CN113567658A

CN113567658A - Hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit and application thereof

Info

Publication number: CN113567658A
Application number: CN202110849307.9A
Authority: CN
Inventors: 金茂俊; 王源上; 王静; 邵华; 曹振; 王珊珊; 郑鹭飞; 佘永新; 金芬; 王淼
Original assignee: Institute of Agricultural Quality Standards and Testing Technology for Agro Products of CAAS
Current assignee: Institute of Agricultural Quality Standards and Testing Technology for Agro Products of CAAS
Priority date: 2021-07-27
Filing date: 2021-07-27
Publication date: 2021-10-29
Anticipated expiration: 2041-07-27
Also published as: CN113567658B

Abstract

The invention provides a hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit and application thereof, belonging to the technical field of pesticide residue detection. The detection kit comprises the following components: the kit comprises a black reaction plate coated with organophosphorus hapten-ovalbumin, gold nanoparticles modified with biological barcodes and organophosphorus antibodies, hairpin structure DNA H marked with fluorescent groups and quenching groups, dithiothreitol and organophosphorus standard solution. The invention combines biological bar code immunoassay with catalysis hairpin self-assembly technology to develop a simple, convenient, rapid, high-sensitivity and pesticide trace detection method, has important significance for meeting the requirements of rapid on-site detection of pesticides and food safety supervision, establishes a multi-residue biological bar code immunoassay method based on hairpin self-assembly aiming at three organophosphorus pesticides, namely triazophos, parathion and chlorpyrifos, and has higher sensitivity and accuracy.

Description

Hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit and application thereof

Technical Field

The invention belongs to the technical field of pesticide residue detection, and particularly relates to a hairpin self-assembly-based organic phosphorus pesticide multi-residue biological bar code immunoassay kit and application thereof.

Background

Organophosphorus pesticide is one of the most widely used pesticides in China, wherein parathion belongs to high-toxicity pesticides and is completely prohibited from being used in 2008, and triazophos and chlorpyrifos are also prohibited from being used in vegetables in 2016 successively, but illegal use still happens. The toxicity of organophosphorus pesticides and the food safety caused by the residues thereof are receiving more and more attention. Therefore, the development of a simple, convenient, rapid, high-sensitivity and pesticide trace detection method has great significance for meeting the requirements of rapid pesticide field detection and food safety supervision.

The traditional confirmation detection means are as follows: the gas chromatography-mass spectrometry (GC-MS/MS) technology, the liquid chromatography-mass spectrometry (LC-MS/MS) technology and the like require professional equipment and personnel, so that the sample pretreatment operation is complex, the detection period is long, the cost is high, and the requirement of rapid and efficient detection is difficult to meet.

With the rise of the subject fields of immunoassay, molecular biology, nano materials and the like, the immunoassay method has the advantages of rapidness, simplicity, convenience, no need of special technical personnel, low price cost and the like, and mainly comprises fluorescence immunoassay, enzyme-linked immunoassay, chemiluminescence immunoassay and biological barcode immunoassay. The bio-barcode immunoassay technology was first proposed by Chad Mirkind 03 and successfully applied to the detection of prostate specific antigen. In recent years, the bio-barcode technology has been developed and combined with various technologies to exhibit high sensitivity and high specificity in quantitative detection of proteins, nucleic acids, agricultural and veterinary drugs, biotoxins, and the like.

The nucleic acid isothermal amplification technology is used for amplifying signals of nucleic acids by different design modes based on the amplification capacity of the nucleic acids, and is a common technology for enhancing detection signals in the fields of biological detection, medical diagnosis and the like. Catalytic hybridization self-assembly technology (CHA) is taken as one of nucleic acid isothermal amplification technologies, is proposed on the basis of the Hybridization Chain Reaction (HCR) proposed by the Pierce task group in 2008, and is sequentially subjected to complementary hybridization with two hairpin structures under the activation of a target chain at constant temperature, so that the target chain plays a role of a catalyst in the whole reaction, can generate multiple signal amplification without an enzyme amplification effect, realizes efficient and rapid amplification reaction, has the advantages of simplicity, convenience, rapidness, high sensitivity, low cost and the like, and has certain potential in the aspects of medical diagnosis, environmental monitoring, food safety and the like.

However, there is no report on the application of catalytic hybridization self-assembly technology in pesticide detection. The existing pesticide residue confirmation and detection technologies are as follows: LC-MS, GC-MS and other technologies, but because the methods of chromatography and mass spectrometry need professional equipment and personnel, the pretreatment operation of samples is complex, the detection period is long, the cost is high, and the requirements of rapid and efficient detection are difficult to meet. Therefore, the development of a simple, convenient, rapid, high-sensitivity and pesticide trace detection method has great significance for meeting the requirements of rapid pesticide field detection and food safety supervision.

Disclosure of Invention

In view of the above, the invention aims to provide a hairpin self-assembly-based organophosphorus pesticide multi-residue biological barcode immunoassay kit and an application thereof, and the kit has high sensitivity and accuracy.

The invention provides a hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immune detection kit, which comprises the following components: the kit comprises a black reaction plate coated with organophosphorus hapten-ovalbumin, gold nanoparticles modified with biological barcodes and organophosphorus antibodies, hairpin structure DNA H marked with fluorescent groups and quenching groups, dithiothreitol and organophosphorus standard solution;

the nucleotide sequence of the biological bar code and the nucleotide sequence of the hairpin structure DNA H have complementary pairing sequences; the nucleotide sequence of the hairpin structure DNA H and the nucleotide sequence of the hairpin structure DNA H marked by the fluorescent group have complementary pairing sequences.

Preferably, the organophosphorus comprises one or more of the following substances: triazophos, parathion and chlorpyrifos.

Preferably, when the kit detects 2 or 3 organophosphorus at the same time, 2 or 3 sets of reagents are included;

in each set of reagent, the nucleotide sequence of the biological bar code in the gold nano-particle modified with the biological bar code and the organophosphorus antibody is shown as one of SEQ ID NO 1-SEQ ID NO 3, and the biological bar codes modified in 2 sets or 3 sets of reagent are different;

the fluorescent group in the hairpin structure DNA H marked with the fluorescent group and the quenching group is one of 6-FAM, Cy3 and Texas red, and the labeled fluorescent groups in the 2 sets or 3 sets of reagents are different.

Preferably, the gold nanoparticles modified with the biological barcodes and the organophosphorus antibodies are prepared by the following method, a gold nanoparticle solution and an organophosphorus antibody solution are mixed and labeled, the gold nanoparticles labeled with the antibodies are mixed with an activated biological barcode solution, 1 mass percent of PEG 20000 and 0.01mol/L of PBS (phosphate buffer solution) solution are sequentially added, standing and labeling are carried out, sealing is carried out, centrifugation is carried out, and precipitates are re-suspended to obtain the gold nanoparticles modified with the biological barcodes and the organophosphorus antibodies;

the volume ratio of the gold nanoparticle solution to the organic phosphorus antibody solution is 500 (3-6); the concentration of the organophosphorus antibody solution is 1.4-10.6 mg/mL;

the concentration of the gold nanoparticle solution is 9-10 nmol/L, and the pH value is 8.5-9;

the concentration of the activated biological barcode solution is 2.5-4.5 mu mol/L.

Preferably, when the organophosphorus is triazophos, the dilution multiple of the organophosphorus hapten-ovalbumin in the organophosphorus hapten-ovalbumin coated black reaction plate is 4000-8000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibody is 10-40;

when the organophosphorus is parathion, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibody is 10-40;

when the organophosphorus is chlorpyrifos, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000-8000; the dilution multiple of the gold nanoparticles modified with the biological bar codes and the organophosphorus antibodies is 10-20.

Preferably, the working concentration of the dithiothreitol is 10-14 mmol/L;

the solvent of the organophosphorus standard solution is 0.01mol/L PBS solution containing 4-8% methanol by volume percentage.

Preferably, the hairpin structure DNA H and/or the hairpin structure DNA H marked with a fluorescent group and a quenching group are/is dissolved by a catalytic hairpin reaction system buffer solution;

the buffer solution of the catalytic hairpin reaction system is a 35-45 mmol/L Tris-HCl solution containing 7-10 mmol/L magnesium ions and having a pH value of 8-10.

The invention provides an application of the hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immune detection kit in detection of organophosphorus pesticide multi-residue.

The invention provides a method for analyzing multiple residues of crop organophosphorus pesticides by using the hairpin self-assembly-based organophosphorus pesticide multiple-residue biological bar code immunoassay kit, which comprises the following steps:

1) adding a sample solution to be detected and a suspension of gold nanoparticles modified with a biological bar code and an organophosphorus antibody into a black reaction plate coated with organophosphorus hapten-ovalbumin, fully mixing, incubating, and washing the plate to obtain a washed ELISA plate;

2) and (3) adding dithiothreitol, the pretreated hairpin structure DNA H and the hairpin structure DNA H marked with a fluorescent group and a quenching group into the elisa plate for removing free organic phosphorus in sequence, measuring the fluorescence value of the elisa plate after oscillation reaction, and substituting the fluorescence value into a standard curve equation for detecting the organic phosphorus to calculate the content of the organic phosphorus pesticide in the crops.

Preferably, the volume ratio of the solution of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin to the sample solution to be detected, the suspension of the gold nanoparticles modified with the biological barcode and the organophosphorus antibody, dithiothreitol, the pretreated hairpin structure DNA H and the hairpin structure DNA H marked with the fluorescent group and the quenching group is 20: 20: 10: 20: 1: 3.

the invention provides a hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immune detection kit, which comprises the following components: the kit comprises a black reaction plate coated with organophosphorus hapten-ovalbumin, gold nanoparticles modified with biological barcodes and organophosphorus antibodies, hairpin structure DNA H marked with fluorescent groups and quenching groups, dithiothreitol and organophosphorus standard solution; the nucleotide sequence of the biological bar code and the nucleotide of hairpin structure DNA HSequences for which there is a complementary pairing of sequences; the nucleotide sequence of the hairpin structure DNA H and the nucleotide sequence of the hairpin structure DNA H marked by the fluorescent group have complementary pairing sequences. The invention establishes an organophosphorus pesticide immune competition reaction system by competitive combination of organophosphorus pesticide antigen coated on the inner wall of a reaction hole in a black reaction plate and pesticide molecules in a sample with an antibody modified by combining gold nanoparticles, then after unbound free substances are washed away, dithiothreitol, a hairpin structure H and a hairpin structure H for marking a fluorescent group and a quenching group are added on the reaction plate, the dithiothreitol dissociates a biological bar code for modifying the gold nanoparticles, which is combined on an antigen-antibody compound in the reaction hole, to release a biological bar code, the hairpin structure DNA H for marking the fluorescent group and the quenching group are hybridized and catalyzed and amplified, under the driving of free energy, the biological bar code is used as a target chain to initiate the hairpin structure DNA H to open and be complementary matched with the hairpin structure DNA H, and the hairpin structure DNA H for marking the fluorescent group and the quenching group is then hybridized and catalyzed and amplified with the biological bar code and the hairpin structure DNA And (3) complementarily pairing the intermediate products formed by H, replacing the biological bar codes, forming complementary paired chains in a stable linear double-chain structure, and sequentially and circularly performing catalytic hybridization reaction to amplify signals. Because the hairpin structure DNA H for marking the fluorescent group and the quenching group is marked with the fluorescent substrate, a stable linear double-chain structure is formed, so that the hairpin structure is opened to generate a fluorescent signal, and the pesticide residue can be quantitatively detected according to the detected fluorescent signal. The kit provided by the invention is a simple, convenient, rapid, high-sensitivity and pesticide trace detection kit, has important significance for meeting the requirements of rapid on-site detection of pesticides and food safety supervision, is suitable for single or mixed detection of various organophosphorus pesticides such as triazophos, parathion, chlorpyrifos and the like, and establishes a multi-residue biological bar code immunoassay method based on hairpin self-assembly. The experimental result shows that the LOD values (IC) of triazophos, parathion and chlorpyrifos are within the linear range of 0.01-50 ng/mL₁₀) Respectively 0.012ng/mL, 0.0057ng/mL and 0.0074ng/mL, and has higher sensitivity and accuracy.

Drawings

FIG. 1 is a schematic diagram of a CHA-based multi-residue bio-barcode immunoassay method for organophosphorus pesticides;

FIG. 2 is a diagram showing the ultraviolet spectra before and after the colloidal gold is labeled;

FIG. 3 is a result of a transmission electron microscope characterization chart before and after modification of gold nanoparticles with a biological barcode and an organophosphorus antibody;

FIG. 4 is a spectrum before and after modification of gold nanoparticles with a biological barcode and an organophosphorus antibody;

FIG. 5 shows the optimization results of different addition amounts of the colloidal gold-modified monoclonal antibody;

FIG. 6 shows the optimized results of different methanol contents in phosphate solution;

FIG. 7 shows the results of the optimization of dithiothreitol concentration;

FIG. 8 shows the results of concentration optimization of the buffer in the catalytic hairpin reaction system;

FIG. 9 shows Mg in buffer of catalytic hairpin reaction system²⁺Optimizing the concentration;

FIG. 10 shows the results of pH optimization in the buffer of the catalytic hairpin reaction system;

FIG. 11 shows the results of optimizing the ratio of the hairpin structure DNA H and the hairpin structure DNA H labeled with a fluorescent group and a quenching group;

FIG. 12 shows the result of optimizing the reaction time in the self-assembly process of the detection process;

FIG. 13 shows the results of the reaction temperature optimization;

FIG. 14 shows the optimization results of the amounts of colloidal gold probe antibodies for parathion and chlorpyrifos;

FIG. 15 shows the fluorescence intensity of three fluorophores and the results of cross-reaction.

Detailed Description

In the present invention, the organic phosphorus preferably comprises one or more of the following substances: triazophos, parathion and chlorpyrifos, including one, two or three.

In the present invention, the kit comprises gold nanoparticles modified with a biological barcode and an organophosphorus antibody. The gold nanoparticles modified with the biological bar codes and the organic phosphorus antibodies are prepared by the following method, mixing and marking a gold nanoparticle solution and an organic phosphorus antibody solution, then mixing the gold nanoparticles marked with the antibodies with an activated biological bar code solution, sequentially adding 1% by mass of PEG 20000 and 0.01mol/L of PBS solution at final concentration, standing and marking, sealing, centrifuging, and re-suspending precipitates. The volume ratio of the gold nanoparticle solution to the organic phosphorus antibody solution is preferably 500 (3-6). The concentration of the organophosphorus antibody solution is 1.4-10.6 mg/mL; the concentration of the gold nanoparticle solution is 9-10 nmol/L, and the pH value is adjusted to 8.5-9. The solution of gold nanoparticles is preferably filtered using a 0.22 μm filter membrane. When the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibodies are prepared by using different types of organic phosphorus antibodies, the addition volumes of the antibodies are different: the volume ratio of the gold nanoparticles modified by the biological barcodes to the triazophos antibody solution is 500: 6; the concentration of the triazophos antibody solution is 1.4 mg/mL. The volume ratio of the gold nanoparticles modified by the biological bar codes to the triazophos antibody solution is 500: 3; the concentration of parathion antibody was 7.57 mg/mL. The volume ratio of the gold nano particles modified by the biological bar codes to the triazophos antibody solution is 125: 1; the concentration of the chlorpyrifos antibody is 10.6 mg/mL. The gold nanoparticle solution modified with the biological bar code and the organophosphorus antibody prepared according to the proportion is purple red, which shows that the gold nanoparticles are not agglomerated and have higher fluorescence signals. The concentration of the biological bar code is preferably 2.5-4.5 mu mol/L, and more preferably 2.9-4.3 mu mol/L. The method for activating the biological barcode preferably comprises the steps of centrifuging the biological barcodes corresponding to the three pesticides at 4000rpm/min for 1min, dissolving the biological barcodes by using TE buffer solution, and adding 20mmol/L of TCEP solution to ensure that the volume ratio of TCEP to DNA is 200: and (1) oscillating for 2-3 h to obtain the activated biological bar code. The blocking is preferably carried out using a 1% BSA solution at the final concentration. The closing time is preferably 40-60 min. The rotation speed of the centrifugation is preferably 12000 rpm/min. The time for the centrifugation is preferably 15 min. The heavy suspension solvent is preferably a 0.01mol/L PBS solution containing 1% by mass of PEG 20000 and 1% by mass of BSA. The resuspension is preferably to 0.4 times the volume of the original gold nanoparticle solution.

In the present invention, the organic phosphorus preferably comprises one or more of the following substances: triazophos, parathion and chlorpyrifos. When the kit detects 2 or 3 organophosphorus at the same time, 2 or 3 sets of reagents are included. The nucleotide sequence of the biological bar code in the gold nano-particle modified with the biological bar code and the organic phosphorus antibody is shown as one of SEQ ID NO 1-SEQ ID NO 3, and the modified biological bar codes in 2 or 3 sets of reagents are different; according to different detection objects, the hairpin structure DNA H and the hairpin structure DNA H marked with the fluorescent group and the quenching group are adaptively adjusted according to different nucleotide sequences of the biological bar codes. In the embodiment of the invention, when detecting triazophos, the reagent corresponding to hairpin DNA H is named hairpin DNA H1(SEQ ID NO: 4); the reagent of hairpin structure DNA H labeled with a fluorophore and a quencher was named hairpin structure DNA H2 labeled with a fluorophore and a quencher (SEQ ID NO: 5); when parathion is detected, a reagent corresponding to hairpin structure DNA H is named as hairpin structure DNA H3(SEQ ID NO: 6); the reagent of hairpin structure DNA H labeled with a fluorescent group and a quenching group was named hairpin structure DNA H4 labeled with a fluorescent group and a quenching group (SEQ ID NO: 7); when detecting chlorpyrifos, a reagent corresponding to hairpin structure DNA H is named hairpin structure DNA H5(SEQ ID NO: 8); the reagent of hairpin structure DNA H labeled with a fluorescent group and a quenching group was named hairpin structure DNA H6 labeled with a fluorescent group and a quenching group (SEQ ID NO: 9). The volume ratio of the hairpin structure DNA H to the hairpin structure DNA H marked with the fluorescent group and the quenching group is preferably 1: 3-1: 4, and more preferably 1: 3. The working concentration of the hairpin structure DNA H is preferably 0.5 to 2.5. mu.M, and more preferably 2. mu.M. The working concentration of the hairpin structure DNA H marked with the fluorescent group and the quenching group is preferably 0.5-2.5. mu.M, and more preferably 2. mu.M. The fluorescent group in the hairpin structure DNA H labeled with the fluorescent group and the quenching group is preferably one of 6-FAM, Cy3 and Texas red, and the labeled fluorescent groups in the 2 sets or 3 sets of reagents are different. Experiments show that the three fluorescent groups have higher fluorescence intensity and smaller influence on fluorescence excitation/emission bands without interference when the excitation/emission wavelengths are 489/521nm, 532/568nm and 592/622nm respectively, can be modified on a hairpin structure DNA chain, and are used for multi-residue fluorescence measurement of organophosphorus pesticides.

In the invention, the detection kit comprises a black reaction plate coated with organophosphorus hapten-ovalbumin. The preparation method of the organophosphorus hapten-ovalbumin coated black reaction plate preferably comprises the following steps: and adding the coating solution of the organophosphorus hapten-ovalbumin into a reaction hole of a black reaction plate, standing overnight at 4 ℃, washing the plate, sealing, and washing the plate to obtain the black reaction plate coated with the organophosphorus hapten-ovalbumin. The addition amount of the coating solution of the organophosphorus hapten-ovalbumin is 100 mu L/hole. The black reaction plate is preferably a 96-hole black enzyme label plate. The solvent of the coating solution of the organophosphorus hapten-ovalbumin is 0.05mol/L carbonate buffer solution (CBS, pH 9.6). The preparation method of the organophosphorus hapten-ovalbumin comprises the steps of weighing organophosphorus hapten, dissolving the organophosphorus hapten in DMF (N, N-dimethylformamide), adding NHS (N-hydroxysuccinimide) into the mixed solution, and stirring and reacting for 15min at room temperature. DCC (N, N-dicyclohexylcarbodiimide) was added dropwise to the above reaction solution. After stirring and reacting for 4h at room temperature in the dark, the reaction mixture was centrifuged at 4000rpm/min for 15min, and the supernatant was collected and added dropwise to a carbonate buffer (0.01mol/L, pH 9.6) containing ovalbumin. Stirring for 4h, dialyzing the reaction solution in a dialysis bag, dialyzing with 0.01mol/L PBS for three days, mixing the organic phosphorus hapten-ovalbumin conjugate after dialysis, subpackaging, and storing at-20 ℃. When detecting different types of organic phosphorus, the organic phosphorus hapten is replaced by the corresponding type of organic phosphorus hapten. When the organophosphorus is triazophos, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000-8000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibodies is 10-40. When the organophosphorus is parathion, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibodies is 10-40. When the organophosphorus is chlorpyrifos, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000-8000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibody is 10-20.

In the present invention, the detection kit comprises dithiothreitol. The dithiothreitol is used to dissociate the bio-barcodes from the modified gold nanoparticles. The working concentration of the dithiothreitol is preferably 10-14 mmol/L, more preferably 11-13 mmol/L, and most preferably 12.5 mmol/L.

In the present invention, the solvent of the hairpin structure DNA H or the hairpin structure DNA H modified with the fluorescent group and the quenching group is preferably a catalytic hairpin reaction system buffer. The buffer solution of the catalytic hairpin reaction system is a 35-45 mmol/L Tris-HCl solution containing 7-10 mmol/L magnesium ions and having a pH value of 8-10.

In the invention, the detection kit comprises an organophosphorus standard solution. The solvent of the organophosphorus standard solution is preferably 0.01mol/L PBS solution containing 4-8% methanol by volume percentage. The concentration of methanol is preferably 5%. The organophosphorus standard solution is used for preparing an organophosphorus standard curve. The standard curve of the kit for detecting triazophos is as follows: 10.334x +29.773, R²0.974; kit detection pairThe standard curve for sulfur and phosphorus is as follows; 12.527x +38.145, R²0.975; the standard curve of the kit for detecting chlorpyrifos is as follows: 11.694x +34.94, R²0.966, wherein y represents fluorescence intensity and x represents concentration of the pesticide.

The invention provides an application of the hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immune detection kit in detection of organophosphorus pesticide multi-residue. The organophosphorus preferably comprises one or more of the following substances: triazophos, parathion and chlorpyrifos.

The invention provides a method for analyzing multiple residues of organophosphorus pesticide in crops by using the kit in the scheme, which is shown in figure 1 and comprises the following steps:

2) and (3) adding dithiothreitol, the pretreated hairpin structure DNA H and the hairpin structure DNA H marked with a fluorescent group and a quenching group into the washed ELISA plate in sequence, measuring the fluorescence value of the ELISA plate after oscillation reaction, substituting the fluorescence value into an organophosphorus detection standard curve equation, and calculating to obtain the content of the organophosphorus pesticide in the crops.

In the present invention, the thorough mixing is preferably carried out by gentle shaking on a micro-shaker, and the time for the thorough mixing is preferably 1 min. The temperature of the incubation is preferably 37 ℃ and the time of the incubation is preferably 1 h. The time of the shaking reaction is preferably 90min, and the temperature of the shaking reaction is preferably 37 ℃. The fluorescence value of the ELISA plate is determined according to three different fluorescent groups.

In the invention, the volume ratio of the solution of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin to the sample solution to be detected, the suspension of the gold nanoparticles modified with the biological barcode and the organophosphorus antibody, dithiothreitol, the pretreated hairpin structure DNA H and the hairpin structure DNA H marked with the fluorescent group and the quenching group is preferably 20: 20: 10: 20: 1: 3.

the analysis method developed by the invention has the characteristics of simplicity, rapidness, high sensitivity and trace pesticide detection, and has important significance for meeting the requirements of rapid field pesticide detection and food safety supervision, so that the hairpin self-assembly-based multi-residue biological bar code immunoassay method is established for three organophosphorus pesticides, namely triazophos, parathion and chlorpyrifos. Linear range of 0.01-50 ng/mL, LOD value (IC) of triazophos, parathion and chlorpyrifos₁₀) Respectively 0.012ng/mL, 0.0057ng/mL and 0.0074ng/mL, and has higher sensitivity and accuracy.

The present invention provides a hairpin self-assembly based organic phosphorus pesticide multi-residue biological bar code immunoassay kit and its application, which are described in detail below with reference to the following examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit

1) The preparation method of the black reaction plate coated with the organophosphorus hapten-ovalbumin comprises the following steps:

adding 100 mu L of triazophos, parathion and chlorpyrifos complete antigen (OVA coupling) which are diluted by a certain times and uniformly vibrated into each hole of a black enzyme label plate, respectively, coating overnight at 4 ℃, sealing for 1h at 37 ℃ by 300 mu L of 1% BSA after washing the plate, and washing the plate to obtain a black reaction plate coated with organophosphorus hapten-ovalbumin;

2) the preparation method of the gold nanoparticles modified with the biological bar codes and the organophosphorus antibodies comprises the following steps:

A. synthesis of colloidal gold

100mL of 1mmol/L HAuCl₄The aqueous solution was added to a round bottom flask, a condenser tube was attached and reflux was initiated. Heating to boiling under magnetic stirring, rapidly adding 10mL of newly prepared 38.8mmol/L trisodium citrate solution, gradually changing the color of the solution from yellow to black and deep red with stirring and heating, reacting for 15min, and standing at room temperatureNaturally cooling to room temperature, and storing at 4 ℃ for later use;

B. preparation method of colloidal gold probe

(1) Activation of the bio-barcode DNA strand: respectively centrifuging the biological barcodes corresponding to the three pesticides at 4000rpm/min for 1min according to a specification, dissolving the biological barcodes by using TE buffer solution, and adding TCEP (20mmol/L) solution to ensure that the ratio of TCEP to DNA is 200: 1, shaking for 2-3 h at room temperature;

the specific nucleotide sequences of the bio-barcodes corresponding to the three pesticides are as follows:

SEQ ID NO:1:-SH-(CH₂)₆-AAAAAAAAAACGACATCTAACCTAGCT CACTGAC；

SEQ ID NO:2：-SH-(CH₂)₆-AAAAAAAAAACTGATAAGCTA；

SEQ ID NO:3：-SH-(CH₂)₆-AAAAAAAAAAAATTACGATTA。

(2) labeling of the antibody: filtering the colloidal gold solution with a filter membrane with the aperture of 0.22 mu m, respectively taking a certain volume of the colloidal gold solution, and using 0.2mol/L K₂CO₃Adjusting the pH value to about 9.0. Adding a certain volume of triazophos monoclonal antibody, parathion monoclonal antibody and chlorpyrifos monoclonal antibody into the colloidal gold solution with the adjusted pH value, fully beating and uniformly mixing, and incubating for 1h at room temperature; the triazophos monoclonal antibody, the parathion monoclonal antibody, the chlorpyrifos monoclonal antibody and the antigen thereof are provided by pesticide and environmental toxicology subjects of Zhejiang university. The sources of the triazophos monoclonal antibody, parathion monoclonal antibody, chlorpyrifos monoclonal antibody and its antigen are reported in the prior art (1)]Zhang Xiuyuan biological bar code immune analysis method research for organophosphorus pesticide residue in agricultural products based on DNA/RNA hybridization [ D]Smoke desk university, 2020; [2]Zhang,Chan,Zejun Jiang,Maojun Jin,Pengfei Du,Ge Chen,Xueyan Cui, Yudan Zhang,Guoxin Qin,Feiyan Yan,A.M.Abd El-Aty,Ahmet

and Jing Wang.2020.'Fluorescence immunoassay for multiplex detection of organophosphate pesticides in agro-products based on signal amplification of gold nanoparticles and oligonucleotides',Food Chemistry,326:126813. [3]Chen,Ge,Guangyang Liu,Huiyan Jia,Xueyan Cui,Yuanshang Wang, Dongyang Li,Weijia Zheng,Yongxin She,Donghui Xu,Xiaodong Huang,A.M. Abd El-Aty,Jianchun Sun,Haijin Liu,Yuting Zou,Jing Wang,Maojun Jin,and Bruce D.Hammock.2021.'A sensitive bio-barcode immunoassay based on bimetallic Au@Pt nanozyme for detection of organophosphate pesticides in various agro-products',Food Chemistry,362:130118.)。

(3) Labeling of the bio-barcode: respectively adding the three activated biological barcodes into the corresponding mixed liquor, and fully and uniformly mixing; adding 30% PEG 20000 to a final concentration of 1%, mixing completely, and adding 0.1mol/L PBS to a final concentration of 0.01 mol/L; standing for 1 h;

(4) sealing and centrifuging: adding 10% BSA to the solution until the final concentration is 1%, continuously standing for more than 40min, centrifuging at 12000rpm/min for 15min, removing the supernatant, adding 400 mu L of probe resuspension into the obtained red precipitate, slightly blowing and beating the red precipitate by a pipette to enable the precipitate to be resuspended and uniformly mixed, and storing the gold nanoparticles which are simultaneously modified with the biological barcode and the organophosphorus monoclonal antibody at 4 ℃ for later use;

3) a hairpin structure DNA H, wherein when the triazophos is detected, a reagent corresponding to the hairpin structure DNA H is named as hairpin structure DNA H1(SEQ ID NO: 4); when parathion is detected, a reagent corresponding to hairpin structure DNA H is named as hairpin structure DNA H3(SEQ ID NO: 6); when detecting chlorpyrifos, a reagent corresponding to hairpin structure DNA H is named as hairpin structure DNA H5(SEQ ID NO: 8);

the specific nucleotide sequence of hairpin DNA H is as follows:

SEQ ID NO:4：GTCAGTGAGCTAGGTTAGATGTCGCCATGTGTAGAC GACATCTAACCTAGCCCTTGTCATAGAGCAC；

SEQ I D NO:6：TAGCTTATCAGCCATGTGTAGACTGATA

SEQ ID NO:8：TTATTGCTAATCCATGTGTAGAATTAGC。

4) the hairpin structure DNA H marked with a fluorescent group and a quenching group is named as hairpin structure DNA H2(SEQ ID NO:5) marked with the fluorescent group and the quenching group when detecting triazophos; when detecting parathion, the reagent of hairpin structure DNA H marked with fluorescent group and quenching group is named as hairpin structure DNA H4 marked with fluorescent group and quenching group (SEQ ID NO: 7); when detecting chlorpyrifos, the reagent of hairpin structure DNA H marked with fluorescent group and quenching group is named as hairpin structure DNA H6(SEQ ID NO:9) marked with fluorescent group and quenching group;

the specific nucleotide sequence of hairpin structure DNA H marked with fluorescent group and quenching group is as follows: 5, SEQ ID NO: AGATGTCG/i6FAMdT/CTACACATGGCGACATCTAAC CTAGCCCATGTGTAGA-BHQ-1;

SEQ ID NO:7：CAGTCA/iCy3dT/CACATGGCTGATACCATGTGTAGA -BHQ-1；

SEQ ID NO:9：AATTCA/iTexRddT/CACATGGATTAGCCCATGTGTAGA -BHQ-2。

5) dithiothreitol;

6) an organophosphorus standard solution; the standard solution comprises triazophos standard solution, parathion standard solution and chlorpyrifos standard solution; the solvent is PBS solution containing methanol; wherein the standard solution of parathion, chlorpyrifos and triazophos is purchased from Dr.Ehrentorfer company in Germany;

7) buffer solution containing Mg for catalysis hairpin reaction system²⁺Tris-HCl solution of (1).

Example 2

The method for detecting the residues of triazophos, parathion and chlorpyrifos pesticides by using the detection kit prepared in the embodiment 1 comprises the following steps:

1) indirect competitive immune response: adding 50 μ L of three pesticide mixed standard solutions or a sample to be tested and 50 μ L of three colloidal gold probe mixed solutions diluted by 10 times respectively, slightly oscillating on a micro-oscillator for 1min, and incubating at 37 ℃ for 1 h. In the process, pesticides to be detected in three pesticide standard products or samples compete with the coating antigen to bind to antibodies on corresponding colloidal gold probes respectively. By washing the plate, the three probes specifically bound to the bottom of the microplate are retained, and the remaining components are removed.

2) Catalyzing hairpin self-assembly reaction: mu.L of DTT with a certain concentration is added into each well, then 2 mu.M of hairpin structures H1, H3, H55 mu.L and H2, H4, H615 mu.L are added, after slight shaking for 2min, the reaction is carried out for 90min in a constant temperature and humidity box at 37 ℃. The DTT dissociates three ssDNAs on the surface of the colloidal gold through ligand exchange, and performs self-assembly reaction in sequence after being mutually complemented and opened with a hairpin probe solution under the catalytic action of target strand DNA, and displaces the target DNA strand to generate a stable linear double-stranded structure and release a fluorescent signal.

3) Signal detection: fluorescence values were measured at excitation/emission wavelengths of 489nm/521nm, 532nm/568nm, and 592nm/622nm (Infinite M200 PRO, TECAN, multifunctional enzyme calibrator). The higher the concentration of the pesticide to be detected in the standard solution or the sample is, the lower the detected fluorescence value is.

Example 3

The gold nanoparticles modified with the biological barcode and the organophosphorus antibody and the colloidal gold solution prepared in example 1 were subjected to ultraviolet scanning, transmission electron microscope characterization, and energy spectrum analysis.

As seen from FIG. 2, the ultraviolet scanning of the unlabeled colloidal gold solution shows that it has a maximum absorption peak at 520nm, the ultraviolet scanning of the colloidal gold composite probe labeled with the triazophos monoclonal antibody and the thiol DNA chain shows that it has a maximum absorption peak at 528nm, the maximum absorption wavelength of the modified colloidal gold probe is shifted from 520nm to 528nm, a red shift occurs, and the color changes from wine red to purple red. Indicating that the antibody, the biological bar code sulfhydryl DNA chain has been modified on the surface of the colloidal gold.

As can be seen from FIG. 3, the colloidal gold before and after modification had a particle size of 13nm, a uniform particle size and good dispersibility, and no aggregation of the colloidal gold occurred. The transmission electron microscope picture of the colloidal gold solution after labeling the antibody and the biological bar code sulfhydryl DNA chain shows that: as the surface of the colloidal gold particles is modified with the antibody and the biological bar code DNA chain, a layer of white aperture can be observed on the surface of the colloidal gold. The antibody contains protein P element, and the biological bar code sulfhydryl DNA chain contains S element.

FIG. 4 is EDS (EDS Spectroscopy) spectra of colloidal gold (left) and its composite probe before and after labeling, which can be observed that the labeled colloidal gold composite probe contains S, P two characteristic elements by scanning, and also proves that the antibody and the bio-barcode DNA chain have been successfully modified on the surface of the colloidal gold probe.

Example 4

Experiment for optimizing coating amount of antibody in gold nanoparticles modified with biological bar codes and organophosphorus antibodies

Because the antibody is modified on the surface of the colloidal gold, an electronic double layer can be formed to cover the surface of the colloidal gold probe, if the addition amount of the antibody is insufficient, the salt ions in the colloidal gold solution can destroy the electronic balance, and if the addition amount of the antibody is moderate or slightly excessive, the agglomeration of the colloidal gold composite probe can be avoided.

The optimum adding amount of the triazophos pesticide is determined by judging the triazophos pesticide through a colorimetric observation method and an ultraviolet spectrophotometry method. The system was tested specifically as in example 2.

To 1mL of colloidal gold, 30. mu.L of 0.2mol/L K was added₂CO₃Adjusting the pH value to 8.5-9.0, standing for 10-15 min, and adding the antibodies into the solution in the volume of 2 muL, 4 muL, 6 muL, 8 muL, 10 muL, 12 muL, 14 muL and 16 muL respectively. And (3) uniformly mixing, adding 100 mu L of 10% NaCl, standing for 1h, observing change, and scanning the maximum absorbance at 400-600 nm by using an enzyme-labeling instrument.

FIG. 5 shows that colloidal gold solution with 2-10 μ L of added antibody causes agglomeration of colloidal gold due to insufficient addition of antibody, and the solution is blue. Adding 12-16 mu L of colloidal gold solution into the mixture, and enabling the solution to be purple red without agglomeration. It was observed that just without discoloration, 12. mu.L of the antibody was added to stabilize the minimum antibody concentration of 1mL of the colloidal gold solution, the concentration of the triazophos pesticide monoclonal antibody was 1.4mg/mL, and the optimum amount of the antibody used in the actual experiment was 120% of the minimum antibody volume of the stabilized 1mL of the colloidal gold solution, so the amount of the protein used optimally was determined to be 20.16 mg.

Example 5

Optimization experiment of methanol concentration in solvent of organophosphorus standard solution

In order to optimize the content of methanol in the standard concentration buffer solution of the pesticide in the immunoreaction, 0.01mol/L PBS buffer solution with the concentration of 0%, 2.5%, 5%, 10%, 20% and 40% was prepared respectively, the concentration of the triazophos pesticide was 5ng/mL, and the fluorescence value after the reaction was measured according to the method of example 2.

As shown in FIG. 6, the fluorescence value measured was the highest in the case of 0.01mol/L PBS containing 5% methanol in the standard concentration buffer solution for agricultural chemicals, and gradually decreased with increasing methanol concentration, indicating that the reaction was accelerated by an appropriate amount of methanol and inhibited by an excess amount of methanol, so that 5% methanol was selected as the optimum concentration for addition of the standard buffer solution for agricultural chemicals.

Example 6

Concentration optimization experiment of Dithiothreitol (DTT)

Experiments investigated the effect of different concentrations of DTT on the extent of dissociation of DNA strands on the catalytic hairpin self-assembly reaction. Using triazophos as an example, the system was examined in the same manner as in example 2.

As shown in FIG. 7, the fluorescence value increases and levels off as the concentration of DTT increases, and the signal reaches the highest value when the concentration of DTT is 12.5mmol/L, so the optimal concentration of the detection probe in the present experiment is selected to be 12.5 mmol/L.

Example 7

Concentration, pH and Mg of buffer solution of catalytic hairpin reaction system²⁺Optimization experiment of content to verify the concentration, pH and Mg of the buffer solution in the catalytic hairpin reaction system²⁺Whether the factors such as content have certain influence on the catalytic hybridization reaction or not is determined, and in the case of the triazophos pesticide detection system, gradient parameters are set for the factors, and the fluorescence value of the system is detected according to the method in the example 2.

In this example, the hairpin working buffer concentrations of 10mmol/L, 20mmol/L, 30 mmol/L, 40mmol/L, 50mmol/L, and 60mmol/L Tris-HCl (pH 7.5) were selected for reaction and then measured, and as shown in FIG. 8, the fluorescence value increased first and then decreased with the increase in Tris-HCl (pH 7.5) concentration, and the fluorescence value was the highest with the concentration of Tris-HCl (pH 7.5) of 40mmol/L, so the hybridization reaction buffer system was selected to have the optimum concentration of 40 mmol/L.

After the optimum concentration is determined, hairpin working buffer solutions with pH values of 3.5, 4.5, 5.5, 6.5, 7.5, 8.5 and 9.5 and concentration of 40mmol/L Tris-HCl are prepared for reaction and then measurement, in FIG. 9, the fluorescence value rises firstly and then falls with the increase of Tris-HCl pH, and when Tris-HCl pH is 8.5, the fluorescence value is the highest, so the optimum pH value of the hybridization reaction buffer system is selected to be 8.5.

Mg²⁺As metal ions, the metal ions are important accessory factors in DNA catalytic hybridization reaction, and contain Mg for a hairpin working buffer solution²⁺Respectively 0mmol/L, 2mmol/L, 4mmol/L, 6mmol/L, 8mmol/L, 10mmol/L, and fluorescence measurement is performed, in FIG. 10, in Mg²⁺At a concentration of 8mmol/L, the fluorescence reaches a maximum, so Mg is selected²⁺The concentration was 8mmol/L to promote the reaction.

Example 8

Volume ratio optimization experiment of hairpin structures H1 and H2

The dosage of the hairpin structures H1 and H2 is used as a key factor of the method, and the dosage ratio of the hairpin structures H1 and H2 determines the saturation degree and the amplification efficiency of the reaction. In this example, the proportion of the added amounts of hairpin structures H1 and H2 (the concentrations of H1 and H2 are 2 μmol/L5 μ L and 2 μmol/L5 μ L, respectively) is optimized, and 7 hairpin structure addition proportions are set, which are 1: 1. 1: 2. 1: 3. 1: 4. 2: 1. 3: 1: 4: 1.

as shown in fig. 11, when the ratio of hairpin structures H1 and H2 is 1: and when 3, the fluorescence value is the highest, namely the reaction efficiency is the highest. Therefore, the method comprises the following steps of 1:3 as hairpin structures H1 and H2.

Example 9

Optimization experiment of reaction time of catalytic hairpin reaction system

By searching the reaction time of the target chain and the hairpin structures H1 and H2, the optimal detection fluorescence value is obtained. In the process of the catalysis hairpin self-assembly reaction, fluorescence values are respectively measured on a microplate reader in five time periods of 10min, 30min, 60min, 90min, 120min and the like.

As shown in FIG. 12, the fluorescence reached a maximum at 90min, so the reaction temperature was selected to be 90 min.

Example 10

Optimization experiment of reaction temperature of catalytic hairpin reaction system

The temperature factor has relevant influence on the stability of the DNA chain in the catalytic hybridization self-assembly reaction and the hybridization reaction, and the opening and the hybridization of the hairpin structure and the target chain are directly influenced by the temperature. If the temperature is low, spontaneous catalytic reaction of entropy free energy can be blocked, the reaction efficiency is influenced, and if the temperature is high, the stability of the reaction can be damaged, and the opened stem-loop structure is closed again. The optimal reaction temperature is obtained by searching the fluorescence values measured by the reaction temperature of the target strand with the hairpin structures H1 and H2.

Four reaction temperatures, i.e., 4 ℃, 24 ℃ (room temperature), 37 ℃, 48 ℃ and the like, are designed for carrying out catalytic reaction fluorescence measurement.

The results are shown in FIG. 13. With the increasing temperature, the fluorescence value rises first and then slightly falls, and at 37 ℃, the fluorescence reaches the maximum value. At an excessively low incubation temperature, the hairpin structure and the target chain cannot spontaneously and completely react with free energy, so that the efficiency is low and the fluorescence value is low; when the incubation temperature is too high, the stability of the hairpin structure and the target strand DNA strand is reduced, and the fluorescence value is reduced, so that the reaction temperature is selected to be 37 ℃ as the optimum reaction temperature.

Example 11

Optimization experiment for addition amount of antibodies of parathion and chlorpyrifos probes

The amount of antibodies added to the parathion and chlorpyrifos probes was optimized according to the method of example 3, specifically, 4. mu.L, 6. mu.L, 8. mu.L, 10. mu.L, and 12. mu.L of parathion antibody (7.57mg/mL) or chlorpyrifos antibody (10.6mg/mL) was added to the colloidal gold solution, and fluorescence measurement was performed.

The results are shown in FIG. 14, and the optimal antibody addition amounts for preparing parathion and chlorpyrifos colloidal gold probes are 6 μ L and 8 μ L through optimization.

Example 12

Experiment of mutual interference situation of hairpin structure DNA chain H2 modified with fluorophore 6-FAM, hairpin structure DNA H4 modified with Cy3 and hairpin structure DNA H6 modified with Texas red in the same system

The hairpin structure DNA chain H2 modified with the fluorophore 6-FAM, the hairpin structure DNA H4 modified with Cy3, and the hairpin structure DNA H6 modified with Texas red were dissolved in sterile water to 100. mu.M, and then diluted to working concentration using a catalytic hybridization buffer solution, wherein: five parallel experiments were performed for each group of hairpin structures for fluorescence determination. According to the measurement result shown in fig. 15, all three fluorescent substances can be excited to the maximum extent, the fluorescence values of 6-FAM, Cy3 and Texas red are gradually reduced, the distance range of excitation/emission wavelengths is moderate, and cross reactions such as mutual excitation interference and the like do not occur. Therefore, the three fluorophores of 6-FAM, Cy3 and Texas red selected in the experiment have higher fluorescence intensity and smaller influence of fluorescence excitation/emission bands at the excitation/emission wavelengths of 489/521nm, 532/568nm and 592/622nm, are not interfered, can be modified on a hairpin structure DNA chain, and are used for multi-residue fluorescence determination of organophosphorus pesticides.

Example 13

Standard curve drawing method for three organophosphorus pesticides

Diluting standard solutions of the three pesticides into a series of concentration gradients of 0.01-1000 ng/mL by using 0.01mol/L PBS buffer solution containing 5% methanol, and establishing an immunoassay method for the three organophosphorus pesticides, namely triazophos, parathion and chlorpyrifos, after optimizing various experimental conditions of a multi-residue reaction system. The results are shown in Table 1.

TABLE 1 Standard Curve of triazophos, parathion, Chlorpyrifos pesticides

Example 14

On the basis of the optimized conditions of the experiment, OVA-hapten of triazophos, parathion and chlorpyrifos is respectively diluted by 8000 times, 4000 times and 8000 times, three colloidal gold nanoprobes are respectively diluted by 10 times, and pesticides with the concentration of 5ng/mL are added for reaction.

Specific experiments were designed for three pesticides, eight combinations of experiments were performed for each pesticide, as shown in table 2: respectively, single OVA hapten-single AuNPs-single hairpin structure; a single OVA hapten-single AuNPs-mixed hairpin structure; single OVA hapten-mixed AuNPs-single hairpin structure; a single OVA hapten-mixed AuNPs-mixed hairpin structure; mixed OVA hapten-single AuNPs-single hairpin structure; mixed OVA hapten-single AuNPs-mixed hairpin structure; mixed OVA hapten-mixed AuNPs-single hairpin structure; the mixed OVA hapten-mixed AuNPs-mixed hairpin structure comprises 24 groups, examples 1-8 are the specificity optimization of triazophos in an immune competition system, experimental groups 9-16 are the specificity optimization of parathion in the immune competition system, and experimental groups 17-24 are the specificity optimization of chlorpyrifos in the immune competition system, and each group is subjected to 5 parallel experiments. See table 2 for details.

Table 224 set of Experimental settings

The experimental results show that: compared with three pesticides, the fluorescence detection values of eight experiments are almost consistent, the reaction fluorescence value of the triazophos pesticide floats from 3600 to 4000, the reaction fluorescence value of the parathion floats from 2000 to 2500, and the reaction fluorescence value of the chlorpyrifos floats from 1500 to 2000. The fluorescence value of the multi-residue immunoassay of the three pesticides is slightly higher than that of the single-residue immunoassay, slight cross reaction can occur, but the cross reaction rate is lower and is within an acceptable range. Demonstrating the feasibility of this experiment in immune competition and catalyzing hairpin reactions.

TABLE 3 optimization of OVA hapten and colloidal gold probe working concentrations

Example 15

In order to further verify the accuracy and precision of the established organophosphorus pesticide multi-residue biological bar code immunoassay method based on catalytic hairpin self-assembly, four representative matrixes of apple, cucumber, cabbage and rice are selected, three pesticide addition levels of 10 mu g/kg, 50 mu g/kg and 100 mu g/kg are added, contaminated fruit and vegetable grain samples are simulated, and the concentrations of triazophos and parathion pesticides in actual samples are determined, wherein: 5 parallel experiments are carried out for each added concentration of each type of sample so as to reduce the error of the experiment, and the method established by the experiment is compared with the detection result of LC-MS/MS.

Experimental samples required for the experiment: apples, cabbage, cucumbers and rice were purchased from Beijing local supermarket, and the experimental water was from laboratory tap water. The pretreatment method adopted in the experiment comprises the following steps:

adding tap water in a laboratory into triazophos pesticide standard solution prepared from methanol until the final concentration is 10 mug/kg, 50 mug/kg and 100 mug/kg, uniformly mixing, standing for more than 4h, and taking 1mL for machine detection by an LC-MS method. Another 100. mu.L of nitrogen was blown dry, redissolved to 2mL with 5% methanol-PBS, and tested by this method.

Pre-crushing apple, cabbage and cucumber samples, weighing 10g of crushed samples into a 50mL centrifuge tube, adding triazophos pesticide standard solution prepared by methanol into the centrifuge tube to a final concentration of 10 mug/kg, 50 mug/kg and 100 mug/kg for simulating the samples polluted by pesticides, standing for more than 4h, adding 10mL acetonitrile, shaking for extraction for 5min, adding 4g of anhydrous MgSO (MgSO) 4g₄And 1g NaCl, vortex for 5min, at 4 deg.C, 5000rpm, centrifugation for 5 min.

Taking 2mL of supernatant and transferring to 100mg of PSA and 100mgC₁₈The mixture was shaken for 5min in a 5mL centrifuge tube, and centrifuged for 5min at 4 ℃ and 5000 rpm. And filtering the supernatant by a membrane, collecting, and taking 1mL of the supernatant for machine detection by an LC-MS method. Another 100. mu.L of nitrogen was blown dry, redissolved to 2mL with 5% methanol-PBS, and tested by this method.

The results are shown in Table 4, and the adding recovery rate of 4 samples such as apple, cucumber, cabbage, rice and the like measured by the method is between 82.8 and 110.6 percent, and the CV value is between 5.5 and 18.5 percent. The recovery rate of the sample measured by LC-MS/MS is between 81.6 and 110.4 percent, and the CV value is 1.3 to 15.7 percent. The immune competition method is shown to have good detection precision and accuracy in agricultural products such as apples, cucumbers, cabbage, rice and the like, and have good applicability and relevance.

Table 4 recovery and coefficient of variation (n ═ 5) for bio-barcode immunoassay and LC-MS/MS instrumental method

TABLE 5 comparison between different immunoassay assays

Note: a lateral flow immunochromatography; b, bionic immunoassay; c, enzyme-linked immunoassay; d chemiluminescent enzyme immunoassay; e bio-barcode based immunoassay based on CHA.

As can be seen from the results in Table 5, the analysis method provided by the present application has significant advantages in terms of detection range, detection sensitivity and accuracy, compared with other detection methods.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of agricultural quality standards and testing technology of Chinese academy of agricultural sciences

<120> hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit and application thereof

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaaaaaaaaa cgacatctaa cctagctcac tgac 34

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaaaaaaaa ctgataagct a 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaaaaaaaaa aattacgatt a 21

<210> 4

<211> 67

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcagtgagc taggttagat gtcgccatgt gtagacgaca tctaacctag cccttgtcat 60

agagcac 67

<210> 5

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (9)..(9)

<223> n = dT modified with i6FAM

<400> 5

agatgtcgnc tacacatggc gacatctaac ctagcccatg tgtaga 46

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tagcttatca gccatgtgta gactgata 28

<210> 7

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (7)..(7)

<223> n = dT modified with iCy3

<400> 7

cagtcancac atggctgata ccatgtgtag a 31

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttattgctaa tccatgtgta gaattagc 28

<210> 9

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (7)..(7)

<223> n = dT modified with iTexRd

<400> 9

aattcancac atggattagc ccatgtgtag a 31

Claims

1. The hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit is characterized by comprising the following components: the kit comprises a black reaction plate coated with organophosphorus hapten-ovalbumin, gold nanoparticles modified with biological barcodes and organophosphorus antibodies, hairpin structure DNA H, hairpin structure DNAH marked with fluorescent groups and quenching groups, dithiothreitol and organophosphorus standard solution;

the nucleotide sequence of the biological bar code and the nucleotide sequence of the hairpin structure DNA H have complementary pairing sequence; the nucleotide sequence of the hairpin structure DNA H and the nucleotide sequence of the hairpin structure DNA H marked by the fluorescent group have complementary pairing sequences.

2. The hairpin self-assembly based organophosphorus pesticide multi-residue biological barcode immunoassay kit according to claim 1, wherein the organophosphorus comprises one or more of the following substances: triazophos, parathion and chlorpyrifos.

3. The hairpin self-assembly based organophosphorus pesticide multi-residue biological barcode immunoassay kit according to claim 2, wherein when the kit detects 2 or 3 organophosphorus simultaneously, the kit comprises 2 or 3 sets of reagents;

in each set of reagent, the nucleotide sequence of the biological bar code in the gold nano-particle modified with the biological bar code and the organophosphorus antibody is shown as one of SEQ ID NO 1-SEQ ID NO 3, and the modified biological bar codes in 2 sets or 3 sets of reagent are different;

the fluorescent group in the hairpin structure DNA H marked with the fluorescent group and the quenching group is one of 6-FAM, Cy3 and Texas red, and the fluorescent groups marked in 2 sets or 3 sets of reagents are different.

4. The hairpin self-assembly-based organophosphorus pesticide multi-residue biological barcode immunoassay kit according to claim 1 or 3, wherein the gold nanoparticles modified with the biological barcodes and organophosphorus antibodies are prepared by mixing and labeling a gold nanoparticle solution and an organophosphorus antibody solution, mixing the gold nanoparticles labeled with the antibodies with an activated biological barcode solution, sequentially adding 1% by mass of PEG 20000 and a final concentration of 0.01mol/LPBS solution, standing for labeling, sealing, centrifuging, and re-suspending precipitates;

5. The hairpin self-assembly based organophosphorus pesticide multi-residue biological bar code immunoassay kit according to claim 4, wherein when the organophosphorus is triazophos, the dilution multiple of organophosphorus hapten-ovalbumin in the organophosphorus hapten-ovalbumin-coated black reaction plate is 4000-8000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibody is 10-40;

when the organophosphorus is chlorpyrifos, the dilution multiple of the organophosphorus hapten-ovalbumin in the black reaction plate coated with the organophosphorus hapten-ovalbumin is 4000-8000; the dilution ratio of the gold nanoparticles modified with the biological bar codes and the organic phosphorus antibody is 10-20.

6. The hairpin self-assembly based organophosphorus pesticide multi-residue biological barcode immunoassay kit according to claim 1, wherein the working concentration of dithiothreitol is 10-14 mmol/L;

7. The hairpin self-assembly based organophosphorus pesticide multi-residue biological barcode immunoassay kit according to any one of claims 1 to 6, wherein the hairpin structure DNAH or the hairpin structure DNAH labeled with a fluorescent group and a quenching group is dissolved in a catalytic hairpin reaction system buffer solution;

8. The application of the hairpin self-assembly based organophosphorus pesticide multi-residue biological barcode immunoassay kit of any one of claims 1 to 7 in detection of organophosphorus pesticide multi-residue.

9. The method for analyzing the organophosphorus pesticide multi-residue by using the hairpin self-assembly-based organophosphorus pesticide multi-residue biological bar code immunoassay kit as claimed in any one of claims 1 to 7 is characterized by comprising the following steps:

10. The analysis method according to claim 9, wherein the volume ratio of the solution of organophosphorous hapten-ovalbumin in the black reaction plate coated with organophosphorous hapten-ovalbumin to the sample solution to be tested, the suspension of gold nanoparticles modified with biological barcodes and organophosphorous antibodies, dithiothreitol, the pretreated hairpin structure DNAH and the hairpin structure DNA H labeled with fluorescent groups and quenching groups is 20: 20: 10: 20: 1: 3.