CN113584038B

CN113584038B - Antisense oligonucleotide combination for treating retina diseases and application thereof

Info

Publication number: CN113584038B
Application number: CN202111057947.2A
Authority: CN
Inventors: 曾润娥; 黄铭伟; 刘阳; 李阳
Original assignee: Shenzhen Yaji Technology Co ltd
Current assignee: Shenzhen Yaji Technology Co ltd
Priority date: 2021-09-09
Filing date: 2021-09-09
Publication date: 2023-11-14
Anticipated expiration: 2041-09-09
Also published as: CN113584038A

Abstract

The application discloses an antisense oligonucleotide combination for treating retina diseases and application thereof. The antisense oligonucleotide combination for treating the retina disease comprises at least two antisense oligonucleotides for promoting the expression of PRPF31 genes, wherein the antisense oligonucleotides take 5' -uORF, exon3, exon11 or exon14 of PRPF31 gene pre-mRNA as target sites; and, the backbone of antisense oligonucleotide employs 2' -MOE modification and phosphorothioate backbone. The antisense oligonucleotide composition for treating the retinal diseases has good intracellular stability, can more effectively promote PRPF31 gene expression, and provides a new scheme and approach for treating retinal pigment degeneration, especially retinal pigment degeneration type 11.

Description

Antisense oligonucleotide combination for treating retina diseases and application thereof

Technical Field

The application relates to the technical field of antisense oligonucleotides, in particular to an antisense oligonucleotide combination for treating retina diseases and application thereof.

Background

Retinitis Pigmentosa (RP) is a clinically common inherited retinal degenerative disease with a prevalence of about 1/3000-1/7000; typically starting from the medial edge, spreading toward the center of the macula and retina, followed by a narrowing of the field of view, resulting in a narrowing of the field of view, ultimately resulting in blindness, or in complex cases, complete blindness, typical symptoms including night blindness. Currently about 6.25 of every million people is retinitis pigmentosa type 11 (RP 11). The retinitis pigmentosa type 11 is caused by PRPF31 mutation and is autosomally dominant inherited, i.e., heterozygous variation of a single copy can lead to disease characterization, and most of pathogenic mutations are loss-of-function; indicating that insufficient gene dose with normal function is a major factor in causing diseases; thus, increasing the expression level of the normal copy PRPF31 is a potential therapeutic approach.

Splicing of a pre-mRNA (pre-mRNA) refers to the process of removing introns from the original mRNA of a gene and splicing the exons under the catalysis of the spliceosome. Among the 80 or more RP pathogenic genes that have been found at present, 8 genes, namely PRPF3, PRPF8, PRPF31, PRPF6, PRPF4, SNRNP200, RP9 and DHX38, are widely expressed throughout the body and are associated with pre-mRNA splicing; however, the mechanism by which these gene mutations cause only ocular lesions is not clear, and at present, no drugs for treating retinitis pigmentosa are marketed or put into clinical study.

Therefore, how to effectively treat retinitis pigmentosa is a major and difficult task of research in the art.

Disclosure of Invention

The object of the present application is to provide a novel antisense oligonucleotide combination for treating retinal diseases and its use.

The application adopts the following technical scheme:

the first aspect of the application discloses an antisense oligonucleotide combination for treating retinal diseases, which comprises at least two antisense oligonucleotides for promoting PRPF31 gene expression, wherein the antisense oligonucleotides take 5' -uORF, exon3, exon11 or exon14 of PRPF31 gene pre-mRNA as target sites; and, the backbone of antisense oligonucleotide employs 2' -MOE modification and phosphorothioate backbone.

The antisense oligonucleotide combination of the present application is a combination of at least two antisense oligonucleotides designed by using 5' -uORF, exon3, exon11 or exon14 of PRPF31 gene pre-mRNA as target sites, and is used in combination. The research of the application shows that the two antisense oligonucleotides can better promote PRPF31 gene expression and improve PRPF31 gene expression level when being used in combination. And, the 2' -MOE modification and phosphorothioate framework are adopted to make the antisense oligonucleotide of the application more stable in cells, and the effect of the antisense oligonucleotide is not affected. It will be appreciated that in the antisense oligonucleotide combination of the present application, both antisense oligonucleotides are capable of promoting PRPF31 gene expression, and in the case of low requirement for gene expression promoting effect, theoretically, both antisense oligonucleotides of the present application can be used alone; accordingly, the therapeutic effect of the retinal disease may be affected.

In one implementation of the application, at least one of the at least two antisense oligonucleotides that promote PRPF31 gene expression is an antisense oligonucleotide designed with 5' -uORF as the target site and at least one is an antisense oligonucleotide designed with exon3, exon11 or exon14 as the target site.

It should be noted that, one of the keys of the application is that the antisense oligonucleotide designed by taking 5' -uORF as a target site is found to be capable of more effectively promoting PRPF31 gene expression; the antisense oligonucleotide designed by taking exon3, exon11 or exon14 as target sites can repair nonsensical mutation of genes and synergistically enhance expression of PRPF31 genes; thus, in a preferred embodiment of the application, the antisense oligonucleotide combination comprises at least one antisense oligonucleotide designed for targeting the 5' -uORF and at least one antisense oligonucleotide designed for targeting exon3, exon11 or exon 14.

In one implementation of the application, the target site of the 5' -uORF is the sequence shown by Seq ID No.1, the target site of exon3 is the sequence shown by Seq ID No.2, the target site of exon11 is the sequence shown by Seq ID No.3, and the target site of exon14 is the sequence shown by Seq ID No. 4.

In one implementation of the present application, the antisense oligonucleotide designed with 5' -uORF as the target site is at least one of the sequences shown in Seq ID No.5 to Seq ID No.7, the antisense oligonucleotide designed with exon3 as the target site is at least one of the sequences shown in Seq ID No.8 to Seq ID No.10, the antisense oligonucleotide designed with exon11 as the target site is at least one of the sequences shown in Seq ID No.11 to Seq ID No.13, and the antisense oligonucleotide designed with exon14 as the target site is at least one of the sequences shown in Seq ID No.14 to Seq ID No. 16.

It will be appreciated that the antisense oligonucleotides of the above specific sequences are only antisense oligonucleotide sequences specifically employed in one implementation of the present application, and that on the basis of the inventive concept, further antisense oligonucleotides may be designed for the 5' -uoorf, exon3, exon11 and exon14 target sites of the present application, without being specifically limited thereto.

In a second aspect, the application discloses the use of an antisense oligonucleotide combination of the application in the manufacture of a medicament for the treatment of a retinal disease.

It will be appreciated that the antisense oligonucleotide combination of the application is capable of promoting PRPF31 gene expression and is therapeutically effective against retinal disease, particularly type 11 retinitis pigmentosa caused by PRPF31 mutations; thus, the antisense oligonucleotide combination of the present application can be prepared into a medicament for treating retinal diseases.

In a third aspect, the application discloses a pharmaceutical composition for treating retinal diseases, which comprises the antisense oligonucleotide combination of the application and pharmaceutically acceptable auxiliary materials.

It should be noted that pharmaceutically acceptable excipients of the present application include, but are not limited to, various pharmaceutically acceptable salts, solvents, excipients, diluents, hydrates, esters, and the like, and in particular, may be determined according to the needs. For example, adjuvants may be selected according to different dosage forms, or cell penetration enhancing agents, carriers or other active or inactive ingredients may be selected as desired.

In a fourth aspect, the application discloses a composition of the application for linking or conjugating an antisense oligonucleotide combination of the application to a drug or pharmaceutical agent.

It should be noted that the antisense oligonucleotide of the present application may be coupled to substances known in the art, such as antibodies to transferrin receptor, amino acids, etc., to facilitate the permeation function of the antisense oligonucleotide; for another example, studies have shown that antisense oligonucleotides can be linked to a portion of a lipid, including but not limited to a cholesterol moiety, a cholesteryl moiety, a fatty chain, such as dodecanol or undecanoyl residues, and the like, in order to enhance targeting of the activity or cellular uptake of the antisense oligonucleotide. In principle, other functional substances that do not limit the effect of the antisense oligonucleotide in promoting PRPF31 gene expression can be coupled to the antisense oligonucleotide of the present application, thereby providing the composition of the present application with more functions and effects.

In a fifth aspect, the application discloses an agent for detecting the therapeutic effect of the antisense oligonucleotide combination of the application, the pharmaceutical composition of the application or the composition of the application, comprising a PRPF31 gene-specific detection primer and a probe; the upstream primer of the PRPF31 gene specificity detection primer is a sequence shown by a Seq ID No.17, the downstream primer is a sequence shown by a Seq ID No.18, and the detection probe is a sequence shown by a Seq ID No. 19; the 5 'end and the 3' end of the PRPF31 gene-specific detection probe are respectively marked with a fluorescent group and a fluorescence quenching group.

The reagent for detecting the treatment effect of the retinal disease is actually a PRPF31 gene specific detection primer and a probe, and the expression level of the PRPF31 gene can be accurately and effectively detected by the PRPF31 gene specific detection primer and the probe, so that the treatment effect of the retinal disease can be judged. For example, if the expression level of the PRPF31 gene is significantly increased, it is demonstrated that the antisense oligonucleotide composition and the pharmaceutical composition of the present application have a significant effect.

In one implementation mode of the application, the reagent of the application also comprises an actin internal reference gene specificity detection primer and a probe; the upstream primer of the actin reference gene specificity detection primer is a sequence shown as a Seq ID No.20, the downstream primer is a sequence shown as a Seq ID No.21, and the detection probe is a sequence shown as a Seq ID No. 22; the 5 'end and the 3' end of the actin reference gene specific detection probe are respectively marked with a fluorescent group and a fluorescence quenching group, and the PRPF31 gene specific detection probe and the actin reference gene specific detection probe are respectively marked with different fluorescent groups.

In order to more accurately and effectively quantitatively detect the expression quantity of the PRPF31 gene, the application additionally designs a specific detection primer and a probe of a housekeeping gene actin as an internal reference and a control. It can be understood that the application actually designs dual real-time fluorescence quantitative PCR detection of PRPF31 gene and actin reference gene; thus, the probes of both need to use different fluorophores.

The sixth aspect of the application discloses the application of the reagent for detecting the therapeutic effect of the antisense oligonucleotide combination and the pharmaceutical composition in preparing a kit for detecting retinal diseases.

It can be understood that the reagent of the application can accurately and effectively detect the expression quantity of PRPF31 gene; therefore, the kit can be used for preparing the kit for detecting the retinal diseases. For example, according to the expression level of the PRPF31 gene, it is possible to judge whether the expression of the PRPF31 gene is abnormal or not with reference to a normal sample, and provide a reference basis for diagnosis of retinal diseases.

The application has the beneficial effects that:

the antisense oligonucleotide composition for treating the retinal diseases has good intracellular stability, can more effectively promote PRPF31 gene expression, and provides a new scheme and approach for treating retinal pigment degeneration, especially retinal pigment degeneration type 11.

Detailed Description

Antisense oligonucleotides (antisense oligonucleotide, ASO) are artificially synthesized, and nucleic acid fragments complementary to a segment of a target gene or mRNA can bind to the target gene pre-mRNA by the base complementarity principle, thereby regulating gene expression and repairing part of the gene function. Lorey et al demonstrate that ASO skipping the exon of the DMD gene in vitro can treat related diseases.

According to the application, ASO is designed at 5' -uORF, exon3, exon11 and exon14 of PRPF31 gene pre-mRNA, so that the main functions of repairing PRPF31 gene can be regulated, and the expression level of normal PRPF31 gene can be improved, thereby achieving the effect of treating retinal pigment degeneration diseases. In particular, the present application has studied that ASO is designed at the 5' -uORF of PRPF31 gene pre-mRNA to promote gene expression more effectively.

Based on the above study and knowledge, the present application creatively proposes an antisense oligonucleotide combination for treating retinal diseases, that is, an antisense oligonucleotide comprising at least two antisense oligonucleotides promoting the expression of PRPF31 gene, wherein the antisense oligonucleotide uses 5' -uORF, exon3, exon11 or exon14 of PRPF31 gene pre-mRNA as a target site; and, the backbone of antisense oligonucleotide employs 2' -MOE modification and phosphorothioate backbone.

The antisense oligonucleotide combination of the application is more stable in cells, can effectively promote PRPF31 gene expression, and provides a new scheme and approach for treating retinitis pigmentosa type 11.

The application is further illustrated by the following examples. The following examples are merely illustrative of the present application and should not be construed as limiting the application.

Examples

1. Antisense oligonucleotide design

This example designed ASO for the four target sites 5' -uORF, exon3, exon11 and exon14 of PRPF31 gene pre-mRNA, respectively. The target site length of the 5' -uORF designed ASO is 344bp, and the specific sequence is a sequence shown as a Seq ID No. 1; exon3 is designed to have a target site length of 61bp of ASO, and a specific sequence is a sequence shown as a Seq ID No. 2; exon11 is designed to have a target site length of 73bp of ASO, and a specific sequence is a sequence shown as a Seq ID No. 3; exon14 is designed to have a target site length of 407bp of ASO, and a specific sequence is a sequence shown as a Seq ID No. 4.

Seq ID No.1

TAGTTTCCTGTTTCCGGCTTCGCTTCGGCCCACCCCCACGTCCACCCCGAATCCCTGCTTAAAGGCCTTGCTTTCTTGTCTAACGCCGCAACCAGTCCTCTGAGTTGCCAACGTCTTTCTTCTTGTCTCGACGCCCCGTCGTCCGGCCACAGCGATTCTCTGCTTAGCAGGATCGGTCCACAGCGGGACGTGAGTCCCTTTCCTCCTCGCGGCTTACCGCCTCTCTCCGCCTAGTGCCAGGTGCTAATAAAGTTGTTGTTTCAAATGCGGCCAGGAACATCGCGAGCGGGGACCAATCAGAGAGTAGCTTTGCCTCTATAACGGCGCGAGAGTGAGACGTCATC

Seq ID No.2

TTTGCTGAGATTATGATGAAGATTGAGGAGTATATCAGCAAGCAAGCCAAAGCTTCAGAAG

Seq ID No.3

GTACCGCAAGATGAAGGAGCGGCTGGGGCTGACGGAGATCCGGAAGCAGGCCAACCGTATGAGCTTCGGAGAG

Seq ID No.4

GGCCTGGAGATTGTGAACCCACAGGCGGCAGAGAAGAAGGTGGCTGAGGCCAACCAGAAGTATTTCTCCAGCATGGCTGAGTTCCTCAAGGTCAAGGGCGAGAAGAGTGGCCTTATGTCCACCTGAATGACTGCGTGTGTCCAAGGTGGCTTCCCACTGAAGGGACACAGAGGTCCAGTCCTTCTGAAGGGCTAGGATCGGGTTCTGGCAGGGAGAACCTGCCCTGCCACTGGCCCCATTGCTGGGACTGCCCAGGGAGGAGGCCTTGGAAGAGTCCGGCCTGGCCTCCCCCAGGACCGAGATCACCGCCCAGTATGGGCTAGAGCAGGTCTTCATCATGCCTTGTCTTTTTTAACTGAGAAAGGAGATTTTTTGAAAAGAGTACAATTAAAAGGACATTGTCAAGA

Considering the gene function and the specificity of ASO, the example finally designs and screens to obtain 12 ASO fragments, and the whole chain is synthesized by using 2'-MOE modification (2' -O-methoxyyethy) and Phosphorothioate (Phosphorothioate) skeletons. The 12 ASOs of this example are specifically shown in table 1, and all ASOs were synthesized by the company of bioengineering, inc.

TABLE 1 antisense oligonucleotides

Sequence number	ASO name	Sequence (5 'to 3')	Seq ID No.	Prediction function
					1	uORF_1	UGCGGCGUUAGACAAGAAAG	5	Promoting gene expression
2	uORF_2	UGUGGACCGAUCCUGCUAAGC	6	Promoting gene expression
					3	uORF_3	GAUGACGUCUCACUCUCGCGC	7	Promoting gene expression
4	exon3_1	AGCAAACUGUAGGAAAGGAG	8	Promoting gene expression
					5	exon3_2	AUCUUCAUCAUAAUCUCAGCA	9	Promoting gene expression
6	exon3_3	UGCUGAUAUACUCCUCAAUCU	10	Promoting gene expression
					7	exon11_1	UCCUUCAUCUUGCGGUACCUG	11	Promoting gene expression
8	exon11_2	UUGGCCUGCUUCCGGAUCUC	12	Promoting gene expression
					9	exon11_3	UCUCCGAAGCUCAUACGGUU	13	Promoting gene expression
10	exon14_1	GUUCACAAUCUCCAGGCCCU	14	Promoting gene expression
					11	exon14_2	CCUCAGCCACCUUCUUCUCU	15	Promoting gene expression
12	exon14_3	ACUCUUCUCGCCCUUGACC	16	Promoting gene expression

2. Antisense oligonucleotide application and gene detection

Rpe cell (human retinal pigment epithelial cell) culture

1) The culture supernatant was discarded, and the cells were rinsed 1-2 times with PBS free of calcium and magnesium ions.

2) 2mL of digestion solution (0.25% Trypsin-0.53mM EDTA) is added into a culture flask, the mixture is placed into a culture box at 37 ℃ for digestion for 1-2 minutes, then the digestion condition of cells is observed under a microscope, if most of the cells are rounded and fall off, the cells are quickly taken back to an operating table, and a small amount of culture medium is added after tapping the culture flask for stopping the digestion.

3) Adding M199 culture medium at a ratio of 6-8 mL/bottle, gently stirring, sucking out, centrifuging at 1000rpm for 4 min, discarding supernatant, adding 1-2mL culture solution, and blowing.

4) The cell suspension was split into new dishes or flasks containing 8mL of medium in a ratio of 1:2 to 1:5.

2. Design of experimental group

In this example, ASOs of table 1 were transfected into RPE cell suspensions, respectively, and then qPCR was used to verify the effect of ASOs on PRPF31 gene expression. To verify the effect of different ASOs in promoting PRPF31 gene expression, this example transfected a single ASO or a combination of two ASOs according to the protocol of table 2 and used RPE cells not transfected with ASOs as reference.

TABLE 2 design of antisense oligonucleotide transfection assay

ASO transfection

1) Cells were collected one day in advance, and plated by blowing off the cells to single cells.

2) The transfection was performed in 12-well plates, with 70-90% density per well of cells.

3)23μL Medium diluted 2. Mu.L ASO (1. Mu.g/. Mu.L).

4)21μL Medium dilution 4. Mu.L->2000 reagent.

5) Diluted ASO and2000 mix and incubate for 20min.

6) The mixture was added to 12-well cell plates.

7) The cells were cultured for 24 hours and then subjected to the next experiment.

RNA extraction and first Strand cDNA Synthesis

Total RNA extraction using RNeasy Plus Mini Kit:

1) Add 300. Mu.L of Buffer RLT Plus to the collected cells and vortex for 30s.

2) The lysed cell fluid was filtered on a gDNA adsorption column, >10000rpm centrifuged for 30s.

3) To the filtrate was added an equal volume of 70% ethanol.

4) The mixed solution is added into an RNA mini adsorption column, the maximum bearing capacity of the adsorption column is 700 mu L, and the mixed solution can be added and centrifuged for 15s at 10000rpm for multiple times.

5) 700. Mu.L of Buffer RW1 was loaded onto an RNA mini adsorption column and centrifuged at >10000rpm for 15s.

6) Add 500. Mu.L Buffer RPE to RNAmini adsorption column, >10000rpm for centrifugation 15s.

7) And (6) repeating the step 6.

8) The column was placed on a fresh 1.5mL centrifuge tube, 30-50. Mu.L of RNase-free water was added, and the mixture was centrifuged at >10000rpm for 1min.

PrimeScript ^TM II Reverse Transcriptase reverse transcription first strand cDNA Synthesis:

1) The mixture was prepared in a Microtube: RNA template with Oligo dT primer 50pmol 1. Mu.L, dNTP Mixture (10 mM each) 1. Mu.L and total amount of less than or equal to 5. Mu.g was supplemented with RNase free dH ₂ O to 10. Mu.L.

2) Heated at 65℃for 5 minutes and quenched on ice.

3) The following reaction solutions were prepared in the above tube to a total volume of 20. Mu.L: template RNA/Primer mixture 10. Mu.L, 5× PrimeScript II Buffer 4. Mu.L, RNase Inhibitor 20U, primeScript II RTase 200U, and RNase free dH were supplemented ₂ O to 20. Mu.L.

4) Mix gently.

The above reaction solution is placed at 42-50deg.C for 30-60min, specifically at 42 deg.C for 60min, and then heated at 70 deg.C for 15min, and cooled on ice.

The cDNA solution obtained can be used directly for the synthesis of 2nd-Strand cDNA or for subsequent PCR amplification.

qPCR validation

In order to verify the influence of ASO on the PRPF31 gene expression level, a PRPF31 gene specific detection primer and a probe are specifically designed; the upstream primer of the PRPF31 gene specificity detection primer is a sequence shown by a Seq ID No.17, the downstream primer is a sequence shown by a Seq ID No.18, and the detection probe is a sequence shown by a Seq ID No. 19; the 5 'end and the 3' end of the PRPF31 gene-specific detection probe are respectively marked with a fluorescent group and a fluorescence quenching group. And adopts housekeeping gene actin as reference gene, designs the specific detection primer and probe of the actin reference gene; the upstream primer of the actin reference gene specificity detection primer is a sequence shown as a Seq ID No.20, the downstream primer is a sequence shown as a Seq ID No.21, and the detection probe is a sequence shown as a Seq ID No. 22; the 5 'end and the 3' end of the actin reference gene specific detection probe are respectively marked with a fluorescent group and a fluorescence quenching group, and the PRPF31 gene specific detection probe and the actin reference gene specific detection probe are respectively marked with different fluorescent groups. In this example, the 5 'end and the 3' end of the PRPF31 gene-specific probe respectively use a 6-FAM fluorescent group and a BHQ2 fluorescent quenching group, and the 5 'end and the 3' end of the actin reference gene-specific probe respectively use a 6-VIC fluorescent group and a BHQ2 fluorescent quenching group. Primer and probe sequences are shown in Table 3, and all primers and probes were synthesized by Biotechnology Co., ltd.

TABLE 3 primer and probe sequences

The qPCR reaction system of this example was 25. Mu.L, including: premix Ex Taq (2×) (Probe qPCR), bulk 12.5. Mu.L, PCR Forward Primer (10. Mu.M) 0.5. Mu.L, PCR Reverse Primer (10. Mu.M) 0.5. Mu. L, probe (10. Mu.M) 1. Mu.L, cDNA template 2. Mu.L, sterile water 8.5. Mu.L, and a total of 25. Mu.L.

The qPCR reaction conditions were that the reaction was pre-denatured for 5min at 95℃and then entered 40 cycles: 95 ℃ for 30s and 60 ℃ for 1min. Fluorescence was collected at 60 ℃.

3. Results and analysis

In the example, the effect of ASO on the PRPF31 gene expression of cells is judged by carrying out the relative quantitative gene analysis of PRPF31 by using the untreated RPE cells as a reference and Actin as an internal reference through the result of qPCR. The partial statistics are shown in Table 4.

Table 4 expected test results case data analysis

In Table 4, "test number" corresponds to Table 2, and "blank" is RPE cells without any treatment as a reference. The test design scheme of the table 2 designs 3 ASOs for each target site for testing, and the test results show that the three ASOs of each target site have equivalent effects; thus, table 4 only gives statistics of one ASO designed for each target site, and of the combination of one ASO of the 5' -uoorf target site with one ASO of the exon3 target site, one ASO of the exon11 target site, and one ASO of the exon14 target site, respectively.

The test results show that all 12 ASOs designed for the 5 '-uoorf, exon3, exon11 and exon14 target sites in table 1 can promote PRPF31 gene expression, and all 12 ASOs in this example can significantly increase the relative expression level of PRPF31 gene relative to RPE cells without any treatment, i.e., blank control, as shown in the results of test nos. 1, 4, 7 and 10 in table 4, and especially the ASOs designed for the 5' -uoorf target sites have better effect of promoting PRPF31 gene expression, as shown in the results of test No.1 in table 4. Furthermore, the use of ASO designed for the 5' -uoorf target site in combination with exon3, exon11 and exon14 target site increased the relative expression level of the PRPF31 gene more significantly, i.e., improved the effect of promoting PRPF31 gene expression, as shown in the results of test nos. 13, 16 and 19 of table 4. Analysis suggests that the possible reason is that ASO of the 5' -uoorf fragment is effective in increasing PRPF31 gene expression in cells; meanwhile, the use of apo repairable gene nonsensical mutation of exo 3, exo 11 or exo 14 together synergistically enhances PRPF31 gene expression. Therefore, ASO using 5' -uORF fragment is suggested to be used in combination with ASO of exon3, exon11 or exon 14.

The ASO of the example can promote PRPF31 gene expression, and can be used for preparing a biological molecule medicament for treating retinal pigment degeneration diseases.

In addition, for ease of use, the primary reagents used in this example may be assembled into a kit, e.g., the kit may comprise ASO,2000. Reverse transcription reagent, mixed primer required by qPCR amplification, PCR enzyme premix, enzyme water-free and the like. The specific kit components may be as desired.

The foregoing is a further detailed description of the application in connection with specific embodiments, and it is not intended that the application be limited to such description. It will be apparent to those skilled in the art that several simple deductions or substitutions can be made without departing from the spirit of the application.

SEQUENCE LISTING

<110> Anji Karl (Shenzhen) technology Co., ltd

<120> an antisense oligonucleotide combination for treating retinal diseases and use thereof

<130> 21I32390

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 344

<212> DNA

<213> 5' -uORF fragment

<400> 1

tagtttcctg tttccggctt cgcttcggcc cacccccacg tccaccccga atccctgctt 60

aaaggccttg ctttcttgtc taacgccgca accagtcctc tgagttgcca acgtctttct 120

tcttgtctcg acgccccgtc gtccggccac agcgattctc tgcttagcag gatcggtcca 180

cagcgggacg tgagtccctt tcctcctcgc ggcttaccgc ctctctccgc ctagtgccag 240

gtgctaataa agttgttgtt tcaaatgcgg ccaggaacat cgcgagcggg gaccaatcag 300

agagtagctt tgcctctata acggcgcgag agtgagacgt catc 344

<210> 2

<211> 61

<212> DNA

<213> exon3 fragment

<400> 2

tttgctgaga ttatgatgaa gattgaggag tatatcagca agcaagccaa agcttcagaa 60

g 61

<210> 3

<211> 73

<212> DNA

<213> exon11 fragment

<400> 3

gtaccgcaag atgaaggagc ggctggggct gacggagatc cggaagcagg ccaaccgtat 60

gagcttcgga gag 73

<210> 4

<211> 407

<212> DNA

<213> exon14 fragment

<400> 4

ggcctggaga ttgtgaaccc acaggcggca gagaagaagg tggctgaggc caaccagaag 60

tatttctcca gcatggctga gttcctcaag gtcaagggcg agaagagtgg ccttatgtcc 120

acctgaatga ctgcgtgtgt ccaaggtggc ttcccactga agggacacag aggtccagtc 180

cttctgaagg gctaggatcg ggttctggca gggagaacct gccctgccac tggccccatt 240

gctgggactg cccagggagg aggccttgga agagtccggc ctggcctccc ccaggaccga 300

gatcaccgcc cagtatgggc tagagcaggt cttcatcatg ccttgtcttt tttaactgag 360

aaaggagatt ttttgaaaag agtacaatta aaaggacatt gtcaaga 407

<210> 5

<211> 20

<212> RNA

<213> artificial sequence

<400> 5

ugcggcguua gacaagaaag 20

<210> 6

<211> 21

<212> RNA

<213> artificial sequence

<400> 6

uguggaccga uccugcuaag c 21

<210> 7

<211> 21

<212> RNA

<213> artificial sequence

<400> 7

gaugacgucu cacucucgcg c 21

<210> 8

<211> 20

<212> RNA

<213> artificial sequence

<400> 8

agcaaacugu aggaaaggag 20

<210> 9

<211> 21

<212> RNA

<213> artificial sequence

<400> 9

aucuucauca uaaucucagc a 21

<210> 10

<211> 21

<212> RNA

<213> artificial sequence

<400> 10

ugcugauaua cuccucaauc u 21

<210> 11

<211> 21

<212> RNA

<213> artificial sequence

<400> 11

uccuucaucu ugcgguaccu g 21

<210> 12

<211> 20

<212> RNA

<213> artificial sequence

<400> 12

uuggccugcu uccggaucuc 20

<210> 13

<211> 20

<212> RNA

<213> artificial sequence

<400> 13

ucuccgaagc ucauacgguu 20

<210> 14

<211> 20

<212> RNA

<213> artificial sequence

<400> 14

guucacaauc uccaggcccu 20

<210> 15

<211> 20

<212> RNA

<213> artificial sequence

<400> 15

ccucagccac cuucuucucu 20

<210> 16

<211> 19

<212> RNA

<213> artificial sequence

<400> 16

acucuucucg cccuugacc 19

<210> 17

<211> 20

<212> DNA

<213> artificial sequence

<400> 17

atggacagcg gaagaagcga 20

<210> 18

<211> 21

<212> DNA

<213> artificial sequence

<400> 18

gcctcgttta cctgtgtctg c 21

<210> 19

<211> 21

<212> DNA

<213> artificial sequence

<400> 19

aggccaaccg tatgagcttc g 21

<210> 20

<211> 18

<212> DNA

<213> artificial sequence

<400> 20

catctcaggt gaacgctt 18

<210> 21

<211> 21

<212> DNA

<213> artificial sequence

<400> 21

ttcacattcc catccacgat t 21

<210> 22

<211> 21

<212> DNA

<213> artificial sequence

<400> 22

actctcatct tgcctcgctc t 21

Claims

1. An antisense oligonucleotide combination for treating retinal disease, characterized in that: comprises at least two antisense oligonucleotides for promoting PRPF31 gene expression, wherein the antisense oligonucleotides take 5' -uORF, exon3, exon11 or exon14 of PRPF31 gene pre-mRNA as target sites; and, the backbone of the antisense oligonucleotide employs 2' -MOE modification and phosphorothioate backbone;

at least one antisense oligonucleotide designed by taking 5' -uORF as a target site and at least one antisense oligonucleotide designed by taking exon3, exon11 or exon14 as a target site;

an antisense oligonucleotide designed by taking 5' -uORF as a target site is at least one of sequences shown in SEQ ID No.5 to SEQ ID No.7, an antisense oligonucleotide designed by taking exon3 as a target site is at least one of sequences shown in SEQ ID No.8 to SEQ ID No.10, an antisense oligonucleotide designed by taking exon11 as a target site is at least one of sequences shown in SEQ ID No.11 to SEQ ID No.13, and an antisense oligonucleotide designed by taking exon14 as a target site is at least one of sequences shown in SEQ ID No.14 to SEQ ID No. 16.

2. The antisense oligonucleotide combination of claim 1, characterized in that: the target site of 5' -uORF is the sequence shown in Seq ID No.1, the target site of exon3 is the sequence shown in Seq ID No.2, the target site of exon11 is the sequence shown in Seq ID No.3, and the target site of exon14 is the sequence shown in Seq ID No. 4.

3. Use of an antisense oligonucleotide combination according to claim 1 or 2 in the manufacture of a medicament for the treatment of a retinal disease.

4. A pharmaceutical composition for treating retinal disease, characterized in that: comprising the antisense oligonucleotide combination of claim 1 or 2 and pharmaceutically acceptable excipients.

5. A composition of the antisense oligonucleotide combination of claim 1 or 2 linked or conjugated to a pharmaceutical or pharmaceutical-property agent.