CN113583143A

CN113583143A - CAR-T cells and methods of making the same

Info

Publication number: CN113583143A
Application number: CN202111156273.1A
Authority: CN
Inventors: 刘庆喜; 许晓椿; 肖海蓉; 魏卿; 赵梦莲
Original assignee: Sinica Ltd
Current assignee: Shenzhen Boya Perception Pharmaceutical Co ltd
Priority date: 2021-09-30
Filing date: 2021-09-30
Publication date: 2021-11-02
Anticipated expiration: 2041-09-30
Also published as: CN113583143B

Abstract

The present invention relates to CAR-T cells and methods of making the same. In particular, in one aspect, an encoded chimeric antigen receptor includes an antigen binding domain as a first signal, a transmembrane domain, an intracellular signaling domain as a second signal, and a third signal domain that expresses IL-7 and CCL-17 cytokines. The invention also relates to a recombinant plasmid, a CAR-T cell capable of secreting and expressing IL-7, CCL17 factor and/or PD-1, GM-CSF antibody. The present invention exhibits excellent effects as described in the specification.

Description

CAR-T cells and methods of making the same

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a CD19-CAR-T cell secreting IL-7 and CCL-17 factors, anti-PD-1 and anti-GM-CSFscFv for secreting and neutralizing PD-1 and GM-CSF, and a preparation method and application of the CD19-CAR-T cell.

Background

The first gene therapy product, kymeriah, was approved by the U.S. Food and Drug Administration (FDA) in 2017 at month 8 and is well suited for the treatment of some children and young patients with Acute Lymphoblastic Leukemia (ALL). Kymeriah is a genetically modified autologous T cell immunotherapy, namely chimeric antigen receptor T (CAR-T) immunotherapy. CAR-T immunotherapy is a cellular immunotherapy based on chimeric antigen receptors, where the CAR-T gene sequence encoding the chimeric antigen receptor is introduced into T cells by in vitro gene transduction techniques, resulting in tumor-specific T cells that can bind the target antigen. Most common CARs include a segment of antigen recognition, such as the single chain variable segment (scFv) of a monoclonal antibody (mAb), and the TCR zeta chain, which activates the intracellular signaling domain of T cells.

The CAR-T cell targeting CD19 has shown remarkable effect in preclinical and clinical situations, and the prior research shows that IL-7 can prolong the survival ability of immune cells, and can also stimulate the proliferation of mature T cells, so IL-7 factor can enhance the survival time of immune cells in vivo and the anti-tumor effect; CCL-17, also known as thymus and activation-regulated chemokines, is capable of increasing the ability of endogenous immune cells to aggregate into tumor cells, further enhancing the anti-tumor effect of immune cells. However, this therapy is limited by its associated toxic side effects, such as cytokine release syndrome and neurotoxicity. The cytokine syndrome mainly refers to the condition that in the process of the action of immune cells and tumor cells, a large amount of cytokines are released so as to cause further linkage reaction, such as high fever and chill, dyspnea, blood coagulation disorder and the like caused by excessive inflammation, and symptoms such as headache, confusion, cognitive change, language disorder and the like caused by neurotoxicity, which finally endanger life. Recently, studies have shown that monocytes and macrophages promote CRS and neurotoxicity progression after CAR-T cell therapy, and that neutralizing the giant cell colony stimulating factor (GM-CSF) can slow down CRS and neurotoxicity after CAR-T cell therapy without inhibiting CAR-T function (Sterner RM, Sakemura R, Cox MJ. GM-CSF inhibition of cell death pathway and neuroinflammation pathway CAR-T cell function in opportunities, blood, 2019 Feb 14; 133(7): 697. phi. 709. doi: 10.1182/blood-2018-10-881722. Epub 2018 Nov 21.). The RNA interference technology is utilized to efficiently knock down GM-CSF in CAR-T cells or secrete anti-GM-CSF scFv for expression and neutralization of GM-CSF, so that the generation and development of cytokine release syndrome and neurotoxicity are prevented or slowed down, and the safety of CAR-T therapy is improved.

In the aspect of CAR-T cell treatment of tumor, tumor microenvironment and immune response play an important role, in order to eliminate tumor cells, the autoimmune system needs to be activated, the activation and expansion of immune cells become key factors for tumor elimination, and immune cells such as T cells are inhibited by immune checkpoint molecules in the tumor microenvironment, such as programmed death receptor (PD-1), PD-1 can down regulate the response of the immune system to human cells in the body, and regulate the immune system and promote self-tolerance by inhibiting T cell inflammatory activity, and prevent autoimmune disease from generating, but can also bind to transduction inhibitory signals, such as PDL-1 ligand-induced cell death (AICD) generation, and limit the persistence of immune cells or CAR-T cells in the body. The PD-1 immune checkpoint is blocked by the PD-1 antibody, thereby repairing the function of the CAR-T cell.

Thus, there remains a need in the art for improved methods of tumor treatment, such as for example, for CD19-CAR-T cells secreting IL-7 and CCL-17 factor, and anti-PD-1 and anti-GM-CSFscFv that neutralize PD-1 and GM-CSF, with superior properties.

Disclosure of Invention

The invention aims to improve the method for treating tumors, for example, to provide a CD19-CAR-T cell which secretes IL-7 and CCL-17 factors with excellent performance, and secretes anti-PD-1 and anti-GM-CSFscFv for neutralizing PD-1 and GM-CSF.

The CAR-T cells made by the present invention may also be referred to as CD19-CAR-T cells.

Aiming at the actual requirements of the current CAR-T technology, the invention provides the construction of the CD19 CAR expression plasmid co-expressing IL-7 and CCL17, so that not only IL-7 can be secreted out of T cells, but also CCL-17 can recruit peripheral blood immune cells to the greatest extent, and the tumor cell killing capacity of CAR-T is further improved. In order to enhance the killing effect and reduce CRS and neurotoxic side effects, plasmids secreting anti-PD-1 and anti-GM-CSFscFv for neutralizing PD-1 and GM-CSF are constructed at the same time.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a chimeric antigen receptor comprising:

a) an antigen binding domain as a first signal,

b) A transmembrane domain,

c) An intracellular transduction domain as a second signal, and

d) a third signal domain that expresses IL-7 and CCL-17 cytokines.

The coded chimeric antigen receptor comprises an amino acid sequence shown in a sequence 2.

In a second aspect, the present invention also provides a recombinant plasmid having a nucleotide sequence as shown in sequence 1.

In a third aspect, the invention also provides a CAR-T cell capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.

The CAR-T cell according to the invention, which is transfected with a sequence expressing the aforementioned chimeric antigen receptor.

In a fourth aspect, the invention further provides a method of making a CAR-T cell, comprising the steps of:

(1) plasmid synthesis:

synthesizing CAR-19-1 plasmid by using vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, envelope signal of CD3 zeta, IL-7, CCL17 sequence, and has the nucleotide sequence of sequence 1;

synthesizing CAR-19-2 plasmid using vector pLVX-EF1a-IRES-PGK-puro, the plasmid is composed of CD19 single-chain variable region, CD8a hinge region, CD8a transmembrane region, 4-1BB signal, and the encapsidation signal sequence of CD3 zeta, and has the nucleotide sequence described in sequence 3;

synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid is composed of an anti-PD-1scFv single-chain variable region sequence and an anti-GM-CSF scFv single-chain variable region sequence and has a nucleotide sequence shown in a sequence 5;

(2) and (3) packaging the virus:

performing virus packaging by using an Invitrogen Lipofectamine 3000 transfection reagent, namely Lip3000, wherein a 293T culture medium is a DMEM-H culture medium added with 10% FBS, and a lentivirus packaging culture medium is an Opti-MEMI culture medium added with 1% GlutaMAX, 1mM sodium pyruvate and 5% FBS;

293T cells at 7X10⁶The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO₂Incubating the cells overnight under conditions until the 293T cell density reaches 95%;

the overnight incubated dishes were removed 6mL of lentivirus packaging medium per dish, 6mL of the liquid A-liquid B mixture was added to each dish, gently mixed to achieve uniform distribution, and placed at 37 ℃ in 5% CO₂Incubating under the condition for transfection; after 6 hours of transfection, the 293T culture medium is replaced for continuous incubation;

24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO₂Incubating under the condition for transfection;

collecting cell supernatant for the second time after 54 hours of transfection, and mixing the cell supernatant with the supernatant collected for the first time to obtain cell supernatant;

centrifuging the cell supernatant collected in the previous step at 2000rpm for 10 minutes at room temperature, removing cell debris precipitate, and filtering the supernatant with a 0.45 μm filter to obtain virus supernatant;

mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until a precipitate (off-white) is formed at the bottom of a centrifugal tube;

carefully removing the supernatant, adding a proper volume of DMEM to resuspend and precipitate to obtain a lentivirus concentrated solution, and measuring the virus titer of the lentivirus concentrated solution;

(3) t cell preparation:

add biotin-labeled CD8 antibody to an EP tube containing 1mL of whole blood and mix for 30 minutes at room temperature;

adding 150 μ L of microvesicle to the whole blood 1mL, mixing at room temperature for 20 minutes, binding microvesicle to antibody-labeled cells, and centrifuging;

gently transferring the white microbubble layer into another 2mL EP tube by using a 200 muL pipette gun, washing the microbubbles attached to the tube wall and the pipette head by using 500 muL microbubble buffer solution, merging the microbubbles into the EP tube, and incubating for 30min at room temperature; the microbubble buffer is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, 2mM EDTA;

breaking bubble with ultrasonic wave, centrifuging, collecting cell precipitate, and making into CD8 as T cell⁺T cells, which are flow cytometrically identified;

(4) t cell activation, transduction and expansion:

collecting CD8⁺T cells at 5x10⁵The individual cells/mL were seeded in 24/6 well plates and stimulated with activation medium for 24-48 hours, followed by viral transduction by addition of lentiviral concentrate (MOI =10) and transduction medium, and 24-48 hours later switched to maintenance medium; when expanded to 6-8 days, CAR-T cells were harvested.

According to the method, the liquid A-liquid B mixed liquid is obtained by uniformly mixing the liquid A and the liquid B and then incubating at room temperature for 15 min; preparing solution A: restoring the Opti-MEMI serum-reducing culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mixing 1.5ml of Opti-MEMI, 35 mu L of P3000Enhancer and 12 mu g of plasmid mixture to obtain solution B; wherein the plasmid ratio of the plasmid mixture is, PMD2.G: pSPAX2: CAR-19-1=1:3: 4.

The method according to the invention, wherein the activation Medium is X-VIVOTM15 Medium comprising 30ng/mL anti-CD3 and 20ng/mL CD 28; the transduction Medium was X-VIVOTM15 Medium containing 200U/mL IL-2 and 5 μ g/mL Polybrene; the maintenance Medium was X-VIVOTM15 Medium containing 200U/mL IL-2.

The method according to the present invention, wherein the microbubble buffer used in the preparation of the T cells is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, sodium tartrate 25mg/L, proline 120 mg/L. As described herein, it was surprisingly found that CD8 was present in T cells obtained after treatment with a microvesicle buffer comprising both sodium tartrate and proline⁺The proportion of T cells to total mononuclear cells after sorting was significantly higher than without the addition of both reagents.

The method of the present invention has the following steps as described in examples 1 to 4.

Various aspects of the present invention exhibit superior technical effects.

Detailed Description

The following examples, which are intended to be illustrative only and not limiting, and which are intended to be commercially available as reagents and materials with no specific description.

Some of the main experimental materials used in the present invention include: Endo-Free Plasmid Maxi Kit (Omega), NaCl, peptone, EDTA, NaoH, yeast powder (Shanghai Biotech Co., Ltd.), competent Stbl3 (gold Biotech Co., Ltd.), lip3000 transfection reagent (containing P3000 Enhancer), Opti-MEM serum-reduced medium, sodium pyruvate, DMEM-H, calcein AM (ThermoFisher), DiI cell membrane fluorescence probe (meilunbio), HIV-1P 24 protein rapid detection card, lentivirus titer (HIV P24) ELISA detection reagent (Orlon), Polybrene (syngeneic gene), biogeok TM virus concentration Kit (syngeneic gene), Millipore disposable needle head 0.45 μm (Millipore), 96, 24-well plate, 6-well plate, 10CM, T25 culture bottle, T75 culture bottle, 5, 10ml, Colipore pipette (Cozap-32 ml), VOX pipette (CORZA 15 ml), and pipette (Co. RTM. sub.), Ultra-LEAF Purified Anti-Mouse CD28, Ultra-LEAF Purified Anti-Mouse CD3 epsilon (Biolegend), IL-2(Peprotech), BD Pharmingen ™ Biotin Mouse Anti-Human CD8, PerCP-Cy @ 5.5 Mouse Anti-Human CD8(BD), lentiviral vectors (vast-Ling Bio), sequence synthesis (Universal organism), GM-CSF ELISA kit (Abcam). The remaining common reagents and materials are commercially available.

Example 1: construction of recombinant plasmids

1. CAR-19-1 plasmid Synthesis:

the CAR-19-1 sequence is composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal, a CD3 zeta envelope signal, IL-7 and a CCL17 sequence, the vector used is pLVX-EF1a-IRES-PGK-puro, and the vector is synthesized by the general biological system (Anhui) limited company.

The CAR-19-1 nucleotide sequence is as follows (which may be referred to as sequence 1 in the present invention):

ATGGCCCTGCCCGTGACCGCTCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCCGCTAGACCTGAGGTGAAGCTGCAGGAGTCCGGCCCTGGCCTGGTGGCTCCTTCCCAGTCCCTGAGCGTGACCTGTACAGTGTCCGGCGTGTCCCTGCCTGATTACGGCGTGTCCTGGATCAGGCAGCCTCCCAGAAAGGGCCTGGAGTGGCTGGGCGTGATCTGGGGCTCCGAGACAACCTACTACAATTCCGCCCTGAAGTCCAGGCTGACAATCATCAAGGACAATAGCAAGAGCCAGGTGTTTCTGAAGATGAACTCCCTGCAGACAGACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCTCCTACGCCATGGATTACTGGGGCCAGGGCACCAGCGTGACAGTGTCCTCCGGCGGCGGCGGAAGCGGAGGAGGAGGATCTGGCGGCGGCGGTTCCGATATCCAGATGACCCAGACAACAAGCAGCCTGTCCGCCTCCCTGGGCGACAGAGTGACCATCTCCTGCAGGGCCTCCCAGGACATCAGCAAGTACCTGAACTGGTACCAGCAGAAGCCCGATGGCACCGTGAAGCTGCTGATCTACCACACCTCCAGACTGCACTCCGGCGTGCCTTCCAGATTTTCCGGCTCCGGCAGCGGCACCGACTACAGCCTGACCATCAGCAACCTGGAGCAGGAGGACATCGCCACCTACTTTTGCCAGCAGGGCAATACCCTGCCTTACACCTTTGGCGGCGGCACAAAGCTGGAGATCACAAGGGCCGATGCCGCCCCCACAGTGAGCATCTTTCCCCCTAGCTCCAACGCCAAGCCCACAACAACCCCTGCCCCTAGACCCCCCACACCCGCTCCTACCATCGCCAGCCAGCCTCTGAGCCTGAGACCTGAGGCCTGTAGGCCCGCCGCCGGAGGAGCTGTTCACACAAGGGGCCTGGACTTTGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGTGGAGTTCTGCTGCTGAGCCTGGTCATTACCAAGAGGGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCTTTCATGAGACCCGTGCAGACAACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCTGAGGAGGAGGAGGGCGGCTGTGAGCTGAGGGTGAAGTTCTCCAGGAGCGCCGACGCCCCCGCCTACCAACAGGGACAGAATCAGCTGTACAATGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGGAGGGGCAGGGACCCTGAGATGGGCGGCAAGCCCCAGAGGAGGAAGAATCCCCAGGAGGGCCTGTACAATGAACTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGGAGGAGAGGCAAGGGCCACGATGGCCTGTACCAGGGCCTGTCCACCGCCACAAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCAAGAGGAAGCGGAGCCACCAATTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGACCTATGTTCCATGTTTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTGTTCTGTTGCCAGTAGCATCATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTGATTTTGATCTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCACTGGCCAGGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAAGAGTTTGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAACACGGCTCCGGCGAAGGCAGAGGCTCTTTACTGACTTGTGGAGACGTGGAAGAGAACCCCGGTCCCATGGCCCCACTGAAGATGCTGGCCCTGGTCACCCTCCTCCTGGGGGCTTCTCTGCAGCACATCCACGCAGCTCGAGGGACCAATGTGGGCCGGGAGTGCTGCCTGGAGTACTTCAAGGGAGCCATTCCCCTTAGAAAGCTGAAGACGTGGTACCAGACATCTGAGGACTGCTCCAGGGATGCCATCGTTTTTGTAACTGTGCAGGGCAGGGCCATCTGTTCGGACCCCAACAACAAGAGAGTGAAGAATGCAGTTAAATACCTGCAAAGCCTTGAGAGGTCT

the amino acid sequence of CAR-19-1 expression (which may be referred to as sequence 2 in the present invention):

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Pro Leu Lys Met Leu Ala Leu Val Thr Leu Leu Leu Gly Ala Ser Leu Gln His Ile His Ala Ala Arg Gly Thr Asn Val Gly Arg Glu Cys Cys Leu Glu Tyr Phe Lys Gly Ala Ile Pro Leu Arg Lys Leu Lys Thr Trp Tyr Gln Thr Ser Glu Asp Cys Ser Arg Asp Ala Ile Val Phe Val Thr Val Gln Gly Arg Ala Ile Cys Ser Asp Pro Asn Asn Lys Arg Val Lys Asn Ala Val Lys Tyr Leu Gln Ser Leu Glu Arg Ser

2. CAR-19-2 plasmid Synthesis:

the CAR-19-2 sequence is composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal and a CD3 zeta envelope signal sequence, the vector is pLVX-EF1a-IRES-PGK-puro, and the vector is synthesized by general biological systems (Anhui) Inc.

The CAR-19-2 nucleotide sequence is as follows (which may be referred to as sequence 3 in the present invention):

ATGGCCCTGCCCGTGACCGCTCTGCTGCTGCCACTGGCCCTGCTGCTGCACGCCGCTAGACCTGAGGTGAAGCTGCAGGAGTCCGGCCCTGGCCTGGTGGCTCCTTCCCAGTCCCTGAGCGTGACCTGTACAGTGTCCGGCGTGTCCCTGCCTGATTACGGCGTGTCCTGGATCAGGCAGCCTCCCAGAAAGGGCCTGGAGTGGCTGGGCGTGATCTGGGGCTCCGAGACAACCTACTACAATTCCGCCCTGAAGTCCAGGCTGACAATCATCAAGGACAATAGCAAGAGCCAGGTGTTTCTGAAGATGAACTCCCTGCAGACAGACGACACCGCCATCTACTACTGCGCCAAGCACTACTACTACGGCGGCTCCTACGCCATGGATTACTGGGGCCAGGGCACCAGCGTGACAGTGTCCTCCGGCGGCGGCGGAAGCGGAGGAGGAGGATCTGGCGGCGGCGGTTCCGATATCCAGATGACCCAGACAACAAGCAGCCTGTCCGCCTCCCTGGGCGACAGAGTGACCATCTCCTGCAGGGCCTCCCAGGACATCAGCAAGTACCTGAACTGGTACCAGCAGAAGCCCGATGGCACCGTGAAGCTGCTGATCTACCACACCTCCAGACTGCACTCCGGCGTGCCTTCCAGATTTTCCGGCTCCGGCAGCGGCACCGACTACAGCCTGACCATCAGCAACCTGGAGCAGGAGGACATCGCCACCTACTTTTGCCAGCAGGGCAATACCCTGCCTTACACCTTTGGCGGCGGCACAAAGCTGGAGATCACAAGGGCCGATGCCGCCCCCACAGTGAGCATCTTTCCCCCTAGCTCCAACGCCAAGCCCACAACAACCCCTGCCCCTAGACCCCCCACACCCGCTCCTACCATCGCCAGCCAGCCTCTGAGCCTGAGACCTGAGGCCTGTAGGCCCGCCGCCGGAGGAGCTGTTCACACAAGGGGCCTGGACTTTGCCTGCGACATCTACATCTGGGCCCCCCTGGCCGGCACCTGTGGAGTTCTGCTGCTGAGCCTGGTCATTACCAAGAGGGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCTTTCATGAGACCCGTGCAGACAACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCTGAGGAGGAGGAGGGCGGCTGTGAGCTGAGGGTGAAGTTCTCCAGGAGCGCCGACGCCCCCGCCTACCAACAGGGACAGAATCAGCTGTACAATGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGGAGGGGCAGGGACCCTGAGATGGGCGGCAAGCCCCAGAGGAGGAAGAATCCCCAGGAGGGCCTGTACAATGAACTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGGAGGAGAGGCAAGGGCCACGATGGCCTGTACCAGGGCCTGTCCACCGCCACAAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCAAGA

the amino acid sequence of CAR-19-2 expression is as follows (which may be referred to as sequence 4 in the present invention):

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

3. CAR-19-3 plasmid Synthesis:

the CAR-19-3 sequence is composed of an anti-PD-1scFv single-chain variable region and an anti-GM-CSF scFv single-chain variable region, the vector is pLVX-mCherry-C1, and the vector is synthesized by general biological systems (Anhui) Inc.

The CAR-19-3 nucleotide sequence is as follows (which may be referred to as sequence 5 in the present invention):

ATGGCCCTGCCTGTGACCGCCCTGCTGCTGCCACTGGCCCTGCTGCTCCACGCCGCTAGACCTCAGGTGCAGCTGGTGCAGTCCGGCGTGGAGGTGAAGAAGCCCGGCGCCTCCGTGAAGGTGTCCTGCAAGGCCTCCGGCTACACCTTTACAAATTACTACATGTACTGGGTGAGGCAGGCCCCCGGCCAGGGACTGGAATGGATGGGCGGCATCAATCCCTCCAATGGCGGCACAAACTTTAACGAGAAGTTTAAGAACAGGGTGACCCTGACCACCGATAGCTCCACCACAACAGCCTACATGGAGCTGAAGTCCCTGCAGTTCGATGATACCGCCGTGTACTACTGTGCCAGGAGGGACTACAGGTTTGATATGGGCTTCGATTACTGGGGCCAGGGCACCACCGTGACCGTGTCCTCCGGCGGAGGCGGAAGCGGAGGAGGAGGAAGCGGCGGAGGCGGTAGCGAGATCGTGCTGACACAGAGCCCTGCCACACTGTCCCTGTCCCCTGGCGAGAGAGCCACCCTGAGCTGCAGAGCCTCCAAGGGCGTGAGCACCTCCGGCTACAGCTACCTGCACTGGTACCAGCAGAAGCCCGGCCAGGCCCCCAGGCTGCTGATCTACCTGGCCTCCTACCTGGAGTCCGGCGTGCCCGCTAGATTCTCCGGCTCCGGCAGCGGCACCGATTTTACCCTGACAATCTCCAGCCTGGAGCCTGAGGACTTCGCCGTGTACTATTGTCAGCACTCCAGGGATCTGCCTCTGACCTTTGGCGGCGGCACCAAGGTGGAGATCAAGGGCTCCGGCGCCACAAACTTTAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCTGGCCCACAGGTGCAGCTCGTGCAGTCCGGAGCCGAGGTGAAGAAACCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCTTCACCGGCTACTACATGCACTGGGTGAGACAGGCCCCCGGACAGGGCCTGGAGTGGATGGGATGGATCAATCCTAACAGCGGCGGCACCAATTACGCCCAGAAGTTCCAGGGCAGGGTGACAATGACAAGGGATACCTCCATCAGCACCGCCTACATGGAACTGAGCAGGCTGAGAAGCGACGACACAGCCGTGTACTACTGCGTGAGAAGAGATAGGTTTCCCTACTACTTTGATTACTGGGGACAGGGCACCCTGGTGACCGTGAGCTCCGGCGGAGGAGGCTCCGGAGGAGGAGGTAGCGGCGGAGGAGGATCTGAGATCGTGCTCACCCAGTCCCCCGCCACCCTGTCCGTGTCCCCTGGAGAGAGGGCCACACTGAGCTGTAGAGCCTCCCAGAGCATCGGCTCCAATCTGGCCTGGTACCAGCAAAAGCCTGGCCAGGCCCCAAGGGTGCTGATCTACTCCACCTCCTCCAGGGCCACAGGCATCACAGATAGGTTTAGCGGCTCCGGCTCCGGAACCGATTTCACCCTGACCATCAGCAGACTGGAGCCCGAGGACTTCGCTGTGTACTACTGCCAGCAGTTTAATAGATCCCCCCTGACCTTCGGCGGCGGCACAAAGGTGGAGATTAAG

the amino acid sequence of CAR-19-3 expression is as follows (which may be referred to as sequence 6 in the present invention):

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Val Gln Ser Gly Val Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn Phe Asn Glu Lys Phe Lys Asn Arg Val Thr Leu Thr Thr Asp Ser Ser Thr Thr Thr Ala Tyr Met Glu Leu Lys Ser Leu Gln Phe Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Arg Asp Tyr Arg Phe Asp Met Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Lys Gly Val Ser Thr Ser Gly Tyr Ser Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Leu Ala Ser Tyr Leu Glu Ser Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Arg Asp Leu Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys Val Arg Arg Asp Arg Phe Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Gly Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Val Leu Ile Tyr Ser Thr Ser Ser Arg Ala Thr Gly Ile Thr Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

example 2: virus package

The virus packaging was performed using Invitrogen Lipofectamine 3000 transfection reagent (Lip3000), and the experimental procedures were essentially performed with reference to the transfection reagent instructions.

1. 293T Medium configuration

The culture medium was DMEM-H supplemented with 10% FBS. (DMEM-H was DMEM medium supplemented with 4.5g/L glucose and 110mg/L sodium pyruvate).

2. And (3) slow virus packaging culture medium preparation:

the medium was Opti-MEMI, supplemented with 1% GlutaMAX, sodium pyruvate (1mM), 5% FBS. (Opti-MEMI medium is Gibco product).

3. And (3) slow virus packaging:

A) 293T cells at 7X10⁶The density of each cell/well was inoculated into a 10cm dish containing 12mL of lentivirus packaging medium and placed at 37 ℃ in 5% CO₂Cells were incubated under conditions overnight.

B) And (3) performing transfection when the density of 293T cells reaches 95%, wherein the transfection method comprises the following steps:

preparing solution A: firstly, recovering an Opti-MEMI serum-reducing culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A for later use;

preparing liquid B: mixing 1.5ml of Opti-MEMI, 35 mu L of P3000Enhancer and 12 mu g of plasmid mixture to obtain solution B for later use; (in the case of the transduction type CAR-1= (CAR-19-1) + (CAR-19-3) the plasmid ratio of the plasmid mixture pmd2.g: pSPAX2 (CAR-19-1/CAR-19-3) =1:3 (4/3), in the case of the transduction type CAR-2= (CAR-19-2) + (CAR-19-3) the plasmid ratio of the plasmid mixture pmd2.g: pSPAX2 (CAR-19-2/CAR-19-3) =1:3 (3.5/3), in the case of the transduction type CAR-3= (CAR-19-2) the plasmid ratio of the plasmid mixture pmd2.g: pSPAX2: CAR-19-2=1:3: 3.5, in the case of the transduction type CAR-4= (CAR-19-1) the plasmid ratio of the plasmid mixture pmd2.g: pSPAX2: CAR-19-2=1:3: 3.5, and in the case of the transduction type CAR-4= (CAR-19-1) 3:4, PMD2.G, pSPAX2, pLVX-EF1a-IRES-PGK-puro and pLVX-mCherry-C1 are all products of vast Ling Bio-Co., Ltd.)

Transferring the solution A to the solution B, mixing well, and incubating at room temperature for 15min to obtain a solution A-solution B mixed solution;

step A) overnight incubated dishes were freed of 6mL of lentiviral packaging medium per dish, followed by addition of 6mL of liquid A-liquid B mixture to each dish, and lightMixing to make it uniformly distributed, placing at 37 deg.C and 5% CO₂Incubating under the condition for transfection; after 6 hours of transfection, 293T medium was replaced and incubation continued.

C) 24 hours after transfection, 12mL of cell supernatant was collected and 12mL of pre-warmed 293T medium was added and continued at 37 ℃ with 5% CO₂Transfection was performed by incubation under conditions.

D) Cell supernatants were collected a second time 54 hours after transfection and mixed with the first collected supernatant to obtain cell supernatants.

4. And (3) slow virus concentration:

A) the cell supernatant collected in the previous step was centrifuged at 2000rpm for 10 minutes at room temperature to remove cell debris precipitate, and the supernatant was filtered using a 0.45 μm filter to obtain a virus supernatant.

B) Mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, and standing at 4 ℃ for 2 h.

C) The incubated mixture was centrifuged at 4000g for 30min at 4 ℃ with an off-white precipitate at the bottom of the tube.

D) The supernatant was carefully removed and an appropriate volume of DMEM was added to resuspend the pellet as a lentivirus concentrate, (and as required for the experiment) and virus was aliquoted and the virus titer was determined and stored at-80 ℃.

The titer of the virus obtained in this example, as determined by the method of the present invention, was: 5.74x10⁶TU/ml。

5. Methods for virus titer testing:

the present invention can determine the virus titer as follows.

A) HT1080 cells were inoculated into a 96-well plate containing 100. mu.L of a culture medium at 7000 cells/well, and were cultured for 4 to 5 hours and then transduced, wherein the HT1080 cell culture medium was DMEM-H to which 10% FBS, 1% GlutaMAX, 10. mu.g/mL Polybrene, and 200nM sodium pyruvate were added.

B) Diluting virus liquid: 15mL of fresh medium was first mixed with 12. mu.L of 10mg/mL Polybrene reagent (final concentration 8. mu.g/mL) and vortexed to mix well as a dilution. Subsequently, for each virus sample, 135. mu.L of the medium prepared in the previous step, i.e., the dilution, was added to 16 wells of a 96-well round bottom plate in a 4-well x 4-well format. mu.L of concentrated lentivirus suspension was added to each well of the first row in a total volume of 150. mu.L, and the remaining three rows of cells were diluted sequentially at a ratio of 1: 10.

C) Transduction of cells: the medium in HT1080 cells was removed, 100 μ L of the prepared dilution was transferred to each corresponding well, the plates were centrifuged at 2000rpm for 30 minutes at room temperature, and the plates were incubated overnight.

D) The medium containing the virus supernatant was removed, replaced with fresh HT1080 medium (without Polybrene reagent), and the percentage of GFP positive cells was analyzed using flow cytometry after three days of incubation.

E) Titer (TU/mL) calculation formula (appropriate dilution factor determined from percentage of GFP positive cells) is as follows:

titer = (F × C/V) × D, where F = percentage of GFP positive cells, C = number of cells per well at the time of transduction, V = volume of bacterial fluid (mL), D = lentiviral dilution factor, and appropriate lentiviral dilution factor was selected for subsequent transduction experiments.

Example 3: t cell preparation

1. T cell preparation

A) To an EP tube containing 1mL of whole blood, an antibody (20. mu.L, CD8 biotin antibody, biotin-labeled CD8 antibody, product BD, cat. No. 555365) was added and mixed with a rotary suspension apparatus at room temperature for 30 minutes. Experimental whole blood was collected from 8 healthy male volunteers (age 26-33, weight 58-71 kg) and T cells were prepared.

B) To 1mL of the whole blood described above, 150. mu.L of microvesicles (streptavidin, streptavidin-labeled, ThermoGene product) was added, and the mixture was mixed with a rotary suspension apparatus at room temperature for 20 minutes to bind the microvesicles to the antibody-labeled cells.

C) Cells were centrifuged at 400 Xg for 5 minutes.

D) The white microbubble layer was gently transferred to another 2mL EP tube using a 200 μ L pipette. Microbubbles attached to the wall and tip of the tube were washed with 500 μ L of microbubble buffer, incorporated into the EP tube, and incubated at room temperature for 30 min. (the microbubble buffer is an aqueous solution containing potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin, and 2mM EDTA).

E) The target cells were recovered by breaking the bleb with 400W power ultrasound (2 times ultrasound for 1 second each).

F) Centrifuging at 1000rpm for 10min, collecting cell precipitate, and making into T cell.

2. Flow cytometry identification of CD8⁺T cells

A) Washing the sorted T cells with PBS, and diluting the T cells with PBS to a concentration of 1.2-1.4 x10⁶Individual cells/mL range.

B) 100 μ L of cell suspension was taken and 2 μ L of Anti-CD8 (PerCP-Cy 5.5 Mouse Anti-Human CD8) was added and mixed well.

C) Incubating for 20min at 4 ℃, washing with PBS, resuspending and precipitating with 200 mu L PBS, detecting on a machine, and identifying CD8⁺T cells.

The following example operations described in this paragraph are performed in addition. Example 3 a: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, sodium tartrate 25mg/L, proline 120mg/L, and identifying the obtained T cell CD8 by the same method⁺T cells. Example 3 b: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, and sodium tartrate 25mg/L, and identifying CD8 by the same method for the obtained T cells⁺T cells. Example 3 c: reference is made to "1, T cell preparation" of example 3, except that wherein the microbubble buffer used in step D) is an aqueous solution comprising: potassium chloride 200mg/L, potassium dihydrogen phosphate 200mg/L, sodium chloride 8000mg/L, disodium hydrogen phosphate heptahydrate 2160mg/L, 1% human serum albumin (HAS), 2mM EDTA, proline 120mg/L, and identifying CD8 by the same method for the obtained T cells⁺T cells. The results of the assay using the T cells prepared in example 3 and examples 3a to 3c described above from whole blood of 8 healthy male volunteers were as follows: is divided intoPre-selection CD8⁺Proportion (%) of T cells to peripheral blood mononuclear cells =6.38 ± 1.31, CD8 after sorting in example 3⁺Proportion (%) of T cells to total mononuclear cells after sorting =61.47 ± 9.24 ×, CD8 after sorting in example 3a⁺Proportion (%) of T cells to total mononuclear cells after sorting of 86.35 ± 10.51, example 3b CD8 after sorting⁺Proportion (%) of T cells to total mononuclear cells after sorting (= 58.84 ± 8.47 × example 3c CD8 after sorting⁺The proportion of T cells to total mononuclear cells after sorting (%) =63.73 ± 11.53, wherein is p compared to group p of example 3a<0.01. From this result, it can be seen that CD8 was present in T cells obtained after treatment with a microvesicle buffer containing both sodium tartrate and proline⁺The proportion of T cells to total mononuclear cells after sorting was significantly higher than without the addition of both reagents.

Example 4: t cell activation, transduction and expansion:

1. CAR-T cell preparation

Reference is made to the literature on Milone MC and Lamers CH (Milone MC, Fish JD, Carpento C, et al. Chimeric receivers relating CD137 signal transmissions domains with enhanced functionality of T cells and enhanced anti-inflammatory activityin vivo[J] Mol Ther, 2009, 17(8): 1453-64; lamers CH, van Steenbergen-Langeveld S, et al, T cell receiver-encoded T cells to linear detectors T cell processing time optimal T cell five. Hum Gene Ther methods 2014 Dec; 25(6), 345-57, doi, 10.1089/hgtb, 2014, 051). Briefly described as follows:

CD8 collected from example 3⁺T cells at 5x10⁵The cells/mL were inoculated in a 24-well plate, stimulated with an activation Medium (X-VIVOTM15 Medium containing 30ng/mL anti-CD3 and 20ng/mL CD28) for 24-48 hours, followed by addition of lentivirus concentrate (MOI =10) obtained in example 2 and a transduction Medium (X-VIVOTM15 Medium containing 200U/mL IL-2 and 5. mu.g/mL Polybrene) for virus transduction, and replaced with a maintenance Medium (X-VIVOTM15 Medium containing 200U/mL IL-2) 24-48 hours later; when expanded to 6-8 days, CAR-T cells were harvested.

CAR-T cell detection and subsequent killing experiments were also performed.

2. CAR-T cell transfection efficiency test:

CAR-19-1 and CAR-19-2 are fluorescence labeled with green color, CAR-19-3 is fluorescence labeled with red color, and transfection efficiency was measured by using FITC channel and PE channel of flow cytometer, and the results are shown in the following table.

Table: different kinds of CAR-T cell transduction efficiency

3. ELISA to verify whether CAR-T cells secrete anti-PD-1, GM-CSF, IL-7 and CCL-17:

A) keeping CAR-1, CAR-2, CAR-3, CAR-4 cells and culture supernatant in a sterile centrifuge tube (effective target ratio is 5:1), centrifuging at 4 deg.C for 10min at 1000 Xg, packaging the supernatant into small EP tubes, and storing at-20 deg.C (2-8 deg.C for 24 hr), avoiding repeated freeze thawing, adjusting cell precipitation (2-4) x10⁶cells used 1mL Trizol lysate per tube for 10min (4 ℃) and stored at-80 for use.

B) ELISA was performed to determine whether CAR-T cells secreted anti-PD-1, GM-CSF, IL-7 and CCL-17, following the Abcam's corresponding ELISA Kit instructions (anti-PD-1 detection now coated: a double-antibody sandwich ELISA method is used, an enzyme label plate is coated by using human PD-1 recombinant protein, a goat anti-human IgG (H & L) secondary antibody with an HRP label is used for detection, a commercial PD-1 antibody is used as a standard substance, and the expression quantity of the PD-1 antibody secreted by the T cell after gene modification is quantitatively detected after a sample to be detected is diluted by 5 times.

The method is briefly described as follows:

a) preparing a sample and a standard substance according to the instruction;

b) adding 50 muL of standard substance and sample into the pore plate;

c) adding 50 mu L of Antibody Cocktai to each well;

d) incubating at room temperature for 60 min;

e) washing three times by using 350 mu L1 xWash Buffer each time;

f) adding 100 mu L of TMB Development solution into each hole, and incubating for 10 min;

g) reading the OD value at 450 nm by using an enzyme-labeling instrument after adding 100 mu L Stop Solution into each hole;

h) the concentrations of anti-PD-1, GM-CSF, IL-7 and CCL-17 were calculated according to the specification, and the results are shown in the following table.

Table: the secretion amounts of anti-PD-1, GM-CSF, IL-7 and CCL-17 of different CAR-T cells

4. CAR-T cell killing experiment:

A) the human acute B lymphocyte leukemia cell line Raji is taken as a positive target cell, and effector cells are respectively as follows:

CAR-1=(CAR-19-1)+(CAR-19-3)；

CAR-2=(CAR-19-2)+(CAR-19-3)；

CAR-3=(CAR-19-2)；

CAR-4=(CAR-19-1)。

at 2x10⁴Inoculating the cells/mL of target cells (pre-stained with 1 μ M Calcein-AM) in a 96-well plate at a concentration of 100 μ L/well, adding each group of effector cells according to an effective target ratio (5:1), setting 3 multiple wells, incubating at 37 ℃ for 10 hours with 5% CO2, centrifuging (1000rpm/min, 5min), and detecting; and setting a maximum release hole, adding lysis solution (2.5% TritonX-100), adding PBS (phosphate buffer solution) into a spontaneous release hole, processing, and scanning and reading a fluorescence value by a microplate reader. Cytotoxicity was calculated for each group of effector cells according to the following disclosure:

percent specific lysis = (experimental fluorescence-spontaneous release fluorescence)/(maximum release fluorescence-spontaneous release fluorescence) x 100%.

The results are shown in the following table.

Table: different kinds of CAR-T cell killing efficiency (percentage of specific lysis)

According to the results, the 4 CAR-T cells prepared by the method disclosed by the invention have excellent cell killing effect, and the CAR-T cells prepared by the method disclosed by the invention can be used for treating tumors.

The present invention is illustrated in detail by the examples described above, but the present invention is not limited to the details described above, i.e., it is not intended that the present invention be implemented by relying on the details described above. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Oncology Boya Gene technology (Tianjin) Co., Ltd

<120> CAR-T cell and method for producing the same

<130> Y21039-XXC2112jq

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2451

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggccctgc ccgtgaccgc tctgctgctg ccactggccc tgctgctgca cgccgctaga 60

cctgaggtga agctgcagga gtccggccct ggcctggtgg ctccttccca gtccctgagc 120

gtgacctgta cagtgtccgg cgtgtccctg cctgattacg gcgtgtcctg gatcaggcag 180

cctcccagaa agggcctgga gtggctgggc gtgatctggg gctccgagac aacctactac 240

aattccgccc tgaagtccag gctgacaatc atcaaggaca atagcaagag ccaggtgttt 300

ctgaagatga actccctgca gacagacgac accgccatct actactgcgc caagcactac 360

tactacggcg gctcctacgc catggattac tggggccagg gcaccagcgt gacagtgtcc 420

tccggcggcg gcggaagcgg aggaggagga tctggcggcg gcggttccga tatccagatg 480

acccagacaa caagcagcct gtccgcctcc ctgggcgaca gagtgaccat ctcctgcagg 540

gcctcccagg acatcagcaa gtacctgaac tggtaccagc agaagcccga tggcaccgtg 600

aagctgctga tctaccacac ctccagactg cactccggcg tgccttccag attttccggc 660

tccggcagcg gcaccgacta cagcctgacc atcagcaacc tggagcagga ggacatcgcc 720

acctactttt gccagcaggg caataccctg ccttacacct ttggcggcgg cacaaagctg 780

gagatcacaa gggccgatgc cgcccccaca gtgagcatct ttccccctag ctccaacgcc 840

aagcccacaa caacccctgc ccctagaccc cccacacccg ctcctaccat cgccagccag 900

cctctgagcc tgagacctga ggcctgtagg cccgccgccg gaggagctgt tcacacaagg 960

ggcctggact ttgcctgcga catctacatc tgggcccccc tggccggcac ctgtggagtt 1020

ctgctgctga gcctggtcat taccaagagg ggcagaaaga agctgctgta catcttcaag 1080

cagcctttca tgagacccgt gcagacaacc caggaggagg acggctgcag ctgcagattc 1140

cctgaggagg aggagggcgg ctgtgagctg agggtgaagt tctccaggag cgccgacgcc 1200

cccgcctacc aacagggaca gaatcagctg tacaatgagc tgaacctggg cagaagagag 1260

gagtacgacg tgctggacaa gaggaggggc agggaccctg agatgggcgg caagccccag 1320

aggaggaaga atccccagga gggcctgtac aatgaactgc agaaggacaa gatggccgag 1380

gcctacagcg agatcggcat gaagggcgag aggaggagag gcaagggcca cgatggcctg 1440

taccagggcc tgtccaccgc cacaaaggac acctacgacg ccctgcacat gcaggccctg 1500

cccccaagag gaagcggagc caccaatttc agcctgctga agcaggccgg cgacgtggag 1560

gagaaccccg gacctatgtt ccatgtttct tttaggtata tctttggact tcctcccctg 1620

atccttgttc tgttgccagt agcatcatct gattgtgata ttgaaggtaa agatggcaaa 1680

caatatgaga gtgttctaat ggtcagcatc gatcaattat tggacagcat gaaagaaatt 1740

ggtagcaatt gcctgaataa tgaatttaac ttttttaaaa gacatatctg tgatgctaat 1800

aaggaaggta tgtttttatt ccgtgctgct cgcaagttga ggcaatttct taaaatgaat 1860

agcactggtg attttgatct ccacttatta aaagtttcag aaggcacaac aatactgttg 1920

aactgcactg gccaggttaa aggaagaaaa ccagctgccc tgggtgaagc ccaaccaaca 1980

aagagtttgg aagaaaataa atctttaaag gaacagaaaa aactgaatga cttgtgtttc 2040

ctaaagagac tattacaaga gataaaaact tgttggaata aaattttgat gggcactaaa 2100

gaacacggct ccggcgaagg cagaggctct ttactgactt gtggagacgt ggaagagaac 2160

cccggtccca tggccccact gaagatgctg gccctggtca ccctcctcct gggggcttct 2220

ctgcagcaca tccacgcagc tcgagggacc aatgtgggcc gggagtgctg cctggagtac 2280

ttcaagggag ccattcccct tagaaagctg aagacgtggt accagacatc tgaggactgc 2340

tccagggatg ccatcgtttt tgtaactgtg cagggcaggg ccatctgttc ggaccccaac 2400

aacaagagag tgaagaatgc agttaaatac ctgcaaagcc ttgagaggtc t 2451

<210> 2

<211> 817

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu

20 25 30

Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val

35 40 45

Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys

50 55 60

Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr

65 70 75 80

Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys

85 90 95

Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala

100 105 110

Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met

115 120 125

Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met

145 150 155 160

Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr

165 170 175

Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr

180 185 190

Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser

195 200 205

Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly

210 215 220

Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala

225 230 235 240

Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly

245 250 255

Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser

260 265 270

Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro

275 280 285

Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu

290 295 300

Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg

305 310 315 320

Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly

325 330 335

Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg

340 345 350

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

355 360 365

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

370 375 380

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

385 390 395 400

Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

405 410 415

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

420 425 430

Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly

435 440 445

Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu

450 455 460

Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu

465 470 475 480

Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His

485 490 495

Met Gln Ala Leu Pro Pro Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu

500 505 510

Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Phe His

515 520 525

Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile Leu Val Leu

530 535 540

Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys

545 550 555 560

Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser

565 570 575

Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe

580 585 590

Lys Arg His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg

595 600 605

Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp

610 615 620

Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu

625 630 635 640

Asn Cys Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu

645 650 655

Ala Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln

660 665 670

Lys Lys Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile

675 680 685

Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Gly Ser

690 695 700

Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn

705 710 715 720

Pro Gly Pro Met Ala Pro Leu Lys Met Leu Ala Leu Val Thr Leu Leu

725 730 735

Leu Gly Ala Ser Leu Gln His Ile His Ala Ala Arg Gly Thr Asn Val

740 745 750

Gly Arg Glu Cys Cys Leu Glu Tyr Phe Lys Gly Ala Ile Pro Leu Arg

755 760 765

Lys Leu Lys Thr Trp Tyr Gln Thr Ser Glu Asp Cys Ser Arg Asp Ala

770 775 780

Ile Val Phe Val Thr Val Gln Gly Arg Ala Ile Cys Ser Asp Pro Asn

785 790 795 800

Asn Lys Arg Val Lys Asn Ala Val Lys Tyr Leu Gln Ser Leu Glu Arg

805 810 815

Ser

<210> 3

<211> 1509

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggccctgc ccgtgaccgc tctgctgctg ccactggccc tgctgctgca cgccgctaga 60

cctgaggtga agctgcagga gtccggccct ggcctggtgg ctccttccca gtccctgagc 120

gtgacctgta cagtgtccgg cgtgtccctg cctgattacg gcgtgtcctg gatcaggcag 180

cctcccagaa agggcctgga gtggctgggc gtgatctggg gctccgagac aacctactac 240

aattccgccc tgaagtccag gctgacaatc atcaaggaca atagcaagag ccaggtgttt 300

ctgaagatga actccctgca gacagacgac accgccatct actactgcgc caagcactac 360

tactacggcg gctcctacgc catggattac tggggccagg gcaccagcgt gacagtgtcc 420

tccggcggcg gcggaagcgg aggaggagga tctggcggcg gcggttccga tatccagatg 480

acccagacaa caagcagcct gtccgcctcc ctgggcgaca gagtgaccat ctcctgcagg 540

gcctcccagg acatcagcaa gtacctgaac tggtaccagc agaagcccga tggcaccgtg 600

aagctgctga tctaccacac ctccagactg cactccggcg tgccttccag attttccggc 660

tccggcagcg gcaccgacta cagcctgacc atcagcaacc tggagcagga ggacatcgcc 720

acctactttt gccagcaggg caataccctg ccttacacct ttggcggcgg cacaaagctg 780

gagatcacaa gggccgatgc cgcccccaca gtgagcatct ttccccctag ctccaacgcc 840

aagcccacaa caacccctgc ccctagaccc cccacacccg ctcctaccat cgccagccag 900

cctctgagcc tgagacctga ggcctgtagg cccgccgccg gaggagctgt tcacacaagg 960

ggcctggact ttgcctgcga catctacatc tgggcccccc tggccggcac ctgtggagtt 1020

ctgctgctga gcctggtcat taccaagagg ggcagaaaga agctgctgta catcttcaag 1080

cagcctttca tgagacccgt gcagacaacc caggaggagg acggctgcag ctgcagattc 1140

cctgaggagg aggagggcgg ctgtgagctg agggtgaagt tctccaggag cgccgacgcc 1200

cccgcctacc aacagggaca gaatcagctg tacaatgagc tgaacctggg cagaagagag 1260

gagtacgacg tgctggacaa gaggaggggc agggaccctg agatgggcgg caagccccag 1320

aggaggaaga atccccagga gggcctgtac aatgaactgc agaaggacaa gatggccgag 1380

gcctacagcg agatcggcat gaagggcgag aggaggagag gcaagggcca cgatggcctg 1440

taccagggcc tgtccaccgc cacaaaggac acctacgacg ccctgcacat gcaggccctg 1500

cccccaaga 1509

<210> 4

<211> 503

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu

20 25 30

Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val

35 40 45

Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys

50 55 60

Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr

65 70 75 80

Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys

85 90 95

Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala

100 105 110

Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met

115 120 125

Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met

145 150 155 160

Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr

165 170 175

Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr

180 185 190

Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser

195 200 205

Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly

210 215 220

Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala

225 230 235 240

Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly

245 250 255

Gly Thr Lys Leu Glu Ile Thr Arg Ala Asp Ala Ala Pro Thr Val Ser

260 265 270

Ile Phe Pro Pro Ser Ser Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro

275 280 285

Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu

290 295 300

Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg

305 310 315 320

Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly

325 330 335

Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Lys Arg Gly Arg

340 345 350

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

355 360 365

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

370 375 380

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

385 390 395 400

Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

405 410 415

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

420 425 430

Pro Glu Met Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly

435 440 445

Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu

450 455 460

Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu

465 470 475 480

Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His

485 490 495

Met Gln Ala Leu Pro Pro Arg

500

<210> 5

<211> 1590

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atggccctgc ctgtgaccgc cctgctgctg ccactggccc tgctgctcca cgccgctaga 60

cctcaggtgc agctggtgca gtccggcgtg gaggtgaaga agcccggcgc ctccgtgaag 120

gtgtcctgca aggcctccgg ctacaccttt acaaattact acatgtactg ggtgaggcag 180

gcccccggcc agggactgga atggatgggc ggcatcaatc cctccaatgg cggcacaaac 240

tttaacgaga agtttaagaa cagggtgacc ctgaccaccg atagctccac cacaacagcc 300

tacatggagc tgaagtccct gcagttcgat gataccgccg tgtactactg tgccaggagg 360

gactacaggt ttgatatggg cttcgattac tggggccagg gcaccaccgt gaccgtgtcc 420

tccggcggag gcggaagcgg aggaggagga agcggcggag gcggtagcga gatcgtgctg 480

acacagagcc ctgccacact gtccctgtcc cctggcgaga gagccaccct gagctgcaga 540

gcctccaagg gcgtgagcac ctccggctac agctacctgc actggtacca gcagaagccc 600

ggccaggccc ccaggctgct gatctacctg gcctcctacc tggagtccgg cgtgcccgct 660

agattctccg gctccggcag cggcaccgat tttaccctga caatctccag cctggagcct 720

gaggacttcg ccgtgtacta ttgtcagcac tccagggatc tgcctctgac ctttggcggc 780

ggcaccaagg tggagatcaa gggctccggc gccacaaact ttagcctgct gaagcaggcc 840

ggcgacgtgg aggagaaccc tggcccacag gtgcagctcg tgcagtccgg agccgaggtg 900

aagaaacccg gcgccagcgt gaaggtgagc tgcaaggcca gcggctacac cttcaccggc 960

tactacatgc actgggtgag acaggccccc ggacagggcc tggagtggat gggatggatc 1020

aatcctaaca gcggcggcac caattacgcc cagaagttcc agggcagggt gacaatgaca 1080

agggatacct ccatcagcac cgcctacatg gaactgagca ggctgagaag cgacgacaca 1140

gccgtgtact actgcgtgag aagagatagg tttccctact actttgatta ctggggacag 1200

ggcaccctgg tgaccgtgag ctccggcgga ggaggctccg gaggaggagg tagcggcgga 1260

ggaggatctg agatcgtgct cacccagtcc cccgccaccc tgtccgtgtc ccctggagag 1320

agggccacac tgagctgtag agcctcccag agcatcggct ccaatctggc ctggtaccag 1380

caaaagcctg gccaggcccc aagggtgctg atctactcca cctcctccag ggccacaggc 1440

atcacagata ggtttagcgg ctccggctcc ggaaccgatt tcaccctgac catcagcaga 1500

ctggagcccg aggacttcgc tgtgtactac tgccagcagt ttaatagatc ccccctgacc 1560

ttcggcggcg gcacaaaggt ggagattaag 1590

<210> 6

<211> 530

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Val Gln Leu Val Gln Ser Gly Val Glu Val

20 25 30

Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr

35 40 45

Thr Phe Thr Asn Tyr Tyr Met Tyr Trp Val Arg Gln Ala Pro Gly Gln

50 55 60

Gly Leu Glu Trp Met Gly Gly Ile Asn Pro Ser Asn Gly Gly Thr Asn

65 70 75 80

Phe Asn Glu Lys Phe Lys Asn Arg Val Thr Leu Thr Thr Asp Ser Ser

85 90 95

Thr Thr Thr Ala Tyr Met Glu Leu Lys Ser Leu Gln Phe Asp Asp Thr

100 105 110

Ala Val Tyr Tyr Cys Ala Arg Arg Asp Tyr Arg Phe Asp Met Gly Phe

115 120 125

Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly

130 135 140

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu

145 150 155 160

Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr

165 170 175

Leu Ser Cys Arg Ala Ser Lys Gly Val Ser Thr Ser Gly Tyr Ser Tyr

180 185 190

Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

195 200 205

Tyr Leu Ala Ser Tyr Leu Glu Ser Gly Val Pro Ala Arg Phe Ser Gly

210 215 220

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

225 230 235 240

Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Arg Asp Leu Pro Leu

245 250 255

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Ser Gly Ala Thr

260 265 270

Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly

275 280 285

Pro Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly

290 295 300

Ala Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Gly

305 310 315 320

Tyr Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp

325 330 335

Met Gly Trp Ile Asn Pro Asn Ser Gly Gly Thr Asn Tyr Ala Gln Lys

340 345 350

Phe Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Ile Ser Thr Ala

355 360 365

Tyr Met Glu Leu Ser Arg Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr

370 375 380

Cys Val Arg Arg Asp Arg Phe Pro Tyr Tyr Phe Asp Tyr Trp Gly Gln

385 390 395 400

Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly

405 410 415

Gly Ser Gly Gly Gly Gly Ser Glu Ile Val Leu Thr Gln Ser Pro Ala

420 425 430

Thr Leu Ser Val Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala

435 440 445

Ser Gln Ser Ile Gly Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly

450 455 460

Gln Ala Pro Arg Val Leu Ile Tyr Ser Thr Ser Ser Arg Ala Thr Gly

465 470 475 480

Ile Thr Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu

485 490 495

Thr Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln

500 505 510

Gln Phe Asn Arg Ser Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu

515 520 525

Ile Lys

530

Claims

1. A chimeric antigen receptor comprising:

a) an antigen binding domain as a first signal,

b) A transmembrane domain,

c) An intracellular transduction domain as a second signal, and

d) a third signal domain that expresses IL-7 and CCL-17 cytokines.

2. The chimeric antigen receptor according to claim 1, which comprises the amino acid sequence shown in SEQ ID No. 2.

3. A recombinant plasmid having a nucleotide sequence shown in sequence No. 1.

4. A CAR-T cell, characterized in that it is capable of secreting an antibody expressing IL-7, CCL17 factor and/or PD-1, GM-CSF.

5. The CAR-T cell of claim 4, which is transfected with a sequence expressing the chimeric antigen receptor of claim 2.

6. A method for producing the CAR-T cell according to claim 4 or 5, characterized in that it comprises the following steps:

(1) plasmid synthesis:

synthesizing a CAR-19-1 plasmid by using a vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid has a nucleotide sequence shown in a sequence 1, and the plasmid sequence is composed of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal, an envelope signal of CD3 zeta, an IL-7 sequence and a CCL17 sequence;

synthesizing a CAR-19-2 plasmid with a nucleotide sequence shown in sequence 3 by using a vector pLVX-EF1a-IRES-PGK-puro, wherein the plasmid sequence consists of a CD19 single-chain variable region, a CD8a hinge region, a CD8a transmembrane region, a 4-1BB signal and an envelope signal sequence of CD3 zeta;

synthesizing a CAR-19-3 plasmid by using a vector pLVX-mCherry-C1, wherein the plasmid has a nucleotide sequence shown in a sequence 5, and the plasmid sequence is composed of an anti-PD-1scFv single-chain variable region sequence and an anti-GM-CSF scFv single-chain variable region sequence;

(2) and (3) packaging the virus:

mixing the virus supernatant and the concentrated reagent according to the volume ratio of 5:1, incubating for 2h at 4 ℃, and then centrifuging at 4 ℃ until an off-white precipitate is formed at the bottom of a centrifugal tube;

(3) t cell preparation:

(4) t cell activation, transduction and expansion:

collecting CD8⁺T cells at 5x10⁵Inoculating each cell/mL into a 24-well plate/6-well plate, stimulating for 24-48 hours by using an activation medium, then adding a slow virus concentrated solution with MOI =10 and a transduction medium for virus transduction, and changing to a maintenance medium after 24-48 hours; when expanded to 6-8 days, CAR-T cells were harvested.

7. The method of claim 6, wherein the solution A-solution B is prepared by mixing solution A and solution B, and incubating at room temperature for 15 min; preparing solution A: restoring the Opti-MEMI serum-reducing culture medium to room temperature, and uniformly mixing 1.5ml of Opti-MEMI and 41 mu L of Lip3000 in a 10cm dish to obtain solution A; preparing liquid B: mixing 1.5ml of Opti-MEMI, 35 mu L of P3000Enhancer and 12 mu g of plasmid mixture to obtain solution B; wherein the plasmid ratio of the plasmid mixture is, PMD2.G: pSPAX2: CAR-19-1=1:3: 4.

8. The method of claim 6, wherein: the microbubble buffer is an aqueous solution comprising: 200mg/L potassium chloride, 200mg/L potassium dihydrogen phosphate, 8000mg/L sodium chloride, 2160mg/L disodium hydrogen phosphate heptahydrate, 1% human serum albumin, 2mM EDTA, 25mg/L sodium tartrate and 120mg/L proline.

9. The method of claim 6, wherein the activation Medium is X-VIVOTM15 Medium comprising 30ng/mL anti-CD3 and 20ng/mL CD 28.

10. The method of claim 6, wherein the transduction Medium is X-VIVOTM15 Medium comprising 200U/mL IL-2 and 5 μ g/mL Polybrene; alternatively, the maintenance Medium is X-VIVOTM15 Medium containing 200U/mL IL-2.