTACGAGGCATGCGGTCGGATAGTGAACCCGATTTACGGGTCTGTCGGGCTATTATGGTCCGGGAGCTG（SEQ ID NO:5）

b) an exemplary set of primers and probe sequences that can detect the target gene are as follows:

an upstream primer: 5'-CGAACATCTTCGTCCAGCGATCT-3' (SEQ ID NO: 6)

A downstream primer: 5'-CAGCTCCCGGACCATAATAGC-3' (SEQ ID NO: 7)

And (3) probe: 5'-TACGAGGCATGCGGTCGGATA-3' (SEQ ID NO: 8)

c) The proportions of virus packaging plasmids are as follows: pMDL VSVG: REV = 10: 7: 5;

3. mixing the reagents in the two tubes together, uniformly mixing, and standing for 18 min;

4. adding the reagent of step c) to the cells of step a) and continuing the culture for 12 hours (transfection);

5. washing off the culture medium containing the reagent in the cell culture dish, and adding a DMEM complete culture medium for continuous culture;

collecting culture supernatants after 6.1, 2 and 3 days, and adding DMEM complete culture medium for continuous culture;

7. the culture supernatant contained lentiviral particles (i.e., protein coat containing the gene of interest) encapsulated with the gene of interest (LBD37 gene).

Example 3: preparation of protein coat encapsulating nucleic acid (preparation of exosome-like raw material)

The protein coat which wraps the nucleic acid is artificially synthesized by a phage method to serve as a raw material for synthesizing the exosome, and the method is only one of the realization ways of wrapping the nucleic acid by the protein.

The specific method comprises the following steps:

1. the gene comprises a Q beta bacteriophage mature enzyme coding gene, a capsid protein coding gene, a packaging site and a target gene which are synthesized by Shanghai;

a) the target gene of the present invention may be any gene, and in this example, the sequence information of DUF26 at NCBI is: "NM-113095.2 Arabidopsis thaliana cysteine-rich repeat gene-like protein (DUF26) (AT3G21990), mRNA", DUF26 sequence is mRNA, and its reverse transcription cDNA sequence is as follows:

TCATGTTCCAGTGTCGCGGCGACTCCTACTGGTCCAAGTGCCCCCCTTGCATTAGCACCGCTGTCTCTGGGCTTCGTAGGAGA（SEQ ID NO:9）

b) an exemplary set of primers and probe sequences that can detect the target gene are as follows:

an upstream primer: 5'-TCATGTTCCAGTGTCGCGG-3' (SEQ ID NO: 10)

A downstream primer: 5'-TCTCCTACGAAGCCCAGAGA-3' (SEQ ID NO: 11)

And (3) probe: 5'-TCCTACTGGTCCAAGT-3' (SEQ ID NO: 12)

2. Subcloning the gene into pET-28a (+) plasmid to construct recombinant expression plasmid named DUF26-pET-28a (+) plasmid;

3. transferring the recombinant plasmid DUF26-pET-28a (+) into competent cells of Escherichia coli BL21, coating the competent cells on LB agar plates with kanamycin (the final concentration is 50 mg/L), and culturing at 37 ℃ overnight;

4. after overnight, selecting a single colony, inoculating the single colony into 5 mL LB culture medium containing kanamycin, and carrying out shaking culture at 37 ℃ for overnight;

5. taking 200 mu L of activated bacterial liquid, and carrying out shaking culture at 37 ℃ and 180 r/min in 20 mL LB culture medium containing kanamycin until OD600 is about 0.6;

6. adding IPTG with final concentration of 0.8 mmol/L to induce expression for 12 h, centrifuging at 4 deg.C for 11000 r/min for 10 min, and collecting phage particles (i.e. protein shell containing target gene) coated with target gene (DUF26 gene).

Example 4: preparation and quantification of exosomes (chemical cross-linking method)

1. Obtaining a protein coat-encapsulated nucleic acid according to the method of example 1;

2. taking the armored virus described in example 1 as an example, the armored virus has a structure that a protein coat wraps a target gene (Bos _ LALBA gene);

3. chemically crosslinking the protein shell of the armored virus by a chemical crosslinking method, wherein the antigen is crosslinked on the protein shell of the armored virus by chemically crosslinking amino and carboxyl under the catalysis of NHS and EDC by carboxyl on the protein shell and amino on the antigen;

a) there are many methods for crosslinking proteins based on chemical bonds, and only amino groups and carboxyl groups are taken as an example;

b) here CD9, CD63, CD81 antigens were cross-linked on the protein coat of the armored virus; (antigens can be customized, the above antigen is only one example)

4. The exosome is synthesized through the above steps, and the structure of the synthesized exosome is shown in a schematic diagram in fig. 1. The synthetic exosomes were quantified for encapsulated nucleic acids using ddPCR. Primers and probe sequences for quantification are as follows (primers and probe sequences can be customized, and the following primer and probe sequences are only one example):

an upstream primer: 5'-CCACCCAGGCTGAACAGTTA-3' (SEQ ID NO: 2)

A downstream primer: 5'-CGTGGTACAGACCCATTCAGG-3' (SEQ ID NO: 3)

And (3) probe: 5'-GAGCTGAAAGACTTGAA-3' (SEQ ID NO: 4)

5. And diluting with TE solution (1M Tris, 0.5M EDTA, Ph 7.2-8.5), and quantitatively diluting the concentration of Bos _ LALBA in the exosome to 50000 Copies/mL. (at any concentration, here, 50000 Copies/mL is taken as an example)

Example 5: preparation and quantification of exosomes (biological activity-based cross-linking method)

1. Taking the lentivirus described in example 2 as an example, the lentivirus has a structure that a protein coat wraps a target gene (LBD37 gene), and chemical crosslinking is performed between carbodiimide on the protein coat and carboxyl on avidin on the protein coat of the lentivirus, so that avidin is crosslinked on the protein coat of the lentivirus;

2. EZ-Link-NHS-Biotin was modified to the EpCAM, TSG101, HSP90 antigens as described in the instructions; (antigens can be customized, the above antigen is only one example)

3. By avidin on lentiviruses and biotin (biotin) on antigens, by crosslinking based on biological activity: a biotin-avidin reaction, linking the antigen to the lentivirus;

4. exosome-like bodies were synthesized through the above steps, the structure of which is shown in fig. 1, and the encapsulated nucleic acids were quantified using ddPCR on the synthesized exosome-like bodies. Primers and probe sequences for quantification are as follows (primers and probe sequences can be customized, and the following primer and probe sequences are only one example):

an upstream primer: 5'-CGAACATCTTCGTCCAGCGATCT-3' (SEQ ID NO: 6)

A downstream primer: 5'-CAGCTCCCGGACCATAATAGC-3' (SEQ ID NO: 7)

And (3) probe: 5'-TACGAGGCATGCGGTCGGATA-3' (SEQ ID NO: 8)

5. And diluting with TE solution (1M Tris, 0.5M EDTA, Ph 7.2-8.5), and quantitatively diluting the concentration of LBD37 gene in the exosome to 50000 Copies/mL. (at any concentration, here, 50000 Copies/mL is taken as an example)

Example 6: preparation and quantification of exosomes (custom site)

1. Using the phage described in example 3 as an example, the phage has a structure in which the protein coat encapsulates the gene of interest (DUF26 gene);

2. chemically cross-linking the avidin on the protein coat of the bacteriophage by means of carbodiimide on the protein coat and carboxyl on the avidin;

3. chemically crosslinking the protein coat of the bacteriophage by a chemical crosslinking method, wherein the amino group and the carboxyl group on the protein coat are chemically crosslinked under the catalysis of NHS and EDC, so that the antigen is crosslinked on the protein coat of the bacteriophage;

a) here, Claudins, Tim4, ALIX antigens were cross-linked on the protein coat of the phage; (antigens can be customized, the above antigen is but one example);

4. by avidin on the phage and biotin (biotin) on the fluorescent dye Cy5 biotin conjugate, by crosslinking based on biological activity: biotin-avidin reaction, linking the fluorescent dye and the phage together; (Cy 5 is only one example of the custom site, and other fluorescent groups, quantum dots, gold, silver or other substances capable of being detected and identified by the instrument can be selected as the custom site)

5. Exosomes containing custom sites were synthesized by the above procedure, and the encapsulated nucleic acids were quantified using ddPCR for the synthesized exosomes. Primers and probe sequences for quantification are as follows (primers and probe sequences can be customized, and the following primer and probe sequences are only one example):

an upstream primer: 5'-TCATGTTCCAGTGTCGCGG-3' (SEQ ID NO: 10)

A downstream primer: 5'-TCTCCTACGAAGCCCAGAGA-3' (SEQ ID NO: 11)

And (3) probe: 5'-TCCTACTGGTCCAAGT-3' (SEQ ID NO: 12)

6. Diluting with a TE solution (1M Tris, 0.5M EDTA, Ph 7.2-8.5), and quantitatively diluting the concentration of DUF26 in the exosome to 50000 Copies/mL; (at any concentration, here, 50000 Copies/mL is taken as an example)

7. The exosome in this embodiment can be localized and quantified by detection of a fluorescent dye.

Example 7: method for extracting exosome by using different methods

Sample 1 was prepared by dissolving the total amount of Bos _ lalbs 500 Copies of the exosomes prepared in example 4 in 1 mL PBS (sample 1 was prepared with total amount of Bos _ lalbs 500 Copies of 30 total exosomes);

sample 2 (sample 2 prepared in total of 500 Copies of LBD37 gene in 30 exosomes) was prepared by dissolving 500 Copies of LBD37 gene prepared in example 5 in 1 mL of PBS;

sample 3 (sample 3 prepared in total of 500 Copies of DUF26 gene 7 genes in 30 exosomes) was prepared by dissolving 500 Copies of the DUF26 gene prepared in example 6 in 1 mL of PBS;

the purchased plasma-derived exosome standard was quantified for the internal reference gene GAPDH by ddPCR, and the plasma-derived exosome standard with a total GAPDH amount of 500 Copies was dissolved in 1 mL of PBS to prepare sample 4 (sample 4 with a total GAPDH amount of 500 Copies in 30 exosomes).

Bos _ LALBA, LBD37, DUF26 are exosome-like reference genes, GAPDH is a reference gene of a commercially available plasma-derived exosome standard, and the extraction efficiency of exosomes can be judged according to the content of the reference gene, because encapsulated nucleic acids are released after the exosomes are damaged, the released nucleic acids are unstable and can be degraded quickly, and if the exosomes are not damaged, the nucleic acids are in the exosomes and can be prevented from being degraded.

Exosome-like standards in samples 1, 2, 3 and plasma-derived exosomes in sample 4 were extracted using different exosome extraction methods, 5 replicates per method:

ultra-high speed centrifugation: the operation process of extracting exosome by ultra-high speed centrifugation is referred to in the literature, Isolation of Extracellular vectors by Ultracentrifugation (DOI: 10.1007/978-1-4939-;

a precipitation method: the operating process of extracting exosomes by precipitation refers to the specification of ExoQuick;

magnetic bead method: the operation process of extracting exosomes by the magnetic bead method refers to the specification of ExoCap;

chromatography: the operation process of extracting exosome by chromatography refers to the specification of qEV;

column extraction method: the operation process of extracting exosome by column extraction refers to the instruction manual of exoRNeasy Midi Kit (50);

microfluidic chip (filtration method): the operational process of extracting exosomes by the microfluidic chip (filtration method) refers to the description of ExoDisc and ExoDiscovery;

referring to fig. 2, the exosomes and exosome-like comparison results are extracted for different methods. The results in FIG. 2 show that: methods that can extract exosomes can all be used for exosome-like extraction.

Example 8: exosome-like body as reference substance and/or standard substance extracted from exosome

Exosomes with total amount of Bos _ LALBA prepared in example 4 of 5, 10, 50, 100, 500 and 1000 Copies are respectively dissolved in 1 mL PBS to prepare samples a1, B1, C1, D1, E1, F1 and G1;

taking exosomes of LBD37 prepared in example 5, wherein the total amount of exosomes is 5, 10, 50, 100, 500 or 1000 Copies, and dissolving the exosomes in 1 mL PBS to prepare samples A2, B2, C2, D2, E2, F2 and G2;

samples A3, B3, C3, D3, E3, F3 and G3 are prepared by dissolving 5, 10, 50, 100, 500 and 1000 Copies of total amount of DUF26 prepared in example 6 in 1 mL of PBS;

samples a, b, c, d, e, f, g were prepared by dissolving commercially available plasma-derived exosome standards with a total amount of GAPDH of 5, 10, 50, 100, 500, 1000 Copies, respectively, in 1 mL PBS.

The exosome is extracted by ultra-high speed centrifugation, and the operation process of extracting the exosome by ultra-high speed centrifugation is referred to in the publication of Isolation of Extracellular vectors by ultra centrifugation (DOI: 10.1007/978-1-4939-7253-1_ 3').

Exosome-like and commercially available plasma-derived exosome standards were quantified from nucleic acid and protein perspectives using ddPCR and chemiluminescence, respectively, and correlation analyses were performed, with the results of nucleic acid quantification and correlation fitting shown in fig. 3A-3C and protein quantification and correlation fitting shown in fig. 4A-4C. The abscissa of the points in fig. 3A to 3C represents the copy number of the internal reference nucleic acid contained in each extracted exosome type, the ordinate of the points represents the copy number of the extracted naturally occurring exosome GAPDH gene derived from plasma, and the straight line in the figures represents a correlation-fitting straight line between the points, reflecting the correspondence between the copy number of the internal reference nucleic acid contained in each extracted exosome type at different concentrations and the copy number of the extracted naturally occurring exosome GAPDH gene derived from plasma at different concentrations. The abscissa of the points in fig. 4A to 4C represents the luminescence value of the specific marker CD63 contained in each extracted type of exosome, the ordinate of the points represents the luminescence value of the CD63 antigen of the extracted plasma-derived naturally-occurring exosome, and the straight line in the figures represents a correlation fitting straight line between the points reflecting the correspondence between the luminescence value of the specific marker contained in each extracted type of exosome at different concentrations and the luminescence value of the CD63 antigen of the extracted plasma-derived naturally-occurring exosome at different concentrations.

The results in fig. 3A demonstrate from a nucleic acid perspective that there is a very good correspondence between the extracted internal reference nucleic acid Bos _ LALBA and the copy number of the extracted plasma-derived naturally occurring exosome GAPDH gene of the exosome prepared in example 4 (armored virus-derived exosome, chemical cross-linking method), the correlation coefficient (Pearson r) >0.999, which is very close to 1, and the results of the correlation coefficient are tested bilaterally by the P value, and the P value is <0.0001 (much less than 0.05), so the results have significant difference and are reliable. The results in fig. 3B demonstrate from a nucleic acid perspective that there is a very good correspondence between the extracted internal reference nucleic acid LBD37 and the copy number of the extracted plasma-derived naturally occurring exosome GAPDH gene of the exosome prepared in example 5 (lentivirus-derived exosome, bioactive-based cross-linking method), the correlation coefficient (Pearson r) >0.999, which is very close to 1, and the results of the correlation coefficient are tested bilaterally by the P value, the P value is <0.0001 (much less than 0.05), so the results have significant difference and are reliable. The results in fig. 3C demonstrate from a nucleic acid perspective that there is a very good correspondence between the copy numbers of the extracted internal reference nucleic acid DUF26 and the extracted plasma-derived naturally occurring exosome GAPDH gene of the exosome-like (phage-derived exosome, containing a customized site) prepared in example 6, the correlation coefficient (Pearson r) >0.999, which is very close to 1, and the results of the correlation coefficient are tested bilaterally for the P value, which is <0.0001 (much less than 0.05), so the results have significant difference and are reliable.

The results in fig. 4A demonstrate from a protein perspective that there is a very good correspondence between the specific marker CD63 after extraction of exosomes prepared in example 4 (armored virus-derived exosomes, chemical cross-linking method) and the luminescence value of CD63 antigen of extracted plasma-derived naturally occurring exosomes, the correlation coefficient (Pearson r) >0.999, which is very close to 1, and the results of the correlation coefficient are tested bilaterally by the P value, and the P value is <0.0001 (much less than 0.05), so the results have significant difference and are reliable. The results in fig. 4B demonstrate from a protein perspective that there is a very good correspondence between the specific marker CD63 after extraction of exosomes prepared in example 5 (lentivirus-derived exosomes, bioactive-based cross-linking) and the luminescence value of CD63 antigen of extracted plasma-derived naturally occurring exosomes, the correlation coefficient (Pearson r) >0.999, very close to 1, and the results of the correlation coefficient are tested bilaterally for P-value, P-value <0.0001 (much less than 0.05), therefore the results are significantly different and reliable. The results in fig. 4C demonstrate from a protein perspective that there is a very good correspondence between the specific marker CD63 after extraction of the exosomes prepared in example 6 (phage-derived exosomes, containing customized sites) and the luminescence value of the CD63 antigen of the extracted plasma-derived naturally occurring exosomes, the correlation coefficient (Pearson r) >0.999, very close to 1, and the results of the correlation coefficient are tested bilaterally for a P value of <0.0001 (much less than 0.05), so the results have significant differences and are reliable.

Therefore, the extraction effect of various exosomes is highly consistent with that of a commercial exosome standard product from the aspects of protein and nucleic acid, and the exosome standard product has a very good corresponding relation, so that the exosomes can be used as a reference product and/or a standard product of the exosomes.

Example 9: stability of exosomes

A batch of exosome-like reference products with total Bos _ LALBA, LBD37 and DU145 amount of 5000 Copies were prepared and stored at-18 ℃, 4 ℃ and 25 ℃ for 1 year according to the methods described in examples 4, 5 and 6, exosomes stored at3 temperatures each month were taken out and quantitatively detected by ddPCR, and exosome storage conditions were calculated by using the initial total Bos _ LALBA, LBD37 and DU145 amounts as controls.

The purchased exosome standard derived from plasma was quantified for the reference gene GAPDH by ddPCR, stored at-18 deg.C, 4 deg.C, and 25 deg.C for 1 month, respectively, for plasma exosome standard derived from 5000 Copies in total GAPDH amount, taken out 3 plasma exosome standard stored at temperature at 0, 1, 3, 5, 7, 10, 15, and 30 days for quantitative detection, and the storage condition of exosome was calculated with the initial GAPDH total amount as a control.

The results are shown in fig. 5 and 6, and fig. 5 shows the following results: more than 80% of exosomes are not damaged and stably exist when the exosomes are stored at the temperature of 18 ℃ below zero and 4 ℃ for 1 year; the exosome-like bodies still exist stably in more than 80 percent of exosome-like bodies which are not damaged after being stored for 3 months at room temperature (25 ℃). The results in FIG. 6 show that: for commercially available plasma-derived exosome standards, more than 20% of exosomes were destroyed by storage at-18 ℃ for about 7 days, more than 60% of exosomes were destroyed by storage at 4 ℃ for about 1 day, and were destroyed by storage at room temperature (25 ℃) for about 1 day.

In conclusion, the exosome-like body is more stable compared with the conventional exosome, and can solve the storage and transportation problems of the conventional exosome.

Example 10: classification and quantification of exosomes containing customized site identification

Three exosomes containing custom site identifiers were prepared as described in example 6: FAM fluorescence-labeled exosomes, VIC fluorescence-labeled exosomes, and exosomes labeled with both FAM and VIC fluorescence.

1500 FAM fluorescence-labeled exosomes, 850 VIC fluorescence-labeled exosomes and 40 exosomes simultaneously labeled with FAM and VIC fluorescence were added to 1 mL of plasma.

After being mixed uniformly, exosomes in the plasma are extracted by ExoQuick;

resuspending the extracted exosomes with 20 μ Ι _ of water, generating 20000 droplets with a droplet generator;

after the resuspension solution is dropped into droplets, fluorescence in the droplets is detected by the modified QX200 Droplet Digital PCR System (11471 droplets are detected in total), and the detected fluorescence is analyzed by QuantaSoft ™ method, the results are shown in FIG. 7: the exosome is also extracted in the process of extracting the plasma exosome; the identified exosomes may be detected by the respective instrument; 572 exosomes identified by FAM fluorescence, 313 exosomes identified by VIC fluorescence, and 14 exosomes identified by FAM and VIC fluorescence (each point in fig. 7 represents a detection result, and the number and types of exosomes can be quantified and classified according to the quadrant and position of the point). The calculation shows that the recovery rate of FAM fluorescence-labeled exosomes is 66.5%, the recovery rate of VIC fluorescence-labeled exosomes is 64.1%, the recovery rate of FAM fluorescence-labeled exosomes and VIC fluorescence-labeled exosomes is 60.9%, and the recovery rate of ExoQuick exosomes in plasma can be calculated to be about 65% by combining the above results.

In conclusion, when the exosome is used as a reference substance and a standard substance of the exosome, the exosome can indirectly quantify the exosome through the internal reference gene and the surface antigen, and can also directly quantify the exosome through counting the number of the identified exosomes.

The above description is only a part of the preferred embodiments of the present invention, and the present invention is not limited to the contents of the embodiments. It will be apparent to those skilled in the art that various changes and modifications can be made within the spirit of the invention, and any changes and modifications made are within the scope of the invention.

Sequence listing

<110> Shanghai thought Di medical laboratory Co., Ltd

<120> exosome and application thereof as reference substance and standard substance

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 101

<212> DNA

<213> cattle (Bos taurus)

<400> 1

ccacccaggc tgaacagtta acaaaatgtg aggtgttccg ggagctgaaa gacttgaagg 60

gctacggagg tgtcagtttg cctgaatggg tctgtaccac g 101

<210> 2

<211> 20

<212> DNA

<213> primer (primer)

<400> 2

ccacccaggc tgaacagtta 20

<210> 3

<211> 21

<212> DNA

<213> primer (primer)

<400> 3

cgtggtacag acccattcag g 21

<210> 4

<211> 17

<212> DNA

<213> Probe (probe)

<400> 4

gagctgaaag acttgaa 17

<210> 5

<211> 105

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 5

cgaacatctt cgtccagcga tctttcgctc gttgttgtac gaggcatgcg gtcggatagt 60

gaacccgatt tacgggtctg tcgggctatt atggtccggg agctg 105

<210> 6

<211> 23

<212> DNA

<213> primer (primer)

<400> 6

cgaacatctt cgtccagcga tct 23

<210> 7

<211> 21

<212> DNA

<213> primer (primer)

<400> 7

cagctcccgg accataatag c 21

<210> 8

<211> 21

<212> DNA

<213> Probe (probe)

<400> 8

tacgaggcat gcggtcggat a 21

<210> 9

<211> 83

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 9

tcatgttcca gtgtcgcggc gactcctact ggtccaagtg ccccccttgc attagcaccg 60

ctgtctctgg gcttcgtagg aga 83

<210> 10

<211> 19

<212> DNA

<213> primer (primer)

<400> 10

tcatgttcca gtgtcgcgg 19

<210> 11

<211> 20

<212> DNA

<213> primer (primer)

<400> 11

tctcctacga agcccagaga 20

<210> 12

<211> 16

<212> DNA

<213> Probe (probe)

<400> 12

tcctactggt ccaagt 16

Claims (14)

1. An exosome-like body, characterized by: the kit comprises a protein shell, a specific marker and a nucleic acid, wherein the nucleic acid is wrapped inside the protein shell, the specific marker is positioned on the surface of the protein shell, and the diameter of the protein shell ranges from 20 nm to 200 nm; the nucleic acid is an internal reference nucleic acid for detecting the existence of exosomes or quantifying exosomes.

2. An exosome-like according to claim 1, characterized by: the protein coat serves to protect the nucleic acids inside from degradation.

3. An exosome-like according to claim 1, characterized by: the protein coat is a viral protein coat.

4. An exosome-like according to claim 3, characterized by: the virus is a pseudovirus.

5. An exosome-like according to claim 4, characterized in that: the virus is an armored virus, a retrovirus, an adenovirus and a bacteriophage.

6. An exosome-like according to claim 5, characterized in that: the retrovirus is a lentivirus.

7. An exosome-like according to claim 1, characterized by: the specific marker is an antigen contained on the surface of the exosome.

8. An exosome-like according to claim 7, wherein: the antigen is one or more of CD9, CD63, CD81, CD44, CD31, Rab5b, EpCAM, TSG101, HSP90, HSP70, ANXA5, FLOT1, ICAM1, ALIX, GM130, ICAM-1, SNAP, MHC I/II, HLA-G, Integrins, Claudins, Tim 4.

9. An exosome-like according to claim 8, characterized in that: the antigen is one or more of CD9, CD63 and CD 81.

10. An exosome-like body according to claim 1, further comprising: identifying a custom site for the presence of exosomes; the customized site is obtained by modifying a fluorescent group, a quantum dot, gold, silver or other markers which can be detected and distinguished by an instrument on the surface of the protein shell.

11. An exosome-like according to claim 1, characterized by: the specific marker is linked to the surface of the protein coat based on a cross-linking reaction of chemical bonds and/or based on a cross-linking reaction of biological activity.

12. An exosome of the kind described in claim 11, wherein: the cross-linking reaction of the chemical bond comprises one or more of reaction of amino and aldehyde groups on the surface of the protein or reaction of amino and carboxyl, reaction of unsubstituted aryl azide on the surface of the protein and amino, reaction of carbodiimide on the surface of the protein and carboxyl or hydroxyl, reaction of hydrazide on the surface of the protein and aldehyde groups, ketone groups, reaction of carboxyl, reaction of imino ester on the surface of the protein and amino, reaction of iodoacetyl on the surface of the protein and sulfhydryl groups, reaction of isocyanate on the surface of the protein and hydroxyl, reaction of amino, reaction of maleimide on the surface of the protein and sulfhydryl groups, reaction of succinimide on the surface of the protein and amino, reaction of pyridyl disulfide on the surface of the protein and sulfhydryl groups, and reaction of vinyl sulfone on the surface of the protein and sulfhydryl groups.

13. An exosome of the kind described in claim 11, wherein: the bioactive cross-linking reaction includes one or more of biotin-avidin reaction, immunoaffinity reaction, immunoprecipitation, aptamer-binding reaction.

14. Use of an exosome according to any one of claims 1 to 13 in an exosome-extracted reference and/or standard.

Images