CN113575330B - Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage - Google Patents
Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage Download PDFInfo
- Publication number
- CN113575330B CN113575330B CN202110836950.8A CN202110836950A CN113575330B CN 113575330 B CN113575330 B CN 113575330B CN 202110836950 A CN202110836950 A CN 202110836950A CN 113575330 B CN113575330 B CN 113575330B
- Authority
- CN
- China
- Prior art keywords
- potato
- seedling
- seedlings
- black spot
- investigation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G22/00—Cultivation of specific crops or plants not otherwise provided for
- A01G22/25—Root crops, e.g. potatoes, yams, beet or wasabi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Biodiversity & Conservation Biology (AREA)
- Ecology (AREA)
- Forests & Forestry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention belongs to the technical field of evaluation of plant disease prevention and control effects, and discloses a method for evaluating the influence of sweet potato black spot on potato seedlings in a seedling bed stage, which comprises the following steps: selecting the sweet potatoes which are non-invasive, non-diseased and uniform in size, and weighing to obtain the fresh weight of the sweet potatoes; setting a seedling pool, dividing the seedling pool into an independent investigation area and a conventional investigation area, and inoculating sweet potato black spot germs to the seedbed soil in an artificial inoculation mode; putting the sweet potatoes into seedling raising ponds flatly, covering the sweet potatoes with bed soil, carrying out independent irrigation management on each seedling raising pond, covering the seedlings with mulching films after irrigation, and removing the mulching films after seedling emergence; and (3) evaluating the influence of the sweet potato black spot on the potato seedlings in the seedling bed stage by taking the potato seedlings growing to 5-6 leaf stages as seedling formation standards, wherein the evaluation comprises three parts, namely seedling formation investigation, non-seedling formation investigation and black spot detection. The method solves the problem that the influence of the black spot on the sprouting and the immature seedlings of the potato blocks cannot be evaluated in the past.
Description
Technical Field
The invention belongs to the technical field of evaluation of plant disease prevention and control effects, and relates to a method for evaluating the influence of sweet potato black spot on potato seedlings in a seedbed stage.
Background
The black spot of sweet potato occurs in each sweet potato producing area in the world, and is one of the main diseases in sweet potato production in China. The yield loss of the sweet potatoes caused by the disease is 5 to 10 percent each year, and the loss caused by serious harm is 20 to 50 percent, even higher.
The whole growth period and storage period of the sweet potato can be infected with black spot. In the seedling stage, when the seed potato carries bacteria or the bed soil is polluted by the alternaria alternata, the occurrence of black spot in the bed stage can be caused, and dead seedlings and diseased potato seedlings are generated. Dead seedlings reduce the amount of emergence of the seedbed, thereby increasing the cost; the diseased seedlings become an important propagation way of black spot, the seedlings are continuously diseased during the selling, transporting and transporting processes of the potato seedlings, and the disease-free field can be polluted when the potato seedlings are transplanted into the field. The diseased seedling can also grow badly or die continuously after being transplanted to a field, so that the seedling lacks and breaks ridges. Along with frequent adjustment and transportation of seedlings in a region, the professional planting scale of a large planting household is enlarged, the potato seedlings in a seedbed stage are protected from being infected by black spot, and the production of healthy disease-free seedlings is more and more important.
The method for reducing the potato seedling infection comprises the steps of cultivating disease-resistant varieties, changing the seedling culture environment by adopting targeted management measures and treating seed potatoes or seedbeds by using bactericides. When measures for reducing the black spot of the potato seedlings in the seedbed stage are evaluated and screened, the most main evaluation indexes are the seedling yield and the incidence of the potato seedlings. However, the current investigation of the potato seedlings in the seedbed stage only remains to simply investigate the growth vigor and the morbidity of the potato seedlings on the ground or pull the potato seedlings out to investigate the morbidity. The method can not determine the seedling emergence condition of the potato blocks and the growth and disease occurrence condition of the potato seedlings before the emergence of the soil and the seedling formation; when the seedling number or the disease susceptibility varies among different varieties or among different prevention and control measures, it cannot be determined whether the seedling emergence amount of potato blocks varies among different varieties or the potato seedlings of each variety have the difference in disease resistance to black spot; it is not certain whether different control measures have an effect on the emergence of the potato pieces or cause differences in the growth vigor of the potato seedlings and cause differences in the susceptibility of the potato seedlings. The defects of the existing investigation method cause great interference to the evaluation of the disease resistance of disease-resistant varieties and the effect of prevention and control measures.
Disclosure of Invention
The invention aims to provide a method for evaluating the influence of the black spot of sweet potatoes on potato seedlings in a seedling bed stage, which can accurately evaluate the effectiveness of different prevention and control means and provide a basis for evaluating the diffusion risk of the black spot caused by the bacteria carried by the potato seedlings.
In order to achieve the purpose, the invention adopts the following technical scheme:
the invention provides a method for evaluating the influence of a medicament on the black spot of sweet potato seedlings in a sweet potato seedling bed stage, which comprises the following steps:
1) selecting the sweet potatoes which are non-invasive, non-diseased and uniform in size, and weighing to obtain the fresh weight of the sweet potatoes;
2) setting a seedling pool, dividing the seedling pool into an independent investigation area and a conventional investigation area, and inoculating sweet potato black spot germs to the seedbed soil in an artificial inoculation mode;
3) putting the sweet potatoes into seedling raising ponds flatly, covering the sweet potatoes with bed soil, carrying out independent irrigation management on each seedling raising pond, covering the seedlings with mulching films after irrigation, and removing the mulching films after seedling emergence;
4) evaluating the influence of the black spot of the sweet potatoes on the sweet potato seedlings in the seedling bed stage by taking the growth stage of the sweet potato seedlings to 5-6 leaves as a seedling standard, wherein the evaluation comprises three parts of seedling formation investigation, non-seedling formation investigation and black spot detection; the seedling investigation is to pull out potato seedlings in a conventional investigation area, count the number of the seedlings and the number of diseased seedlings and calculate the morbidity; the non-seedling investigation is to dig out all potato blocks in a single investigation area, clean the potato blocks, count the seedling number and the diseased seedling number of the potato blocks, and calculate the seedling rate, the diseased seedling rate and the potato seedling bacteria-carrying rate; and the black spot detection is to randomly sample the diseased potato seedlings and the non-diseased potato seedlings in a conventional investigation region and an independent investigation region and carry out PCR detection.
Further, the sweet potatoes in the step 1) are the same variety or different varieties of sweet potatoes.
Further, the inoculation amount of the sweet potato black spot pathogen is 1 multiplied by 104～5×105Spore/cm3。
Further, before the sweet potatoes are flatly placed in the seedling raising pool in the step 3), the sweet potatoes are placed in the liquid medicine to be soaked for 10 minutes.
Furthermore, the sampling part is an obvious part of an obvious potato seedling or sprout, and a white stem base part or sprout of an asymptomatic potato seedling.
Furthermore, the manifestation of the symptomatic potato seedlings is black or blackish brown spots appearing on the potato seedlings or on the sprouting parts, or the disease parts are overflowed, shrunk and wilted.
Further, the primer is selected from an upstream primer CFCPF 417: gttctctatcctacccatgat, respectively; the downstream primer CFCPR 417: gacgttgtcgacacggccagct is added.
Compared with the prior art, the invention has the beneficial effects that:
1. the method combines seedling investigation (conventional investigation area), non-seedling investigation (independent investigation area) and bacteria-carrying condition sampling detection for the first time, has the advantages that the three are all absent, the seedling emergence condition of the potato blocks and the process that the potato seedlings are damaged by the black spot from germination to seedling formation can be clearly reflected, the effectiveness of different prevention and control means can be accurately evaluated, and a basis is provided for evaluating the diffusion risk of the black spot caused by bacteria-carrying of the potato seedlings.
2. According to the method, the potato blocks are dug out for investigation by arranging the independent investigation area, so that the problem that the germination of the potato blocks and the influence of the black spot on the immature seedlings cannot be evaluated in the past is solved, the damage characteristics of the black spot in the seedbed stage can be determined, and a practical basis is provided for improving the prevention and control means of the diseases.
3. The investigation and sampling of the invention do not need special environmental conditions, can be carried out simultaneously with the actual production or independently, has low implementation threshold, is beneficial to carrying out tests under different conditions by combining the actual production, and carries out comprehensive effect evaluation on different prevention and control measures, thereby promoting the continuous improvement and improvement of the prevention and control measures.
Drawings
Fig. 1 is a diagram showing the arrangement of test cells in example 1.
FIG. 2 shows the appearance of the seedlings infected with black spot in example 2 after emergence.
FIG. 3 shows the expression of the entire piece of sweetpotato dug out after infection with black spot disease in example 2.
FIG. 4 shows the PCR results of example 2 for significant and non-significant potato seedlings or sprouts.
Detailed Description
The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified.
Example 1 investigation result of non-partition of nursery pond
1. Materials and methods
1.1 test materials
The sweet potato variety is commercial potato 19 virus-free seed potato, and the potato blocks with no wound, no disease and uniform size are selected for standby before the test. The agent may be diluted with a bactericide or other agent that is beneficial in reducing the occurrence of melasma. In the embodiment, the selected test agent is SY-01, the selected control agent is 500 g/L iprodione suspending agent and 70% thiophanate-methyl wettable powder, and the blank control is clear water.
1.2 seedbed settings
The seedbed is arranged in a plastic greenhouse, and is inoculated with the sweet potato black spot pathogen in an artificial inoculation mode, wherein the inoculation amount is 2.5 multiplied by 105Spores/cm3The setting of the seedling raising pond is shown in the test method.
2 test method
2.1 Process settings
The experimental cell set-up is shown in figure 1. The size of the seedling raising pool is 1m multiplied by 2m, and the small areas are separated by ridges. Each seedling raising pond shares 70 potato seeds. The total number of treatments is 6, the treatments are repeated for 3 times, and each time, the seeds are sowed separately. The drug treatment settings are shown in table 1.
TABLE 1 drug treatment settings
2.2 Potato Block treatment and seedling raising method
According to the processing settings of table 1, liquid medicine with corresponding concentration is prepared in the containers respectively, the seed potatoes are put into the liquid medicine to soak the potato blocks for 10 minutes, and are dried for standby. After being dried, the potato seeds are flatly placed into seedling raising ponds, the potato seeds are covered by seedbed soil, and each seedling raising pond is independently subjected to irrigation management. And (5) covering with a mulching film after irrigation, and removing the mulching film after seedling emergence.
2.3 investigation method
Weighing the seed potatoes before seeding to obtain the fresh weight of the seed potatoes, and taking the growth period of the potato seedlings to 5-6 leaves as the seedling standard. And (4) carrying out whole-cell seedling pulling investigation on the seedling raising pond for 4 times. Counting the number of seedlings and sick seedlings in each repetition.
2.4 calculation method
The disease seedling rate (%) < number of diseased seedlings x 100%/number of investigated seedlings;
control effect (%) (blank control area disease seedling rate-medicament treatment area disease seedling rate) × 100%/blank control area disease seedling rate;
the seedling yield (plant/kg) of the potato blocks is equal to the total number of the potato seedlings in the cell/the total weight of the potato blocks in the cell.
2.5 calculation results
The results of the examination are shown in Table 2.
TABLE 2 investigation results of the disease of potato seedlings and the conditions of potato block production in the seedling raising pond
| Treatment of | Number of emerged seedlings | Number of diseased seedlings | The morbidity of the potato seedlings is% | Total control effect% | Seed weight of potato | Seedlings of |
| 1 | 858 | 66 | 7.69 | -6.71cB | 13.6 | 63.11 |
| 2 | 1210 | 40 | 3.33 | 53.83abA | 13.3 | 90.87 |
| 3 | 1664 | 41 | 2.43 | 66.23aA | 13.1 | 126.92 |
| 4 | 970 | 38 | 3.87 | 46.35abAB | 12.3 | 78.70 |
| 5 | 874 | 38 | 4.29 | 40.46abAB | 13.4 | 65.35 |
| 6 | 982 | 71 | 7.21 | - | 12.6 | 77.76bB |
The control effect in table 2 shows that: the control effect of the SY-01500 times of treatment of the test medicament is 66.23 percent, the control effect of the SY-01750 times of treatment of the test medicament is 53.83 percent, and the difference between the two treatments is not obvious. The 500 times treatment control effect of 500 g/L iprodione suspending agent is 46.35 percent, and the 1400 times treatment control effect of 70 percent thiophanate-methyl wettable powder is 40.46 percent. The test medicament SY-011000 times of treatment has no obvious control effect. From the amount of emergence in table 2 it can be seen that: the amount of emergence of the test agent SY-01500 times treated kilogram is the largest, 126.92 plants/kilogram, and is obviously higher than that of other treatments. The emergence rates of the test medicaments SY-01750 times, 1000 times, 500 g/L iprodione suspending agent 500 times and 70% thiophanate-methyl wettable powder 1400 times are 90.87 strains/kg, 63.11 strains/kg, 78.70 strains/kg and 65.35 strains/kg respectively, and no obvious difference exists among the treatments. Tests show that the test agents SY-01500 times and 750 times of soaking potato blocks can obviously reduce the occurrence of black spot in the seedling stage of the sweet potatoes, and the emergence amount of kilogram of seed potatoes is obviously improved after 500 times of soaking potato blocks in liquid medicine.
Example 2 results of investigation of division of a nursery pond
1. Materials and methods
1.1 test materials
The sweet potato variety is a commercial potato 19 virus-free seed potato, and the potato blocks which are non-invasive, non-disease and uniform in size are selected for standby before the test. The test agent is SY-01, the contrast agent is 500 g/L iprodione suspending agent and 70% thiophanate-methyl wettable powder, and the blank contrast is clear water.
1.2 seedbed settings
The seedbed is arranged in a plastic greenhouse, and is inoculated with the sweet potato black spot pathogen in an artificial inoculation mode, wherein the inoculation amount is 2.5 multiplied by 105Spores/cm3The setting of the seedling raising pond is shown in the test method.
2 test method
2.1 treatment settings
The size of the seedling raising pond is set to be 1m multiplied by 1m, the seedling raising pond is divided into an individual investigation area (1m multiplied by 30cm) and a conventional investigation area (1m multiplied by 70cm), and the distance between the individual investigation area and the seed potatoes in the conventional investigation area is 5 cm. Totally setting 6 treatments, repeating for 3 times, independently setting a seedling raising pool for each repetition, and sharing 30 potato seeds in each seedling raising pool. The drug treatment settings are as in table 1.
2.2 Potato Block treatment and seedling raising method
According to the processing settings of the table 1, liquid medicines with corresponding concentrations are prepared in containers respectively, the seed potatoes are placed into the liquid medicines to soak the potato blocks for 10 minutes, and the seed potatoes are aired for standby. After being dried, the potato seeds are flatly placed into seedling raising ponds, the potato seeds are covered with seedbed soil, and each seedling raising pond is independently subjected to irrigation management. And (5) covering with a mulching film after irrigation, and removing the mulching film after seedling emergence.
2.3 investigation method
Weighing the seed potatoes before seeding to obtain the fresh weight of the seed potatoes, and taking the growth period of the potato seedlings to 5-6 leaves as the seedling standard.
And (4) carrying out seedling pulling survey on a conventional survey area for 4 times, and counting the seedling forming amount and the seedling ill amount of each repetition. During investigation of the 1 st time, investigation is simultaneously carried out to the investigation district alone, digs out whole potato piece, with potato piece sanitization back, makes statistics of the condition of emerging of every potato piece, including the bud on potato seedling and potato piece surface to investigate the morbidity condition of potato seedling and bud. The expression symptoms of potato seedlings infected with black spot disease after emergence are shown in figure 2, and the expression symptoms of whole sweet potatoes dug out after the infection of black spot disease are shown in figure 3. And sampling and detecting the overt potato seedlings and the non-overt potato seedlings in the independent investigation area at the same time of investigation, wherein the sampling mode is random sampling, and the sampling part is the overt part of the overt potato seedlings or the germination and the white stem base part or the germination of the non-overt potato seedlings. Not less than 5 samples are taken for each repeated symptomatic and asymptomatic sampling. The detection method is conventional PCR amplification (the primer is: upstream primer CFCPF 417: gttctctatcctacccatgat; downstream primer CFCPR 417: gacgttgtcgacacggcc)agct, 20 μ l reaction, denaturation at 94 ℃ for 30 seconds, annealing at 59 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, 36 cycles), the results are shown in fig. 4. M in fig. 4: DL 2000; 1: a1; 2: a3; 3: a4; 4: a5-1; 5: a6; 6: a7-1; 7: b; 8: c; 9: d1-1; 10: a5-3 is none; 11: a7-2 is none; 12: a7-3 is none; 13: a7-4 is none; 14: a8-3 is none; 15: a8-3 is none; 16: CK (CK)+；17：CK-。
2.4 calculation method
The average seedling emergence amount (plant/kg) of the potato blocks is the total seedling emergence amount of the potato blocks dug in the independent investigation region/the corresponding weight of the dug potato blocks;
the average seedling forming amount (plant/kg) of the potato blocks is the total seedling forming amount of multiple surveys in a conventional survey area/the corresponding weight of the potato blocks;
the seedling rate (%) (average seedling amount of potato blocks multiplied by 100%/average seedling amount of potato blocks);
the incidence rate (%) of the seedlings is multiplied by 100% of the total number of the seedlings which are surveyed for multiple times in a conventional survey area/the total number of the seedlings which are surveyed for multiple times;
the seedling bacteria-carrying rate (%) of the potato seedlings is the detected number/(number of symptomatic samples + number of asymptomatic samples) × 100%.
2.5 results of calculation
The results of the examination are shown in tables 3 to 7.
TABLE 3 questionnaire table for disease condition of potato seedlings in individual survey area
TABLE 4 questionnaire table for disease conditions of potato seedlings in conventional survey area
As can be seen from Table 3, the single investigation of the SY-01 drug in the area can effectively reduce the incidence of the black spot of the potato seedlings, the incidence rates of 500-fold, 750-fold and 1000-fold dilution of the SY-01 drug are respectively 35.98%, 37.35% and 40.46%, which are significantly lower than those of the control drug treatment and the clear water control treatment, and the corresponding control effects are respectively 46.44%, 44.39% and 39.76%. The incidence of thiophanate methyl and iprodione treatment was not significantly different from that of the clear water control. As can be seen from Table 4, the incidence rate of the black spot of the potato seedlings can be effectively reduced by the aid of the SY-01 medicine in a conventional investigation region, and the incidence rate of 500-time dilution of the SY-01 medicine is 36.49%, and is remarkably lower than that of a clear water control. The incidence of 750 times dilution of the formulation was also low at 45.18%. The prevention and treatment effects of the SY-01 medicament on the seedlings by 500-time dilution and 750-time treatment are respectively 39.76 percent and 25.43 percent. The thiophanate methyl 1400 times of the sweet potato blocks also have a certain control effect, and the effect is 12.15%. The investigation results of the comparison between the table 3 and the table 4 show that the agent SY-01 soaked potato blocks have certain prevention and treatment effects on the black spot infected by the potato seedlings in the seedling bed period. For 3 treatments of SY-01, the incidence of disease of the potato seedlings in the independent investigation area is lower than that of the potato seedlings investigated from seedling bed seedling pulling, which shows that the incidence of disease of the potato seedlings is increased in the process from potato block sprouting to unearthed seedling formation.
TABLE 5 questionnaire of emergence situation in individual survey area
TABLE 6 questionnaire of emergence conditions in general survey area
As can be seen from table 5, the number of seedlings of each kilogram of potato pieces treated by SY-01 diluted 1000 times, 750 times and 500 times in the individual investigation regions was 56.36, 55.79 and 56.38 respectively, the number of seedlings of each kilogram of potato pieces treated by iprodione diluted 1050 times and thiophanate-methyl diluted 1400 times was 52.40 and 51.10 respectively, and the number of seedlings of each kilogram of potato pieces treated by the blank control was 49.72, but the difference between the treatments was not significant. As can be seen from Table 5, the numbers of seedlings per kilogram of potato processed by SY-01 dilution 1000 times, 750 times and 500 times in the individual investigation regions are 33.55, 34.95 and 36.10 respectively, and the numbers of seedlings per kilogram of potato processed by the SY-01 dilution alone are not significantly different from each other in the three treatments, but are significantly higher than the numbers of seedlings per kilogram of potato processed by the control medicament and the clear water control. The result shows that the SY-01 medicament has obvious effect of soaking potato blocks to reduce the disease rate of potato seedlings under the condition that soil is infected with bacteria.
As can be seen from Table 6, the numbers of seedlings per kilogram of potato pieces and disease-free seedlings treated by SY-01 dilution 500 times in the conventional investigation region are 29.58 and 18.79 respectively, which are significantly higher than those of other treatments. The number of seedlings treated by SY-01 dilution 1000 times and SY-01 dilution 750 times is respectively 20.63 seedlings and 19.00 seedlings, and the number of disease-free seedlings is respectively 11.31 seedlings and 7.45 seedlings; the seedling number of 1400-fold diluted thiophanate methyl and blank control is 16.85 and 15.97 respectively, the seedling number of disease-free seedlings is 7.88 and 6.30 respectively, and the difference between the four treatments is not obvious. The treatment effect of 1050 times of iprodione dilution is poor.
Comparing table 5 and table 6, it can be seen that when the soil is infected with bacteria, there is no significant difference in seedling emergence of each treated potato piece, but as the potato seedling contacts the bacteria-bearing soil, part of the potato seedling is infected with the germ to infect black spot, and because of different control effects of different agent treatments, the difference in the number of disease-free seedlings emerging per kilogram of potato pieces treated with different agents is significant, and the number of disease-free seedlings emerging in the three treatments of SY-01 is significantly greater than that in the control agent treatment. By comparing the seedling emergence amount and the seedling formation amount of each kilogram of potato blocks, the SY-01 with the highest seedling formation rate is diluted by 500 times and is only 52.47%, and the seedling formation rate of other treatments is 23.95-36.98%. The disease-free seedling rate is the highest by 500 times of SY-01 dilution treatment, and is 33.33%, and the disease-free seedling rate of other treatments is 9.26-20.27%, and is further reduced compared with the seedling rate.
Combining table 5 and table 6, unlike SY-01, the incidence of the non-seedling investigation is high due to the treatment of thiophanate methyl and iprodione with poor control effect, and the incidence of the seedling investigation is low because a considerable number of infected potato seedlings cannot emerge smoothly after the disease develops and cannot be counted in the seedling investigation. As is clear from the above survey data: under the condition that soil carries bacteria, the potato seedlings are continuously infected by bacteria in the germination and unearthing processes and are the main reasons for disease occurrence and seedling reduction; the test agent SY-01 can not increase the seedling emergence of potato blocks, but has a more obvious inhibition effect on the black spot of potato seedlings.
TABLE 7 Potato seedlings with bacteria results of PCR detection
As can be seen from Table 7, the potato seedlings treated by 500 times dilution of the SY-01 preparation have the lowest bacteria carrying rate of 84.44%, which is significantly lower than that of the blank control treatment. The germ carrying rate of other treated potato seedlings is not obvious different from that of a blank control, the germ carrying rate of the potato seedlings of the blank control is the highest and is 95.56%, and the whole germ carrying rate of the potato seedlings is high under the condition that the seedbed soil carries germs.
In the sampling detection of the asymptomatic potato seedlings, the detection rate of 500-time dilution treatment of the SY-01 preparation is the lowest and is 66.67 percent, and is obviously lower than that of blank control treatment. The detection rate of the non-symptomatic potato seedlings treated by other treatments is not obvious different from that of the blank control, and the detection rate of the non-symptomatic potato seedlings of the blank control is the highest and is 90.48 percent. Investigation of the detection rate of the asymptomatic potato seedlings shows that under the condition that soil carries bacteria, the potato seedlings which do not show symptoms have higher bacteria carrying rate and risk of disease occurrence after seedling formation.
The same agent is used for soaking potato blocks, and compared with the result of simple seedling pulling investigation and the result of evaluating the effect of the method of the invention on soaking potato blocks in the agent in a normal seedling raising pool, the results show that the simple seedling pulling investigation clearly shows that the agents SY-01500 times and 750 times of soaking potato blocks can obviously reduce the black spot of potato seedlings, and the seedling amount of the agent SY-01500 times of soaking potato blocks is obviously higher than that of other treatments. By the investigation and evaluation method, the emergence condition of the potato blocks is further determined, the incidence conditions of the black spot in the emergence period and the seedling period are compared, the bacteria-carrying conditions of different potato seedlings are detected, the test medicament and the contrast medicament are determined to have no influence on the emergence of the potato blocks, and the reason that the potato seedlings are continuously infected by the black spot bacteria in the unearthing process and then partially fail to unearth or die after unearth is caused to reduce the seedling is revealed. And PCR detection results (figure 4) of symptomatic and asymptomatic potato seedlings are added, so that the conclusion that the emergence of seedlings cannot be influenced by soaking potato blocks with the medicament SY-01 is finally obtained, the main effects are that the infection and morbidity of the potato seedlings in the unearthing process are effectively reduced, the bacteria-carrying rate of the potato seedlings can be reduced, and important data support is provided for positioning the application of the test medicament in the prevention and control of the black spot of the sweet potatoes. And the investigation by using the conventional seedling pulling method cannot judge how the test medicament plays a role, is not beneficial to popularization of the medicament, and is not beneficial to further improving the comprehensive effect of preventing and controlling the black spot by the test medicament through the technologies such as medicament mixing and the like.
Example 3 investigation of emergence of seedlings and incidence of black spot of different species of sweet potatoes under the same inoculation conditions
1. Materials and methods
1.1 test materials
All varieties of potato blocks are required to be non-traumatic, non-diseased and uniform in size. The sweet potato varieties are commercial potato 19, Yu potato 12, Zheng hong 22, Yan potato 25 and Yu potato 10.
1.2 seedbed settings
The seedbed is arranged in a plastic greenhouse, and is inoculated with the sweet potato black spot germs in an artificial inoculation mode, wherein the inoculation amount is 2 multiplied by 105Spores/cm3The setting of the seedling raising pond is shown in the test method.
2 test method
2.1 Process settings
A1 m x 1m seedling raising pond is arranged and divided into an individual investigation area (1m x 30cm) and a conventional investigation area (1m x 70cm), and the distance between the individual investigation area and the seed potatoes in the conventional investigation area is 5 cm. Totally 5 treatments are arranged, 3 times of repetition are carried out, each repetition is independently provided with a seedling raising pool, and each seedling raising pool shares 30 potato seeds.
2.2 Potato Block treatment and seedling raising method
And (3) horizontally placing the seed potatoes into seedling ponds, covering the seed potatoes with seedbed soil, and independently irrigating and managing each seedling pond. And (5) covering with a mulching film after irrigation, and removing the mulching film after seedling emergence.
2.3 methods of investigation
Taking the stage of the potato seedlings growing to 5-6 leaves as a seedling standard, carrying out seedling pulling investigation in a conventional processing area for 4 times, and counting the number of seedlings which emerge and are diseased every time. During the 1 st investigation, investigate the investigation district alone simultaneously, dig out whole potato piece, after rinsing the potato piece clean, make statistics of the emergence condition of every potato piece, including the bud on potato seedling and potato piece surface to investigate the morbidity condition of potato seedling and bud. And (3) sampling and detecting the disease-showing potato seedlings while investigating, wherein the sampling mode is random sampling, and the sampling part is the disease-showing part of the disease-showing potato seedlings or sprouts.
2.4 calculation method
The disease incidence (%) of the potato seedlings is multiplied by 100% per number of the potato seedlings;
the potato seedling bacteria-carrying rate (%) -detected number/sampling number x 100%.
3. Test results
The results of the examination are shown in tables 8 to 9.
TABLE 8 questionnaire for disease condition of potato seedlings in individual investigation region
TABLE 9 survey table for disease condition of potato seedlings in conventional survey area
The research of digging out potato blocks shows that 5 varieties of sweet potatoes have certain difference in disease incidence under the same conditions (Table 8), the disease incidence rates of Zhenghong 22 and Yushu potato No. 10 are lower, respectively 53.41% and 53.68%, and are significantly lower than Yushu potato 12 (the disease incidence rate is 55.83%) and Shanshu potato 19 (55.76%). The incidence rate of the nicotiana tabacum 25 is 54.42%, and the incidence rate of the nicotiana tabacum is not obviously different from that of other varieties. The detection result of the symptomatic potato seedlings shows that the potato seedlings with the symptoms are infected by the sweet potato black spot germs, and no influence of other diseases on the test result is found.
As shown by the seedling pulling survey (Table 9), the morbidity of Zhenghong No. 22, Yangxu No. 25 and Yushu No. 10 is also lower, namely 39.54%, 40.09% and 40.31% respectively, and is obviously lower than that of the other two varieties. The incidence rates of Yushu 12 and Shanshu 19 are 42.82% and 45.22%, respectively.
Comparing the results of the surveys in tables 8 and 9, different surveys have different conclusions. The first expression is that the incidence of disease is higher in the potato seedling digging-out investigation than in the seedling bed seedling pulling investigation, and the disease is increased in the process of emergence of a part of the infected potato seedlings, and finally the infected potato seedlings cannot become seedlings. Secondly, the disease incidence rates of different varieties in the two tables have certain difference, and are estimated to be related to the variety characteristics of the different varieties. Therefore, in evaluating the resistance of sweet potato varieties to black spot, it is necessary to combine the seedling pulling investigation and the potato piece digging investigation for comprehensive evaluation.
The above-mentioned embodiments are merely preferred embodiments of the present invention, which are merely illustrative and not restrictive, and it should be understood that other embodiments may be easily made by those skilled in the art by replacing or changing the technical contents disclosed in the specification, and therefore, all changes and modifications that are made on the principle of the present invention should be included in the scope of the claims of the present invention.
Claims (6)
1. A method for evaluating the influence of sweet potato black spot on potato seedlings in a seedbed stage is characterized by comprising the following steps:
1) selecting the sweet potatoes which are non-invasive, non-diseased and uniform in size, and weighing to obtain the fresh weight of the sweet potatoes;
2) setting a seedling pool, dividing the seedling pool into an independent investigation area and a conventional investigation area, and inoculating sweet potato black spot germs to the seedbed soil in an artificial inoculation mode;
3) putting the sweet potatoes into seedling raising ponds flatly, covering the sweet potatoes with bed soil, carrying out independent irrigation management on each seedling raising pond, covering the seedlings with mulching films after irrigation, and removing the mulching films after seedling emergence;
4) evaluating the influence of the black spot of the sweet potatoes on the sweet potato seedlings in the seedling bed stage by taking the growth stage of the sweet potato seedlings to 5-6 leaves as a seedling standard, wherein the evaluation comprises three parts of seedling formation investigation, non-seedling formation investigation and black spot detection; the seedling investigation is to pull out potato seedlings in a conventional investigation area, count the seedling amount and the diseased seedling amount, and calculate the incidence rate and the average seedling amount of potato blocks; the black spot detection is to randomly sample the diseased potato seedlings and the non-diseased potato seedlings in the individual investigation region for PCR detection; the non-seedling investigation is to dig out all potato blocks in a single investigation area, clean the potato blocks, count the seedling emergence condition of each potato block, calculate the average seedling emergence amount, the seedling disease rate and the bacterial carrying rate of potato seedlings, and calculate the seedling rate of a conventional investigation area according to the average seedling formation amount of the potato blocks and the average seedling emergence amount of the potato blocks.
2. The method for evaluating the influence of the black spot of the sweet potatoes on the potato seedlings at the seedbed stage according to claim 1, wherein the sweet potatoes in the step 1) are the same variety or different varieties of sweet potatoes.
3. The method for evaluating the influence of the sweet potato black spot on the potato seedlings at the seedbed stage according to claim 1, wherein the inoculation amount of the sweet potato black spot pathogen in the step 2) is 1 x 104~5×105Spore/cm3。
4. The method for evaluating the influence of the black spot of the sweet potatoes on the potato seedlings in the seedbed stage according to claim 1, wherein the sweet potato blocks are soaked in the liquid medicine for 10 minutes before the sweet potatoes are flatly placed in the seedling raising pond in the step 3).
5. The method according to claim 1, wherein the potato seedlings with obvious symptoms show black or dark brown spots at various parts of the potato seedlings, or develop excessive or shriveled disease parts.
6. The method for evaluating the influence of the sweet potato black spot on the potato seedlings in the seedbed stage according to claim 1, wherein the primers in the PCR detection are selected from an upstream primer CFCPF 417: gttctctatcctacccatgat, respectively; downstream primer CFCPR 417: gacgttgtcgacacggccagct are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110836950.8A CN113575330B (en) | 2021-07-23 | 2021-07-23 | Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110836950.8A CN113575330B (en) | 2021-07-23 | 2021-07-23 | Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113575330A CN113575330A (en) | 2021-11-02 |
| CN113575330B true CN113575330B (en) | 2022-07-19 |
Family
ID=78249683
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110836950.8A Active CN113575330B (en) | 2021-07-23 | 2021-07-23 | Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113575330B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108375658A (en) * | 2018-03-26 | 2018-08-07 | 河南省农业科学院植物保护研究所 | Method of a set of evaluation fungicide to potato seedling growth black spot control effect |
-
2021
- 2021-07-23 CN CN202110836950.8A patent/CN113575330B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108375658A (en) * | 2018-03-26 | 2018-08-07 | 河南省农业科学院植物保护研究所 | Method of a set of evaluation fungicide to potato seedling growth black spot control effect |
Non-Patent Citations (5)
| Title |
|---|
| 5种悬浮种衣剂对红麻发芽率影响及对苗期立枯病的防控效果评价;王会芳等;《农药》;20180810(第08期);第599-602页 * |
| 抗病壮苗素在西瓜上的应用效果;王春生等;《安徽农业科学》;19980330(第01期);第67-69页 * |
| 杀菌剂包衣种子对番茄苗期2种病害的防治效果;程智慧等;《华中农业大学学报(自然科学版)》;20080815(第04期);第460-463页 * |
| 生物制剂HY01对黄瓜苗期病害防治及生长的影响;忻雅等;《湖北农业科学》;20180125(第02期);第61-63页 * |
| 种衣剂对葡萄杂交种子萌发及成苗的影响;马丽等;《中国果树》;20140110(第01期);第34-36页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113575330A (en) | 2021-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rai et al. | Positive growth responses of the medicinal plants Spilanthes calva and Withania somnifera to inoculation by Piriformospora indica in a field trial | |
| CN104067821A (en) | Preparation method of virus-free seedlings of sweet potato | |
| Khayamim et al. | Seed germination, plant establishment, and yield of sugar beet genotypes under salinity stress | |
| Chauhan et al. | Effect of rice establishment methods on weedy rice (Oryza sativa L.) infestation and grain yield of cultivated rice (O. sativa L.) in Sri Lanka | |
| CN106717306A (en) | Beauveria bassiana colonizes method and its application Maize at Seedling Stage | |
| CN106520908A (en) | Identification method for clubroot resistance of alpine radish at seedling stage | |
| CN105779565A (en) | Sesquipedalis germplasm rust disease resistance in-vitro identification method and rust fungus liquid used in method | |
| Iqbal et al. | Germination biology of sesbania (Sesbania cannabina): an emerging weed in the Australian cotton agro-environment | |
| CN104082006A (en) | High-yield and pollution-free peanut cultivation method | |
| CN103194421A (en) | Alternaria alternate spore suspension liquid and application thereof | |
| CN113575330B (en) | Method for evaluating influence of sweet potato black spot on potato seedlings in seedbed stage | |
| CN103898230B (en) | A kind of food-borne pathogenic microorganism infects the appraisal procedure of leafy vegetable | |
| CN104818222A (en) | Artificial inoculation method of alternaria alternata | |
| CN108056103B (en) | Glucosaccharide compound preparation and application thereof in potato disease prevention and control | |
| CN107142211B (en) | Trichoderma citrinoviride Snef1910 capable of killing root-knot nematodes, metabolite and application | |
| CN111801005A (en) | Endophytes from wild barley populations to increase crop yield | |
| CN111471620B (en) | Biocontrol bacterium BV03, application thereof, microbial inoculum and preparation method of microbial inoculum | |
| Gaurkhede et al. | Management of collar rot of chickpea by Pseudomonas fluorescens and identification of sources of resistance | |
| CN107216186A (en) | Production method and application process with disease-resistant growth-promoting functions functional biological organic fertilizer | |
| Kumar et al. | Prolific production of sclerotia in soil by Rhizoctonia solani anastomosis group (AG) 11 pathogenic on lupin | |
| CN111418431A (en) | Simple method for breeding hispid fig seeds | |
| CN106613287B (en) | Method for rapidly identifying aphid resistance of mung beans | |
| HANCI et al. | The effects of Trichoderma harzianum on germination of onion (Allium cepa L.) seeds under salt stress conditions | |
| CN117598203B (en) | Culture medium group for in-vitro regeneration culture of vaneless meconopsis and application and culture method thereof | |
| Fedoruk et al. | Analysis of potate quality: in vitro versus clonal propagation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |