CN113583937A

CN113583937A - Culture medium and culture method for differentiating pluripotent mammalian stem cells into definitive endoderm cells

Info

Publication number: CN113583937A
Application number: CN202110749758.5A
Authority: CN
Inventors: 蒋卫; 吕静
Original assignee: Wuhan University WHU
Current assignee: Shenzhen Beikeyuan Cell Technology Co ltd
Priority date: 2021-07-02
Filing date: 2021-07-02
Publication date: 2021-11-02
Anticipated expiration: 2041-07-02
Also published as: CN113583937B

Abstract

The invention discloses a culture medium and a culture method for differentiating pluripotent stem cells of mammals into definitive endoderm cells, wherein the components of the culture medium comprise: at least one of ATP and NAC is added to the basal medium. The method comprises the following steps: and culturing the mammalian pluripotent stem cells by using the culture medium so as to differentiate into definitive endoderm cells. The invention improves the differentiation efficiency of the differentiation culture of the pluripotent mammalian stem cells into definitive endoderm cells or/and reduces the dosage of Activin A by adding at least one of ATP and NAC into a basic culture medium, thereby reducing the cost; the culture medium provided by the invention has the advantages of low cost and stable performance, and can efficiently differentiate human pluripotent stem cells into definitive endoderm cells. The method provides a low-cost and high-efficiency research system for the research of endoderm related development problems in vitro. Meanwhile, the application cost of regenerative medicine is also reduced.

Description

Culture medium and culture method for differentiating pluripotent mammalian stem cells into definitive endoderm cells

Technical Field

The invention relates to the field of stem cells and regenerative medicine, in particular to a culture medium and a culture method for differentiating pluripotent mammalian stem cells into definitive endoderm cells.

Background

Pluripotent Embryonic Stem Cells (ESCs) and Induced Pluripotent Stem Cells (iPSCs) are special-like cells. On one hand, the cell has almost unlimited self-renewal capacity, and on the other hand, the cell has the potential of differentiating into various cell types forming a human body, and the in-vitro differentiation system provides a quick and convenient means for explaining the molecular basis of the occurrence of related diseases and provides a good technical system for regenerative medicine. The pluripotent stem cells can be differentiated to inner, middle and outer three germ layer lineages, wherein related diseases caused by defects of tissues such as liver, intestine, pancreas and the like of endoderm sources seriously affect the life quality of human beings, for example, diabetes cannot be radically cured, and regenerative medicine provides possibility for radical cure. However, in order to obtain endoderm tissue cells in vitro, it is necessary to obtain definitive endoderm cells with higher efficiency.

At present, mature and stable definitive endoderm differentiation systems are obtained. Wherein nodal/Activin A signaling pathway plays a key role, thus a certain proportion of endoderm cells can be obtained by adding Activin A to the culture medium. However, Activin a, as a growth factor, is expensive, which makes it expensive to obtain definitive endoderm cells in vitro. Therefore, there is a need to establish a system with low cost, simple components and high efficiency to obtain definitive endoderm cells, which will greatly expand its application in basic research and regenerative medicine.

Disclosure of Invention

The invention aims to provide a culture medium and a culture method for differentiating a mammal pluripotent stem cell into a definitive endoderm cell, which can improve the differentiation efficiency of the mammal pluripotent stem cell into the definitive endoderm cell through differentiation culture or/and reduce the dosage of Activin A so as to reduce the cost by adding at least one of ATP and NAC into a basic culture medium.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided a use of ATP, the use comprising: adding ATP to improve the differentiation efficiency of the pluripotent stem cells of the mammals to differentiate and culture the pluripotent stem cells into the definitive endoderm cells.

In a second aspect of the invention, there is provided an application of a NAC, the application comprising: NAC is added to improve the differentiation efficiency of the differentiation culture of the pluripotent stem cells of the mammals into the definitive endoderm cells.

In a third aspect of the present invention, there is provided a compound for increasing the differentiation efficiency of pluripotent mammalian stem cells into definitive endoderm cells by differential culture, wherein the compound comprises at least one of ATP and NAC.

In a fourth aspect of the invention, there is provided a culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells, the medium comprising: at least one of ATP and NAC is added to the basal medium.

Further, the components of the culture medium include: adding 1-100 ng/ml Activin A, B27, bovine serum albumin, double antibody and at least one of ATP and NAC to a basic culture medium.

Further, the components of the culture medium include: adding 1-10 ng/ml Activin A, 0.5-1.5% B27, 0.1-0.3% bovine serum albumin, 0.5-1.5% double antibody and one of the following compounds to a basic culture medium:

a compound A: 0.1-4 mMATP;

compound B: 1-4 mM NAC;

compound C: 0.05-0.15 mM ATP and 1.5-2.5 mM NAC.

Further, the components of the culture medium further comprise: 2-3 mM GSK3 inhibitor. Specifically, the GSK3 inhibitor may be, for example, CHIR99021 or a Wnt signaling activator, for example, Wnt 3A.

In other embodiments, the culture medium may further comprise a Histone Deacetylase (HDAC) inhibitor, for example, sodium butyrate (NaB), Phenyl Butyrate (PB), valproate (valproate), trichostatin a, Entinostat (antinostat), or panobinostat (Panobinstat). The differentiation medium may further comprise one or more growth factors, such as FGF1, FGF2, and FGF4, and/or serum, such as FBS or FCS. The differentiation medium may also comprise an inhibitor of PI3K (phosphoinositide 3-kinase), such as LY 294002.

Further, the types of mammalian pluripotent stem cells include: mammalian embryonic stem cells or mammalian induced pluripotent stem cells;

when the mammalian pluripotent stem cells are mammalian embryonic stem cells, the compound A is 0.1-2mM ATP, and the compound B is 1-3mM NAC;

when the mammal pluripotent stem cells are mammal induced pluripotent stem cells, the compound A is 0.1-4 mM ATP, and the compound B is 1-4 mM NAC.

Specifically, the mammalian pluripotent stem cells include: one of a human pluripotent stem cell, a primate pluripotent stem cell, a mouse pluripotent stem cell, a rat pluripotent stem cell, a canine pluripotent stem cell, a feline pluripotent stem cell, a porcine pluripotent stem cell, a bovine pluripotent stem cell, and an equine pluripotent stem cell.

In a fifth aspect of the present invention, there is provided a culture method for differentiation of mammalian pluripotent stem cells into definitive endoderm cells, the method comprising: and culturing the mammalian pluripotent stem cells by using the culture medium so as to differentiate into definitive endoderm cells.

Further, the method comprises:

culturing the pluripotent stem cells of the mammal for 3-7 days by using a growth culture medium, digesting, counting and inoculating the cells into a pore plate coated with matrigel, and culturing by using a normal growth culture medium;

and when the density reaches 75-85%, replacing the culture medium for culturing to obtain the definitive endoderm cells.

In the above technical scheme, the growth medium may specifically be mTeSR + 1% double antibody, and the matrigel is mixed with 1: the dilution ratio of 100 is coated in the plate hole, and the addition ratio can be properly adjusted in other embodiments;

in the technical scheme, after digestion counting, the digestion count is carried out according to 0.8X10 for a 24-well plate⁵The density of each well was seeded with cells in a 24-well plate coated with matrigel; in other embodiments, the number of cells seeded is adjusted accordingly, as appropriate, for different dishes.

NAC of the present invention is collectively referred to as N-acetyl-L-cysteine; ATP is called adenosine triphosphate (adenosine triphosphate for short);

one or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

the invention provides a culture medium and a culture method for differentiating pluripotent mammalian stem cells into definitive endoderm cells, which improve the differentiation efficiency of the pluripotent mammalian stem cells into the definitive endoderm cells through adding at least one of ATP and NAC into a basic culture medium or/and reduce the dosage of Activin A so as to reduce the cost; specifically, the method comprises the following steps:

(1) ATP or NAC is added into the culture medium, so that the pluripotent stem cells can achieve higher differentiation efficiency when differentiating for 3 or 4 days, and the differentiation time can be shortened.

(2) The concentration of Activin A in the medium was reduced to 10ng/ml, which is only 1/10 of the concentration of Activin A in the currently popular medium, and on the basis of this addition of ATP or NAC, differentiation efficiency reached a level comparable to 100ng/ml concentration of Activin A. ATP and NAC are much less expensive than Activin A, thus reducing the differentiation cost of definitive endoderm to within 1/10.

(3) The culture medium provided by the invention has the advantages of low cost and stable performance, and can efficiently differentiate human pluripotent stem cells into definitive endoderm cells. The method provides a low-cost and high-efficiency research system for the research of endoderm related development problems in vitro. Meanwhile, the application cost of regenerative medicine is reduced, so that the research and the application of cell therapy are greatly promoted, and the application prospect is good.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a flow chart comparing the results of example 1 and comparative example 1 showing the effect of ATP on the positive rate of human embryonic stem cell endoderm differentiation;

FIG. 2 is the result of quantitative PCR comparing example 1 and comparative example 1 showing the effect of ATP on the expression of human embryonic stem cell endoderm differentiation marker gene;

FIG. 3 is a flow chart comparing the results of example 2 and comparative example 2 showing the effect of NAC on the positive rate of human embryonic stem cell endoderm differentiation;

FIG. 4 is the quantitative PCR result comparing example 2 and comparative example 2 showing the effect of NAC on the expression of human embryonic stem cell endoderm differentiation marker gene;

FIG. 5 is a flow chart comparing the results of example 3 and comparative examples 3 and 4, showing the effect of ATP on the positive rate of endoderm differentiation of human embryonic stem cells when the amount of Activin A is reduced;

FIG. 6 is an immunofluorescence result comparing example 3 with comparative examples 3 and 4, showing the effect of ATP on human embryonic stem cell endoderm differentiation when Activin A is reduced;

FIG. 7 is a flow chart comparing the results of example 4 with those of comparative example 3 and comparative example 5, which shows the effect of NAC on the positive rate of human embryonic stem cell endoderm differentiation when the amount of Activin A is reduced;

FIG. 8 is the immunofluorescence results comparing example 4 with comparative example 3 and comparative example 5, showing the effect of NAC on human embryonic stem cell endoderm differentiation at reduced levels of Activin A;

FIG. 9 is a flow chart showing the effect of combining ATP and NAC on the positive rate of human embryonic stem cell endoderm differentiation when the amount of Activin A is reduced in comparison with example 5 and comparative example 3 and comparative example 6;

FIG. 10 is a graph showing the results of immunofluorescence comparing the effects of ATP and NAC in combination on the endodermal differentiation of human embryonic stem cells at reduced levels of Activin A, between example 5 and comparative example 3 and comparative example 6;

FIG. 11 is a flow chart comparing the results of example 6 and comparative example 7 showing the effect of ATP on the positive rate of human induced pluripotent stem cell endoderm differentiation;

FIG. 12 is a flow chart comparing the results of example 7 and comparative example 8 showing the effect of NAC on the positive rate of human induced pluripotent stem cell endoderm differentiation;

FIG. 13 is a schematic flow chart of a method for differentiating pluripotent mammalian stem cells into definitive endoderm cells according to an embodiment of the present invention.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be obtained by an existing method.

A culture medium and a culture method for differentiating pluripotent mammalian stem cells into definitive endoderm cells according to the present application will be described in detail with reference to examples, comparative examples and experimental data.

Example 1

1. Culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells

The culture medium takes DMEM/F12 as a basic culture medium, and also comprises the following components: 100ng/ml Activin A, 2.5uM CHIR99021, 1% B27, 0.2% bovine serum albumin, 1% double antibody, ATP.

2. A culture method for differentiating human pluripotent stem cells into definitive endoderm cells by using the culture medium specifically comprises the following steps:

(1) mTeSR + 1% double antibody was used as growth medium at 1: culturing human embryonic stem cells on matrigel at a dilution ratio of 100.

(2) The human embryonic stem cells in the step (1) are cultured for 4-5 days and then are cloned and grown, the cell density is about 80% -90% of the bottom area of a culture plate hole plate, Accutase is used for standing for 3 minutes in a 37 ℃ cell culture box, the cells are observed to be spherical under a microscope, DMEM/F12 culture medium is immediately added to stop digestion, the cells are counted after being lightly blown and resuspended, and the counting is carried out according to the ratio of 0.8X10⁵Density per well cells were seeded on matrigel coated 2In 4-well plates, culture in normal growth medium.

(3) After the cell in the step (2) is cultured for one day, the density reaches about 80%, and at the moment, the newly prepared culture medium is replaced to start definitive endoderm differentiation, which is marked as differentiation D0 days.

(4) The definitive endoderm cells were obtained at D3 days by replacing the medium with fresh medium every 24 hours after the start of differentiation.

Comparative example 1

In comparative example 1, the procedure was the same as in example 1 except that ATP was not added to the differentiation medium.

Example 2

1. A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells, which takes DMEM/F12 as a basic culture medium and further comprises the following components: 100ng/ml Activin A, 2.5uM CHIR99021, 1% B27, 0.2% bovine serum albumin, 1% diabody, NAC.

(2) The human embryonic stem cells in the step (1) are cultured for 4-5 days and then are cloned and grown, the cell density is about 80% -90% of the bottom area of a culture plate hole plate, Accutase is used for standing for 3 minutes in a 37 ℃ cell culture box, the cells are observed to be spherical under a microscope, DMEM/F12 culture medium is immediately added to stop digestion, the cells are counted after being lightly blown and resuspended, and the counting is carried out according to the ratio of 0.8X10⁵Density per well cells were seeded in matrigel coated 24-well plates and cultured in normal growth medium.

Comparative example 2

In this comparative example 2, the procedure was the same as in example 2 except that NAC was not added to the differentiation medium.

Example 3

1. A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells, which takes DMEM/F12 as a basic culture medium and further comprises the following components: 10ng/ml Activin A, 1% B27, 0.2% bovine serum albumin, 1% double antibody, ATP.

(4) The definitive endoderm cells were obtained at D4 days by replacing the medium with fresh medium every 24 hours after the start of differentiation.

Comparative example 3

In this comparative example, as a positive control, the following was specifically performed:

(2) And (2) after culturing the human embryonic stem cells in the step (1) for 4-5 days, cloning and growing, wherein the cell density is about 80% -90% of the bottom area of a plate of the culture plate, using Accutase to stand in a cell culture box at 37 ℃ for 3 minutes, observing the cells to be in a spherical shape under a microscope, immediately adding a DMEM/F12 culture medium to terminate digestion, gently blowing, weighing and re-suspending, counting, inoculating the cells into a 24-hole plate coated with matrigel according to the density of 0.8X 105/hole, and culturing by using a normal growth culture medium.

(4) After the start of differentiation, the above medium was replaced with fresh medium every 24 hours, and definitive endoderm cells were harvested at D4 day as a positive control.

Comparative example 4

In this comparative example, the procedure was as in example 3 except that ATP was not added to the medium as a negative control.

Example 4

1. A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells, which takes DMEM/F12 as a basic culture medium and further comprises the following components: 10ng/ml Activin A, 1% B27, 0.2% bovine serum albumin, 1% diabody, NAC.

(2) The human embryonic stem cells in the step (1) are cloned and grown after being cultured for 4-5 days, and the cell density is about 80-90 percent of the bottom area of the culture plate pore plate at the momentPercent, using Accutase to stand in a cell culture box at 37 ℃ for 3 minutes, observing the cells to be in a spherical shape under a microscope, immediately adding DMEM/F12 culture medium to terminate digestion, gently blowing, resuspending and counting according to 0.8X10⁵Density per well cells were seeded in matrigel coated 24-well plates and cultured in normal growth medium.

(3) After the cells in the step 2) are cultured for one day, the density reaches about 80%, and at the moment, the newly prepared culture medium is replaced to start definitive endoderm differentiation, which is marked as differentiation D0 days.

Comparative example 5

In this comparative example, the procedure was as in example 4 except that NAC was not added to the medium as a negative control.

Example 5

1. A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells, which takes DMEM/F12 as a basic culture medium and further comprises the following components: 10ng/ml Activin A, 1% B27, 0.2% bovine serum albumin, 1% diabody, ATP, NAC.

Comparative example 6

In this comparative example, the procedure was as in example 5 except that ATP and NAC were not added to the medium as a negative control.

Example 6

1. A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells is prepared by the same steps as example 1, and is mainly characterized in that the human pluripotent stem cells are human-induced pluripotent stem cells, and the culture medium is used for verifying that the human pluripotent stem cells have consistent effects in different cell lines. The minor part of the difference was DMEM as basal medium and the differentiation time was 4 days.

Comparative example 7

In this comparative example, the procedure was as in example 6 except that ATP was not added to the medium.

Example 7

A culture medium for differentiating human pluripotent stem cells into qualitative endoderm cells is prepared by the same steps as example 2, and is mainly characterized in that the human pluripotent stem cells are human-induced pluripotent stem cells, and the culture medium is used for verifying that the human pluripotent stem cells have consistent effects in different cell lines. The minor part of the difference was DMEM as basal medium and the differentiation time was 4 days.

Comparative example 8

In this comparative example, the procedure was as in example 7 except that NAC was not added to the medium.

Experimental example 1

The positive rate of the definitive endoderm cells and the mRNA level of the definitive endoderm marker gene or the immunofluorescence of the positive rate of the definitive endoderm cells of each example and each comparative example were tested.

The detection method comprises the following steps:

1. and (3) detecting the positive rate of the human embryonic stem cell-derived definitive endoderm cells:

differentiating the above to obtainThe obtained cells were cultured with TrypLE at 37 ℃ in CO₂The incubator was allowed to stand for 1 minute, after which digestion was terminated with 2% FBS, and cell fluid was collected by gentle pipetting into a 1.5ml EP tube. Then, the cells were centrifuged at 3000rpm in a 4 ℃ centrifuge for 3 minutes, and the supernatant was discarded to obtain a cell pellet. Mix with 2% FBS at 1:200 proportions of CXCR4-APC antibody diluent are prepared, 200ul of antibody diluent is taken from each sample to lightly blow cell precipitates, and the samples are placed on ice and incubated for 30 minutes in a dark place. One sample was also prepared and added to APC-Isotype dilution (1: 200) as a negative control. After that, the mixture was centrifuged at 3000rpm for 3 minutes at 4 ℃ and the supernatant was discarded and washed twice with 2% FBS. And finally, re-suspending the cells by using precooled PBS to obtain a cell suspension, transferring the cell suspension into a flow tube, and detecting the CXCR4 positive rate by using an up-flow instrument. The antibody used in this study was Ant-CXCR4(555976, 1:200, BD Biosciences).

2. Detecting mRNA level change of the definitive endoderm cell marker gene by real-time fluorescent quantitative PCR:

(1) total RNA extraction from cells

In the experiment, a small total RNA extraction kit (double-column type) of the meiji organisms is adopted for extracting RNA of cells, and the specific operation steps are as follows:

digesting differentiated definitive endoderm cells with TrypLE, centrifuging, discarding supernatant, collecting cell precipitate, adding appropriate amount of Buffer RL into cell sample, and blowing and scattering cells (the amount of general cells is not more than 5X 10)⁶350ul of Buffer RL) is added in the process, and the mixture can be stored at the temperature of minus 80 ℃; preparing a proper amount of ice, taking out a sample to be extracted from a refrigerator, melting and uniformly mixing, transferring the sample to a gDNA filter column (placing the column in a collecting pipe), and centrifuging at 14000g for 2 minutes; discarding the gDNA filter column, adding 70% ethanol with equal volume of the sample, and blowing for 3-5 times by using a pipette; loading the RNA purification column on a collection tube, transferring the sample solution into the RNA column, and centrifuging at 12000g for 1 minute; the filtrate was decanted, the column was returned to the collection tube and 500ul of Buffer RW1 was added and 12000g was centrifuged for 1 min; the filtrate was decanted, the column was returned to the collection tube and 500ul of Buffer RW2 was added; 12000g centrifugation for 1 min, this step was repeated once; the filtrate was decanted, the column was returned to the collection tube, and 12000g was left empty for 2 minutes; the RNA column was transferred to a new 1.5ml EP tube, 35ul RNase Free water was addedStanding for 2 minutes at room temperature until reaching the center of the column membrane; 12000g, centrifugal 1 minutes, discarding the column, checking the RNA concentration and quality, at-80 ℃.

(2) Reverse transcription to obtain cDNA

1ug of the above extracted RNA was used to prepare cDNA using an Abclonal reverse transcription kit. Taking out the extracted RNA from a refrigerator, putting the RNA on ice, melting and uniformly mixing, taking 1ug of the RNA into a PCR eight-way tube, adding 4ul of 5 xqRT Supermix of Abclonal, and finally using RNase Free water to complement the total volume to 20 ul; the reaction solution was gently stirred with a finger and collected to the bottom of the tube by a palm centrifuge, and the tube was placed in a Bio-rad PCR apparatus for reverse transcription. Reverse transcription conditions were 25 ℃ for 5 minutes; 20 minutes at 42 ℃; 5 seconds at 85 ℃ and then stored at-20 ℃.

(3) Real-time fluorescent quantitative PCR

Taking a proper amount of cDNA obtained by reverse transcription (the amount of corresponding RNA is 10-20ng per well), adding 5ul of Bimake2 XSYBR Green qPCR Master Mix, 5 mu M of upstream primer and 5 mu M of downstream primer (1 ul of upstream and downstream primer mixed liquor), and finally, complementing the total volume to 10 mu l by RNase Free water; the amplification was carried out using a CFX384 quantitative PCR instrument from Bio-rad under the following reaction conditions: at 95 ℃ for 5min, 95 ℃ for 15s and 60 ℃ for 30s, 39 cycles were repeated. Results the housekeeping gene GAPDH was analyzed using the delta Delta CT method.

Primers used in this study:

GAPDH forward primer AATGAAGGGGTCATTGATGG (shown as SEQ ID NO. 1), and reverse primer AAGGTGAAGGTCGGAGTCAA (shown as SEQ ID NO. 2);

FOXA2 forward primer GGAGCAGCTACTATGCAGAGC (shown as SEQ ID NO. 3), and reverse primer CGTGTTCATGCCGTTCATCC (shown as SEQ ID NO. 4);

SOX17 forward primer GCATGACTCCGGTGTGAATCT (shown as SEQ ID NO. 5), reverse primer TCACACGTCAGGATAGTTGCAGT (shown as SEQ ID NO. 6);

CXCR4 forward primer TACACCGAGGAAATGGGCTCA (shown as SEQ ID NO. 7), reverse primer AGATGATGGAGTAGATGGTGGG (shown as SEQ ID NO. 8);

3. immunofluorescence detection of human embryonic stem cell-derived definitive endoderm cell positive rate:

after the cell differentiation is finished, removing culture medium in the hole, and slightly cleaning the cells twice by using DPBS; subsequently, 200ul of pre-cooled 4% paraformaldehyde was carefully added to each well and fixed for 15 minutes at room temperature; after fixation, the cells were gently washed 3 times with DPBS, 5 minutes each time; carefully add 200ul of blocking solution (8.7ml DPBS +1ml donkey serum +0.3ml 10% Triton-X100) to each well to cover the wells evenly, incubate for 1-2 hours at room temperature; then adding 150-200ul of blocking solution containing primary antibody to cover the plate hole, and incubating for 1-2 hours at room temperature; then recovering the primary anti-solvent, storing in a refrigerator at 4 ℃, and gently cleaning the cells for 3 times with DPBS (double stranded polysporagen) for 5 minutes each time; adding 150-200ul of secondary antibody-containing sealing liquid into each hole to cover the plate holes, and incubating for 1-2 hours at room temperature in a dark place; cells were gently washed 3 times with DPBS for 5 minutes each time; 150 and 200ul of DAPI solution (diluted 1: 5000 in DPBS) are added into each well, and the mixture is incubated for 5 to 10 minutes at room temperature in a dark place; and (3) slightly washing the cells by using DPBS (dinitrophenol-bis-phosphate) for 5 minutes each time, finally soaking the cells by using DPBS, placing the cells under an inverted fluorescence microscope for fluorescence observation, and collecting pictures. The primary antibody used in this study was Anti-FOXA2(ET1703-76, 1:200, HuaBio); Anti-SOX2(66411-1-Ig, 1:200, Proteintech). The fluorescent secondary antibody used in this study was Do α Ms TRITC (1:200, Jackson ImmunoResearch); do α Rb 488(1:200, Jackson ImmunoResearch); nuclear dye: DAPI (Roche, USA).

Second, detection results and analysis

1. Example 1 and comparative example 1

The positive rate of CXCR4 of the cells and the mRNA expression of the definitive endoderm marker gene in example 1 and comparative example 1 are detected, and the specific results are shown in a figure 1-2.

FIG. 1 is a flow chart of the definitive endoderm cell positivity in example 1 and comparative example 1, where "0" is comparative example 1. The results show that example 1 has a change in the proportion of CXCR4 positive cells with increasing ATP concentration compared to around 65% positive rate of comparative example 1. ATP concentration below 1uM has no influence on definitive endoderm differentiation, while concentration dependence of CXCR4 positive cells on ATP concentration can be seen in the range of 0.1-2mM, the cell state is still normal, the final positive rate can reach about 90%, and compared with comparative example 1, the cell death rate is obviously increased, and when ATP concentration is 3mM, the cell death rate is increased.

FIG. 2 shows mRNA expression levels of the definitive endoderm cell marker genes FOXA2, SOX17 and CXCR4 in the cells obtained in example 1 and comparative example 1. Compared with comparative example 1-0, the FOXA2 expression level, SOX17 expression level and CXCR4 expression level can be increased 1.5 times, 1.8 times and 2 times after adding 0.1, 0.5 and 1mM ATP in example 1.

The results in fig. 1 and fig. 2 are consistent, and both show that the addition of ATP can significantly promote differentiation of definitive endoderm and has concentration dependence. Meanwhile, in comparative example 1, differentiation is often required for 4-5 days to achieve differentiation efficiency of about 90%, while the addition of ATP in example 1 shortens the differentiation time to 3 days to achieve a comparable differentiation level, reducing the time required for differentiation of definitive endoderm cells.

2. Example 2 and comparative example 2

The positive rate of CXCR4 of the cells and the mRNA expression of the definitive endoderm marker gene in example 2 and comparative example 2 are detected, and the specific results are shown in figures 3-4.

FIG. 3 is a flow chart of the definitive endoderm cell positivity in example 2 and comparative example 2, where "0" is comparative example 2. The results show that example 2 has a varying proportion of CXCR4 positive cells with increasing NAC concentration compared to around 65% positive rate of comparative example 2. When the concentration of NAC is below 0.5mM, there is no influence on differentiation of definitive endoderm, while when the concentration is in the range of 1-3mM, the concentration dependence of CXCR4 positive cells on NAC can be seen, and the final positive rate can reach about 85%, which is obviously improved compared with comparative example 2.

FIG. 4 shows mRNA expression levels of the definitive endoderm cell marker genes FOXA2, SOX17, CXCR4 in the cells obtained in example 2 and comparative example 2. Compared with comparative example 2-0', the FOXA2 expression level, the SOX17 expression level and the CXCR4 expression level can be increased by 0.8 times, 1.5 times and 1.5 times respectively after 1mM, 2mM and 3mM of NAC are added in example 2.

The results in fig. 3 and fig. 4 are consistent, and both show that the addition of NAC significantly promotes differentiation of definitive endoderm and is concentration dependent. Meanwhile, for comparative example 2, differentiation is often required for 4-5 days to achieve differentiation efficiency of about 90%, while the addition of NAC in example 2 shortens the differentiation time to 3 days to achieve a comparable differentiation level, reducing the time required for differentiation of definitive endoderm cells.

3. Example 3, comparative example 3 and comparative example 4

Flow-through and immunofluorescence results were measured for the positive rate of cellular CXCR4 in example 3 and comparative examples 3 and 4, and the specific results are shown in fig. 5-6.

FIG. 5 is a flow chart of the positive rate of definitive endoderm cells in example 3 and comparative examples 3 and 4. The results show that the positive rate of CXCR4 of comparative example 4 as a negative control is about 60%, the positive rate of comparative example 3 as a positive control is more than 80%, and the result shows that the concentration of Activin A is reduced from 100ng/ml to 10ng/ml, so that the positive rate of CXCR4 is greatly reduced, and the positive rate of CXCR4 can be improved to a level equivalent to that of comparative example 3 by adding 0.5 or 1mM ATP in example 3. Indicating that ATP can partially replace Activin A, thereby greatly reducing the cost of differentiation, which is about 1/10 of comparative example 3.

FIG. 6 shows immunofluorescence results for definitive endoderm cell positivity in example 3 and comparative examples 3 and 4. The results show that the proportion of FOXA2 positive definitive endoderm cells was significantly reduced, by about 50%, after decreasing Activin a concentration in comparative example 4 compared to comparative example 3; example 3 the proportion of FOXA2 positive cells was greatly increased to a level comparable to comparative example 3 after addition of 0.5mM ATP based on comparative example 4. Indicating that the ATP can compensate the reduction of the differentiation efficiency of the definitive endoderm caused by the reduction of Activin A.

The results in FIGS. 5 and 6 are consistent, and both show that only 0.5mM ATP is required to achieve 100ng/ml Activin A differentiation under 10ng/ml Activin A, thereby greatly reducing the cost of definitive endoderm differentiation.

4. Example 4, comparative example 3 and comparative example 5

Flow and immunofluorescence results were tested for the positive rate of cellular CXCR4 in example 4 and comparative examples 3 and 5, and the specific results are shown in fig. 7-8.

FIG. 7 is a flow chart of the positive rate of definitive endoderm cells in example 4 and comparative examples 3 and 5. The result shows that the positive rate of CXCR4 of comparative example 5 as a negative control is about 60%, the positive rate of comparative example 3 as a positive control is more than 80%, and the Activin A concentration is reduced from 100ng/ml to 10ng/ml, so that the positive rate of CXCR4 is greatly reduced, and the positive rate of CXCR4 can be improved to more than 70% by adding 2mM NAC in example 4. Indicating that NAC can partially replace Activin A, thereby greatly reducing the differentiation cost.

FIG. 8 shows immunofluorescence results for definitive endoderm cell positivity in example 4 and comparative examples 3 and 5. The results show that the proportion of FOXA2 positive definitive endoderm cells was significantly reduced, by about 50%, after decreasing Activin a concentration in comparative example 5 compared to comparative example 3; example 4 the proportion of FOXA2 positive cells was greatly increased to a level close to that of comparative example 3 after 2mM NAC was added based on comparative example 5. Indicating that the presence of NAC can compensate for the reduced efficiency of definitive endoderm differentiation caused by the reduced Activin A.

The results in FIGS. 7 and 8 are consistent and both show that only 2mM NAC is required to approach the differentiation effect of 100ng/ml Activin A under the condition of 10ng/ml Activin A, thereby greatly reducing the differentiation cost of definitive endoderm.

5. Example 5, comparative example 3 and comparative example 6

Flow and immunofluorescence results of the positive rate of cellular CXCR4 in example 5, comparative example 3 and comparative example 6 were tested, and the specific results are shown in FIGS. 9-10.

FIG. 9 is a flow chart of the positive rates of definitive endoderm cells in example 5 and comparative examples 3 and 6. The results show that the positive rate of CXCR4 of comparative example 6 as a negative control is about 60%, the positive rate of comparative example 3 as a positive control is more than 80%, and the Activin A concentration is reduced from 100ng/ml to 10ng/ml, so that the positive rate of CXCR4 is greatly reduced, and at the moment, the positive rate of CXCR4 can be improved to more than 80% by adding 0.1mM of ATP and 2mM of NAC in example 5, which is equivalent to the level of comparative example 3. The combination of ATP and NAC has higher positive rate than that of the definitive endoderm obtained by adding any one of the ATP at the same level, and only 0.1mM of ATP is needed in combination, and the concentration is lower than that of the ATP added alone, so that ATP and NAC can partially replace Activin A at the same time, and the differentiation cost is greatly reduced, but the ATP and NAC need to be matched at proper concentration.

FIG. 10 shows immunofluorescence results for definitive endoderm cell positivity in example 5 and comparative examples 3 and 6. The results show that the addition of 0.1mM ATP and 2mM NAC in example 5 increases the positive rate of CXCR4 to a level comparable to comparative example 3.

The results in FIGS. 9 and 10 are consistent and both show that the differentiation effect of 100ng/ml Activin A is approached by only 0.1mM ATP and 2mM NAC under the condition of 10ng/ml Activin A, thereby greatly reducing the differentiation cost of definitive endoderm. ATP and NAC have a certain synergistic effect in the differentiation process of the definitive endoderm, but a proper concentration combination needs to be found, and the proper concentration combination range is 0.05-0.15 mM ATP and 1.5-2.5 mM NAC.

6. Example 6 and comparative example 7

FIG. 11 is a flow chart of the definitive endoderm cell positivity in example 6 and comparative example 7, where "0" is comparative example 7. The results show that the differentiation efficiency of the definitive endoderm of the human induced pluripotent stem cell in comparative example 7 is only 40%, while the differentiation efficiency can be improved to 50% and 70% by adding 3mM or 4mM ATP in example 6. It shows that ATP is also beneficial to the differentiation of human induced pluripotent stem cells in the definitive endoderm differentiation system.

Both example 6 and example 1 demonstrate that positive regulatory effects of ATP on definitive endoderm are more pronounced, especially for cell lines with weaker differentiation capacity, but at different specific concentrations required. ATP in example 1 affected the survival of human embryonic stem cells at 3mM, but this concentration was required for human induced pluripotent stem cells in example 6, and only 5mM significantly affected the survival of human induced pluripotent stem cells. Therefore, it is also demonstrated that the appropriate concentration of ATP required for definitive endoderm differentiation is different for different cell lines; specifically, the method comprises the following steps:

when the mammalian pluripotent stem cells are mammalian embryonic stem cells, the preferable concentration of ATP is 0.1-2 mM;

when the mammalian pluripotent stem cell is a mammalian induced pluripotent stem cell, the preferable concentration of ATP is 0.1 to 4 mM.

7. Example 7 and comparative example 8

FIG. 12 is the flow-through results of the definitive endoderm cell positivity in example 7 and comparative example 8, where "0" is comparative example 8. The results show that the differentiation efficiency of definitive endoderm cells of human induced pluripotent stem cells in comparative example 8 is only 40%, while the differentiation efficiency can be respectively improved to 60% by adding 1mM of NAC in example 7, and the differentiation efficiency can reach nearly 80% after increasing the concentration of NAC to 2mM, and further, the differentiation efficiency can be maintained at a level of nearly 80% after increasing the concentration to 4 mM. Indicating that NAC is also beneficial to differentiation in the definitive endoderm differentiation system of human induced pluripotent stem cells.

Both example 7 and example 2 demonstrate the positive regulatory effect of NAC on definitive endoderm and the effect is more pronounced in cell lines with weaker differentiation, but at different specific concentrations required. NAC in example 1 affected human embryonic stem cell survival after 3mM, but did not affect human induced pluripotent stem cells at this concentration. It is also stated that the appropriate concentration of NAC required for definitive endoderm differentiation is not the same for different cell lines; specifically, the method comprises the following steps:

when the mammalian pluripotent stem cells are mammalian embryonic stem cells, the preferable concentration of NAC is 1-2mM NAC;

when the mammalian pluripotent stem cells are mammalian induced pluripotent stem cells, the preferable concentration of NAC is 1-4 mM.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Wuhan university

<120> culture medium and culture method for differentiation of pluripotent mammalian stem cells into definitive endoderm cells

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aatgaagggg tcattgatgg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaggtgaagg tcggagtcaa 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggagcagcta ctatgcagag c 21

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtgttcatg ccgttcatcc 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcatgactcc ggtgtgaatc t 21

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcacacgtca ggatagttgc agt 23

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tacaccgagg aaatgggctc a 21

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agatgatgga gtagatggtg gg 22

Claims

1. Use of ATP, the use comprising: adding ATP to improve the differentiation efficiency of the pluripotent stem cells of the mammals to differentiate and culture the pluripotent stem cells into the definitive endoderm cells.

2. An application of a NAC, comprising: NAC is added to improve the differentiation efficiency of the differentiation culture of the pluripotent stem cells of the mammals into the definitive endoderm cells.

3. A compound for increasing the differentiation efficiency of mammalian pluripotent stem cells into differentiated cultures into definitive endoderm cells, wherein the compound comprises at least one of ATP and NAC.

4. A culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells, the medium comprising: at least one of ATP and NAC is added to the basal medium.

5. A culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells according to claim 4, wherein the components of the culture medium comprise: adding 1-100 ng/ml activin A, B27, bovine serum albumin, double antibody and at least one of ATP and NAC to a basic culture medium.

6. A culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells according to claim 5, wherein the components of the culture medium comprise: adding 1-10 ng/ml activin A, 0.5-1.5% B27, 0.1-0.3% bovine serum albumin, 0.5-1.5% double antibody and one of the following compounds to a basic culture medium:

a compound A: 0.1-4 mM ATP;

compound B: 1-4 mM NAC;

compound C: 0.05-0.15 mM ATP and 1.5-2.5 mM NAC.

7. A culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells according to claim 6, wherein the components of the culture medium further comprise: 2-3 mM GSK3 inhibitor.

8. A culture medium for differentiation of mammalian pluripotent stem cells into definitive endoderm cells according to claim 6, wherein the types of mammalian pluripotent stem cells comprise: mammalian embryonic stem cells or mammalian induced pluripotent stem cells;

when the mammalian pluripotent stem cells are mammalian embryonic stem cells, the compound A is 0.1-2mM ATP, and the compound B is 1-2mM NAC;

9. A method of culturing pluripotent mammalian stem cells to differentiate into definitive endoderm cells, the method comprising: culturing the pluripotent mammalian stem cells in a medium according to any one of claims 4 to 8 to differentiate into definitive endoderm cells.

10. The method of claim 9, wherein the method comprises:

and (3) when the density reaches 75-85%, replacing the culture medium of any one of claims 4-8 for culture to obtain the definitive endoderm cells.