CN113564142A - Burkholderia ester synthetase, coding gene and application thereof - Google Patents
Burkholderia ester synthetase, coding gene and application thereof Download PDFInfo
- Publication number
- CN113564142A CN113564142A CN202110635554.9A CN202110635554A CN113564142A CN 113564142 A CN113564142 A CN 113564142A CN 202110635554 A CN202110635554 A CN 202110635554A CN 113564142 A CN113564142 A CN 113564142A
- Authority
- CN
- China
- Prior art keywords
- burkholderia
- ethyl
- ester
- jfn94
- ester synthase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
- C12G3/00—Preparation of other alcoholic beverages
- C12G3/02—Preparation of other alcoholic beverages by fermentation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
Abstract
The invention discloses Burkholderia ester synthetase, a coding gene and application thereof, and particularly relates to Burkholderia anthina BJQ0011 source ester synthetase JFN94_03506 of bacterial and the catalytic synthesis of ethyl hexanoate and ethyl octanoate in an aqueous phase system by the gene thereof. Meanwhile, the application of the ester synthetase JFN94_03506 in the catalytic synthesis of ethyl caproate and ethyl caprylate serving as flavor substances of white spirit in an aqueous phase system is also disclosed. Therefore, the invention provides an enzyme and a coding gene for catalyzing and synthesizing ethyl caproate and ethyl caprylate in an aqueous phase system, and the enzyme and the coding gene have higher application values.
Description
Technical Field
The invention belongs to the technical field of biological genetic engineering, and particularly relates to Burkholderia ester synthetase, a coding gene and application thereof, and more particularly relates to Burkholderia anthina BJQ 0011-derived ester synthetase JFN94_03506 of bacterial and application of the gene thereof in catalytic synthesis of ethyl caproate and ethyl caprylate in an aqueous phase system.
Technical Field
The main substances of the Luzhou-flavor liquor are water and ethanol, and a small amount of flavor substances such as ester, acid, alcohol, aldehyde, ketone compounds and the like. Although the content of the flavor substances only accounts for 1 to 3 percent of the total amount of the wine body, the flavor substances determine the sense and the flavor of the product and are very important constituent substances in the white wine. Wherein, the ethyl caproate and the ethyl caprylate are important ester substances which determine the quality of the Luzhou-flavor liquor. However, since the main production process of the white spirit is a continuous traditional solid state fermentation process, the brewing system is complex, the scientific basis of the material conversion and flavor substance generation mechanisms in the brewing process is still unclear, so that the ester production fragrance in the brewing process is slow, namely the synthesis efficiency of the ethyl caproate, the ethyl caprylate and other esters is low, the production efficiency of the high-quality white spirit is reduced, and the development of the industry is restricted. Although the ester content can be improved by adding the chemical essence of ethyl caproate and the like in the blending process, sensory evaluation shows that the product has poor quality, and compared with the product produced by the traditional fermentation mode, the product has the characteristics of inconsistent fragrance, stronger irritation, lack of characteristics of 'harmonious fragrance, softness, cleanness and refreshing' of the brewed wine product, and obviously influences the product quality. The method researches the generation mechanism of important esters such as ethyl caproate and ethyl caprylate and has an important role in ensuring the product quality of the Luzhou-flavor liquor. The existing research shows that the main driving force of solid-state fermentation of the Luzhou-flavor liquor is metabolism of microorganisms, wherein ester synthetase produced by the microorganisms has significant contribution to synthesis of ethyl hexanoate and ethyl octanoate.
The solid fermentation brewing process of the white spirit has a plurality of microorganisms, and a complex and unique white spirit microorganism brewing area system is presented. Research shows that various microorganisms from white spirit can produce ester synthetase. However, only a part of species have been reported to have catalytic synthesis ability of esters, including Burkholderia of the genus Micromyces (Burkholderia sp.), Sphingomonas haemoglobosum (Sphingomonas sanguinis), and Mucor (Mucor sp.), Rhizopus (Rhizopus sp.), Rhizopus ramosus (lichtheima ramosa), Aspergillus (Aspergillus sp.) and Monascus ruber (Monascus sp.). However, due to the diversity of white spirit microorganisms and the complexity of material conversion in fermentation processes, little research has been focused on ester synthases from microbial sources for the catalytic synthesis of ethyl hexanoate and ethyl octanoate. Therefore, the Burkholderia is mined with the ester synthetase capable of catalyzing and synthesizing ethyl caproate and ethyl caprylate, which is beneficial to enriching the microbial ester synthesis functional enzyme resources of the white spirit, and the deep research of the related enzyme resources has important significance for ensuring the stable synthesis of key flavor esters in the white spirit.
Disclosure of Invention
The invention aims to provide Burkholderia ester synthase JFN94_03506 and application of genes thereof in catalytic synthesis of ethyl hexanoate and ethyl octanoate in an aqueous phase system.
The invention provides a Burkholderia ester synthetase, which is characterized in that: the amino acid sequence is shown as SEQ ID NO. 1.
Accordingly, the present invention provides the coding gene of the Burkholderia ester synthase. In a preferred mode, the nucleotide sequence is shown as SEQ ID NO. 2.
The Burkholderia ester synthetase is Burkholderia anthina BJQ0011 derived ester synthetase JFN94_03506, has the performance of catalytically synthesizing ethyl hexanoate and ethyl octanoate in an aqueous phase system environment for brewing white spirit, and the amino acid sequence of the ester synthetase JFN94_03506 is shown in SEQ ID No. 1. The specific nucleotide sequence is shown as SEQ ID NO. 2.
The invention also provides an expression vector containing the encoding gene of the Burkholderia ester synthase. Preferably, the gene encoding the Burkholderia ester synthase is operably linked to a promoter.
Furthermore, the invention also provides a host cell of the expression vector. In particular E.coli cells.
Furthermore, the invention provides the application of the Burkholderia ester synthetase in preparing ethyl hexanoate and/or ethyl octanoate.
In one embodiment, the ethyl caproate or ethyl caprylate is produced by using caproic acid and ethanol as catalytic substrates or caprylic acid and ethanol as catalytic substrates in an aqueous phase system through reaction. Preferably, the Burkholderia ester synthase is obtained by a gene working method. More specifically, the construction method of the expression engineering strain comprises the following steps: total DNA of Burkholderia was extracted, primers were designed to amplify the gene, and the gene was integrated into the pET-28a (+) expression vector using the integrase ClonExpress. After sequencing verification, the plasmid is transformed into Escherichia coli Rosetta (DE3) by a chemical transformation method, and the Escherichia coli cell carrying ester synthetase JFN94_03506 is obtained by IPTG induced expression. Crushing cells to obtain a crude enzyme solution, catalyzing substrates of hexanoic acid and ethanol or octanoic acid and ethanol in an aqueous phase system to generate corresponding ester, and detecting products of ethyl hexanoate and ethyl octanoate through gas chromatography.
The ester synthetase JFN94_03506 can be obtained by induced expression of escherichia coli engineering bacteria and is used for catalytically synthesizing ethyl hexanoate and ethyl octanoate in a water phase system.
The experiment proves that: the crude enzyme preparation of the ester synthetase JFN94_03506 induced and expressed by Escherichia coli engineering bacteria can be used for catalytically synthesizing ethyl hexanoate and ethyl octanoate in an aqueous phase system containing 1M ethanol and 0.01M hexanoic acid or octanoic acid, and the yield is 14.2mg/L and 25.1mg/L respectively.
Therefore, the invention utilizes the biological genetic engineering technology, clones and induces the expression to obtain Burkholderia anthina BJQ0011 source ester synthetase JFN94_03506 and encoding genes thereof, constructs escherichia coli expression plasmid containing the encoding genes of the ester synthetase JFN94_03506, transfers the plasmid into escherichia coli, obtains the enzyme through induced expression, and has the capability of catalyzing and synthesizing ethyl hexanoate and ethyl octanoate in an aqueous phase system through the verification of a catalytic system, and the yield of the ethyl hexanoate and the ethyl octanoate is 14.2mg/L and 25.1mg/L respectively. The ester synthetase JFN94_03506 can be used for catalyzing and synthesizing important flavor esters ethyl caproate and ethyl caprylate in an aqueous phase system for brewing white spirit, and therefore, can be used for brewing white spirit.
Drawings
FIG. 1 PCR amplification of the gene encoding ester synthase JFN94_ 03506.
FIG. 2 results of expression induction of a gene encoding ester synthase JFN94_ 03506.
FIG. 3 quantitative calculations for the catalytic synthesis of ethyl hexanoate and ethyl octanoate by ester synthase JFN94_ 03506.
Detailed Description
The present invention will be further described with reference to the following specific examples. The operation steps or conditions not described in detail in the following examples are carried out according to the conventional techniques and conditions in the art.
Example 1 cloning of Gene encoding ester synthase JFN94_03506
1. Culture of Burkholderia
Under the aseptic operation condition, Burkholderia BJQ0011 is inoculated into a 300mL triangular flask containing 100mL fermentation medium, and cultured for 48h at the temperature of 200 +/-10 r/min by a shaking table at the temperature of 30 +/-1 ℃. The fermentation medium comprises 5g/L of sorghum and 10g/L, NH of peptone4HSO4 1g/L、K2HPO4 1g/L、MgSO40.8g/L, olive oil 10mL/L, adjusting pH to 7.0, and sterilizing at 115 deg.C for 20 min.
2. Extraction of DNA from Burkholderia
The Burkholderia cultured for 48h was sampled and total DNA was extracted using BIOMIGA bacterial DNA extraction kit. The method comprises the following specific steps:
(1) the bacterial cultures were grown overnight in LB medium
(2) 1-2mL of the bacterial culture was taken into a 1.5mL or 2.0mL centrifuge tube and centrifuged at 12000rpm for 1min at room temperature. The medium was discarded.
(3) Add 100. mu.L TE Buffer, vortex and suspend the bacterial sludge.
(4) Add 10. mu.L Lysozyme and incubate at 37 ℃ for 10 min.
(5) Add 100. mu.L BTL Buffer and 20. mu.L protease K solution. Vortex and mix well. Culturing in a shaking table with water bath at 55 deg.C for no more than 1 hr.
(6) Add 5. mu.L RNase A. The tube was inverted and mixed well several times. Incubate at room temperature for 5 min. 10000 centrifugation for 2 min. The supernatant was transferred to a new 1.5mL centrifuge tube.
(7) Add 220. mu.L BDL Buffer and vortex to mix. Culturing at 65 deg.C for 10 min.
(8) Add 220. mu.L of 100% ethanol. Vortex at maximum speed for 20s and mix.
(9) The mixture is transferred to an adsorption column with collection tubes (including any precipitate that may have formed). Centrifuge at 10000rpm for 1min at room temperature. The filtrate and collection tube were discarded. Insert the column into a new 2mL centrifuge tube.
(10) Add 500. mu.L HBC Buffer, centrifuge at 10000rpm for 1min at room temperature. The filtrate was discarded and the collection tube was reused.
(11) Add 700. mu.L of DNA Wash Buffer and centrifuge at 10000rpm for 1min at room temperature. The filtrate was discarded and the collection tube was reused.
(12) Add 700. mu.L of DNA Wash Buffer again and centrifuge at 10000rpm for 1min at room temperature. The filtrate was discarded and the collection tube was reused.
(13) Centrifugation was carried out at 13000rpm for 2min at room temperature to remove residual ethanol.
Note that: the ethanol residue will reduce the elution effect and affect the downstream experiment, and the uncapping centrifugation or properly prolonging the centrifugation time will help to remove the ethanol.
(14) The column was placed in a new clean-free 1.5mL collection tube, 50-100. mu.L of DEPC-treated ddH was added2O, standing at room temperature for 3-5min, and centrifuging at 10,000rpm for 1min to elute the DNA. The extracted DNA can be used directly in subsequent experiments or stored at-20 ℃.
3. PCR amplification of the Gene encoding ester synthetase JFN94_03506
By cloning a plurality of alpha/beta hydrolase encoding genes from Burkholderia anthina BJQ0011, performing heterologous expression and performing enzymatic property determination, JFN94_03506 is found to have ester synthesis capacity for the first time, and taking the enzyme as an example, the specific encoding genes are cloned, expressed and the property determination is as follows.
The gene encoding Burkholderia-derived ester synthase JFN94_03506 was amplified by PCR. The primers were designed as follows:
forward primer TAAGAAGGAGATATACCATGATGGACGCTTCTGAATTC
Reverse primer GGTGGTGCTCGAGTGCGATTTCGGAACGGTTCGGCTG
The PCR reaction system is shown in the following table.
TABLE 3 PCR reaction System for amplifying JFN94_03506 encoding Gene
| Reagent composition | Amount used (ul) |
| ddH2O | 21.0 |
| dNTP Mixture(2.5mM each) | 3.0 |
| 10×Ex Taq Buffer | 3.0 |
| Forward primer (10. mu.M) | 0.6 |
| Reverse primer (10. mu.M) | 0.6 |
| Template DNA | 0.8 |
| Ex Taq(5U/μl) | 1.0 |
| Total | 30.0 |
PCR amplification cycle
The results of gene amplification were detected by gel electrophoresis, and the results are shown in FIG. 1.
Example 2 construction of an engineered Strain of Escherichia coli expressing an ester synthase JFN94_03506
1. Linearization of pET-28a (+) vector
Primers were designed for linearization of the pET-28a (+) vector by PCR. The primers were designed as follows:
a forward primer: 5'-CTGAGATCCGGCTGCTAA-3'
Reverse primer: 5'-ACTTCCTCTTGGCACCAGGCCGCTGCT-3'
The PCR reaction system is shown in Table 4.
TABLE 4 PCR reaction System for linearized vector pET-28a (+)
| Reagent | Volume (μ l) |
| ddH2O | 21.0 |
| dNTP Mixture(2.5mM each) | 3.0 |
| 10×Ex Taq Buffer | 3.0 |
| Forward primer (10. mu.M) | 0.6 |
| Reverse primer (10. mu.M) | 0.6 |
| pET-28a (+) vector | 0.8 |
| Q5 DNA Polymerase(5U/μl) | 1.0 |
| Total | 30.0 |
PCR amplification cycle
The amplified DNA band was purified by DNA and used for plasmid construction.
2. Plasmid construction
By passing
II, plasmid construction is carried out. The general principle of primer design is: by introducing homologous sequences at the ends of the linearized cloning vector at the 5' end of the primer, the 5' and 3' extreme ends of the amplified product of the insert carry completely identical sequences (15-20bp) corresponding to the two ends of the linearized cloning vector, respectively. Based on the principle, a primer for gene amplification is designed to carry out recombination reaction, and the following reaction system is prepared in an ice water bath. The reaction system composition is shown in Table 5.
TABLE 5 plasmid ligation reaction System
After the system is prepared, the components are mixed evenly by lightly blowing and beating the components up and down for several times by a pipettor. The mixture is placed at 37 +/-1 ℃ for reaction for 30 min. After the reaction was completed, the reaction tube was immediately placed in an ice-water bath to cool for 5 min.
3. Transformation of plasmids
Add 20. mu.l of the cooled reaction solution to 200. mu.l of competent cells, flick the tube wall and mix well, and leave on ice for 30 min. Heat shock at 42 deg.c for 45-90s and ice water bath incubation for 2 min. Add 600. mu.l LB medium, shake bacteria at 37 + -1 deg.C for 60min for sufficient recovery. 100 μ l of the inoculum was spread evenly on LB medium plates containing the appropriate kanamycin antibiotic. The plates were inverted and incubated overnight at 37. + -. 1 ℃. The LB culture medium formula comprises: 5.0g/L yeast powder, 10.0g/L, NaCl 10.0.0 g/L peptone, 2% agar powder, adjusting pH to 7.0, and sterilizing at 121 deg.C for 20 min.
Example 3 catalytic Synthesis of Ethyl hexanoate and Ethyl octanoate with the crude enzyme liquid aqueous phase System of ester synthetase JFN94_03506
1. Inducible expression of ester synthase JFN94_03506
The transformants which were confirmed to be correct were picked, transferred to LB liquid tubes containing the appropriate kanamycin antibiotic and cultured overnight at 37. + -. 1 ℃ and then inoculated into 300mL flasks containing 100mL of LB medium at an inoculum size of 1% (v/v), cultured for 3 hours at 37. + -. 1 ℃ and 200. + -. 10rpm on a shaker, and then cultured for 20 hours at 20. + -. 1 ℃ and 200. + -. 10rpm with the addition of 0.5mM inducer IPTG.
2. Preparation of crude enzyme solution of ester synthase JFN94_03506
After the E.coli induced expression, the cells were collected by centrifugation at 13000rpm for 5min, washed by suspension in 0.05M Tris-HCl buffer pH 7.5 for 2 times, and then suspended. Breaking cells with ultrasonic cell disruptor, centrifuging at 13000rpm for 5min, taking supernatant as crude enzyme solution, firstly performing SDS-PAGE electrophoresis to determine target protein expression (figure 2), and then performing ester synthesis characteristic detection of esterifying enzyme JFN94_ 03506.
3. JFN 94-03506 catalysis of ester synthesis of crude enzyme solution
The 10mL reaction was as follows:
1mL of crude enzyme solution; citrate buffer (pH 4.0), 9mL (ethanol to 1M); hexanoic acid and octanoic acid, both at a final concentration of 10 mM. Carrying out shaking table reaction in water bath at the speed of 150 +/-10 rpm at the temperature of 30 +/-1 ℃ for 12 hours. 3mL of n-hexane was extracted, and the amount of synthesized ester was quantitatively determined by gas chromatography.
4. Quantitative gas chromatography detection
A chromatographic column: agilent 19091N-213I
Detection conditions are as follows: maintaining at 40 deg.C for 5 min; heating to 170 deg.C at a speed of 8 deg.C/min, and maintaining for 10 min; the temperature is increased to 240 ℃ at a speed of 8 ℃/min and kept for 5 min. The sample volume was 1. mu.l, and no split stream was taken. The carrier gas was nitrogen, the flow rate was 1mL/min, FID detector.
The result proves that the crude enzyme solution of the escherichia coli engineering bacteria expressing the ester synthetase JFN94_03506 constructed by the invention has the capability of catalyzing and synthesizing ethyl hexanoate and ethyl octanoate in an aqueous phase system (figure 3), and the yield is 14.2mg/L and 25.1mg/L respectively.
Sequence listing
<110> Beijing university of Industrial and commercial
Burkholderia ester synthetase <120>, encoding gene and application thereof
<160> 6
<170> Patent-In 3.3
<210> 1
<211> 286
<212> PRT
<213> Burkholderia ester synthase JFN94_03506
<220>
<223>
<400> 1
MDASEFSKFL KAALPAAATA GAALTVAEVE IPGYAQDIAL RLYRRADKTG LPVVLYFHGG 60
GFVRGTLEDA DFAARFLAER LPALVVSVDY SLAPAFPFPA APEDAYRAAV WAATRARAFG 120
GNPKKIGVAG HDAGGQLANC LAFIARDRGE VSIAAQALFG PMLDPSMTRI GDAERLSSDI 180
TARECAACYR AYLPQAAQRM HPYAAPLESV RLAGLPPTLV VTAQNDVLHV EAEKYAGCLI 240
SSGVLTQVIR YPDVTHAALA THEAALEEAV RFFQCRFQAR QPNRSE 286
<210> 2
<211> 861
<212>DNA
<213> Burkholderia ester synthase JFN94_03506 encoding gene
<220>
<223>
<400>2
atggacgctt ctgaattcag caaattcctg aaagccgcat tgcccgccgc ggccacggcc 60
ggcgcggcat tgacggtcgc ggaggtggaa atccccggct acgcgcagga catcgcgctg 120
cgcctctatc ggcgtgcgga caagaccgga ttgccggtag tgctttattt ccacggcggc 180
ggcttcgtgc gcggcacgct cgaggacgcg gatttcgccg cgcgtttttt agcagaacgc 240
ttaccagctc tcgtagtgtc ggtcgattat tcgctcgcgc cggcctttcc ttttccggcc 300
gcgccggagg atgcgtatcg cgccgccgtg tgggccgcga cgcgcgcccg cgcgttcggc 360
ggcaacccga agaagatcgg cgtcgcgggc cacgacgcgg gcggccagct cgcgaactgc 420
ctcgcgttca tcgcgcgcga tcgcggtgaa gtgtcgatcg ccgcgcaggc gctgttcggg 480
ccgatgctcg atccgagcat gacgcgcatc ggcgacgccg agcgcctgtc gtcggacatt 540
accgcgcgcg aatgcgcggc ctgttatcgc gcgtatctgc cgcaggcggc gcagcgcatg 600
cacccgtacg cggcgccgct cgaatcggtg cgactcgcgg gcctgccgcc gacgctcgtc 660
gtcaccgcgc agaacgacgt gctgcacgtc gaagcggaga aatatgcggg ctgcctgatt 720
tcgtcgggcg tgctcacgca ggtgatccgc tacccggacg tcacgcacgc ggcgctcgcg 780
acgcacgaag cggcgctgga ggaagccgtg cgcttcttcc agtgccgctt ccaggcgcgc 840
cagccgaacc gttccgaata a 861
<210> 3
<211>38
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>3
taagaaggag atataccatg atggacgctt ctgaattc 38
<210> 4
<211>37
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>4
ggtggtgctc gagtgcgatt tcggaacggt tcggctg 37
<210>5
<211>18
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>5
ctgagatccg gctgctaa 18
<210> 6
<211>27
<212>DNA
<213> Artificial sequence
<220>
<223>
<400>6
acttcctctt ggcaccaggc cgctgct 27
Claims (10)
1. A burkholderia ester synthase, characterized in that: the amino acid sequence is shown as SEQ ID NO. 1.
2. The gene encoding a Burkholderia ester synthase according to claim 1.
3. The gene encoding a Burkholderia ester synthase according to claim 2, wherein the nucleotide sequence is as shown in SEQ ID No. 2.
4. An expression vector comprising a gene encoding the Burkholderia ester synthase of claim 3.
5. The expression vector of claim 4, wherein the gene encoding the Burkholderia ester synthase is operably linked to a promoter.
6. A host cell expressing the vector of claim 4 or 5.
7. The host cell of claim 6, which is an E.coli cell.
8. Use of a Burkholderia ester synthase according to claim 1 for the preparation of ethyl hexanoate and/or ethyl octanoate.
9. The use according to claim 8, wherein the reaction is carried out in an aqueous system using caproic acid and ethanol as catalytic substrates or caprylic acid and ethanol as catalytic substrates to produce ethyl caproate or ethyl caprylate.
10. The use according to claim 9, wherein the Burkholderia ester synthase is obtained by gene work.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110635554.9A CN113564142A (en) | 2021-06-08 | 2021-06-08 | Burkholderia ester synthetase, coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110635554.9A CN113564142A (en) | 2021-06-08 | 2021-06-08 | Burkholderia ester synthetase, coding gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113564142A true CN113564142A (en) | 2021-10-29 |
Family
ID=78161729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110635554.9A Pending CN113564142A (en) | 2021-06-08 | 2021-06-08 | Burkholderia ester synthetase, coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113564142A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114369582A (en) * | 2022-01-29 | 2022-04-19 | 宜宾五粮液股份有限公司 | Bidirectional Burkholderia-derived ester synthetase JG 536-25355, coding gene and application |
| CN114507652A (en) * | 2022-03-08 | 2022-05-17 | 北京工商大学 | Purification and crystal preparation method of Burkholderia ester synthetase Bur01 |
| CN115261357A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Paracoccus comstocki (Paracoccus konratieveae) alpha/beta hydrolase F8A10_20830, and gene and application thereof |
| CN115261343A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Aspergillus niger ester synthetase An3131, encoding gene and application thereof |
| CN115261342A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Burkholderia BJQ 0011-derived ester synthetase JFN _18195, encoding gene and application thereof |
-
2021
- 2021-06-08 CN CN202110635554.9A patent/CN113564142A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115261357A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Paracoccus comstocki (Paracoccus konratieveae) alpha/beta hydrolase F8A10_20830, and gene and application thereof |
| CN115261343A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Aspergillus niger ester synthetase An3131, encoding gene and application thereof |
| CN115261342A (en) * | 2022-01-06 | 2022-11-01 | 北京工商大学 | Burkholderia BJQ 0011-derived ester synthetase JFN _18195, encoding gene and application thereof |
| CN115261343B (en) * | 2022-01-06 | 2023-07-11 | 北京工商大学 | Aspergillus niger ester synthetase An3131, coding gene and application thereof |
| CN115261342B (en) * | 2022-01-06 | 2023-07-14 | 北京工商大学 | Burkholderia BJQ0011 source ester synthetase JFN94_18195, coding gene and application thereof |
| CN114369582A (en) * | 2022-01-29 | 2022-04-19 | 宜宾五粮液股份有限公司 | Bidirectional Burkholderia-derived ester synthetase JG 536-25355, coding gene and application |
| CN114507652A (en) * | 2022-03-08 | 2022-05-17 | 北京工商大学 | Purification and crystal preparation method of Burkholderia ester synthetase Bur01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113564142A (en) | Burkholderia ester synthetase, coding gene and application thereof | |
| CN110283805B (en) | Monascus purpureus ester synthetase LIP05, encoding gene and application thereof | |
| TWI535847B (en) | Isopropyl alcohol-producing bacteria and method for producing isopropyl alcohol using the same | |
| CN111518806B (en) | Acetobacter pasteurianus promoter and application thereof | |
| Geueke et al. | Heterologous expression of Rhodococcus opacus L-amino acid oxidase in Streptomyces lividans | |
| US10294479B2 (en) | Candida carbonyl reductase and method for preparing (R)-lipoic acid precursor | |
| CN110283806B (en) | Monascus purpureus ester synthetase LIP05-50, encoding gene and application thereof | |
| CN106244569B (en) | Esterase EstC10, and coding gene and application thereof | |
| JP3408737B2 (en) | Protein involved in nitrile hydratase activation and gene encoding the same | |
| CN106754773A (en) | A kind of isoeugenol monooxygenase operon gene and its recombinant vector and restructuring pseudomonad | |
| CN115261342B (en) | Burkholderia BJQ0011 source ester synthetase JFN94_18195, coding gene and application thereof | |
| CN111454918B (en) | Enol reductase mutant and application thereof in preparation of (R) -citronellal | |
| US8735562B2 (en) | Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus | |
| CN105969751B (en) | Beta-glucosidase gene and application thereof | |
| CN106119272B (en) | Strategy for efficiently co-producing L-phenylglycine and gluconic acid | |
| CN113151131B (en) | Self-induction culture medium for producing isoeugenol monooxygenase and application thereof | |
| CN112410353B (en) | fkbS gene, genetic engineering bacterium containing fkbS gene, and preparation method and application of fkbS gene | |
| CN113652408A (en) | Carbonyl reductase mutant and application thereof in synthesis of (R) -4-chloro-3-hydroxybutyric acid ethyl ester | |
| JP6392534B2 (en) | Protein having leucine acid production activity and use thereof | |
| CN114369582B (en) | Brucella bifidus source ester synthetase JG536_25355, coding gene and application | |
| CN115261396B (en) | Aspergillus niger ester synthetase An605, coding gene and application thereof | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN115261343B (en) | Aspergillus niger ester synthetase An3131, coding gene and application thereof | |
| JP2006271378A (en) | Method for producing 12-aminododecanoic acid and biocatalyst used for the method | |
| Hršelová et al. | Genetic transformation of extremophilic fungi Acidea extrema and Acidothrix acidophila |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication |