CN113533603A

CN113533603A - Quality detection method of patchouli oil, inclusion compound, dry suspension and application thereof

Info

Publication number: CN113533603A
Application number: CN202010317649.1A
Authority: CN
Inventors: 黄永焯; 王冰; 刘团兵
Original assignee: Shanghai Institute of Materia Medica of CAS
Current assignee: Shanghai Institute of Materia Medica of CAS
Priority date: 2020-04-21
Filing date: 2020-04-21
Publication date: 2021-10-22

Abstract

The invention relates to a quality detection method of patchouli oil, a clathrate compound, a dry suspension and pharmaceutical application thereof. The quality detection method of the patchouli oil comprises the following steps: s1: measuring the map of the patchouli oil by using GC-MS; s2: matching the map in the step S1 according to a GC-MS NIST database to obtain qualitative attribution information of characteristic peaks; s3: according to the map in the step S1 and the qualitative attribution information in the step S2, in the map in the step S1, detecting peak areas corresponding to the patchouli, the delta-guaiene, the patchouli alcohol and the patchouli ketone, and if the sum of the peak areas is more than 70%, indicating that the quality of the patchouli oil is qualified. According to the quality detection method of patchouli oil disclosed by the invention, the quality of the traditional Chinese medicine can be rapidly detected, the standard of the traditional Chinese medicine is standardized, the pharmacological research of the traditional Chinese medicine is promoted, and a safe, reliable and convenient-to-store traditional Chinese medicine preparation is provided.

Description

Quality detection method of patchouli oil, inclusion compound, dry suspension and application thereof

Technical Field

The invention relates to a quality detection method of patchouli oil, a pharmaceutical formulation and application thereof; specifically, the invention relates to a quality detection method of patchouli oil, a patchouli oil clathrate, a patchouli oil dry suspension and application thereof in preparing a medicament for treating ulcerative colitis.

Background

Ulcerative colitis is a complex disease involving immune reactions, structural changes in the colon, and the intestinal flora, has the characteristics of long course, difficult healing, and easy recurrence, can be life-threatening when the disease deteriorates, and can increase the risk of patients suffering from colorectal cancer, and is called cancer which is not cancer. At present, the medicine for treating the disease mainly comprises aminosalicylic acid, glucocorticoid or immunosuppressant. But the long-term treatment effect is not good, and the long-term taking of the medicine has great side effect. Therefore, no therapeutic drug has reliable efficacy and good safety and is suitable for long-term or life-long use.

In traditional Chinese medicine, ulcerative colitis is called intestinal wind, intestinal stranguria, diarrhea and the like, and the main pathogenesis is spleen deficiency. In clinic, a plurality of effective compound medicines and single medicines for treating ulcerative colitis exist, and modern pharmacological research also proves that the effective components of the traditional Chinese medicine have the characteristics of good efficacy and clear action mechanism for treating ulcerative colitis. Because the anti-ulcerative colitis effect of the traditional Chinese medicine has the advantages of multi-component and multi-target effect, obvious drug effect and high safety, the development and search of the candidate medicine of the traditional Chinese medicine for treating ulcerative colitis in clinic and experiments have great development prospect. In the new medicine application in the clinical test stage, the compound new traditional Chinese medicine for treating ulcerative colitis is accepted by kuojiekang enema liquid, ChangAnkang capsules and Sanjin Colon kang capsules, and no new medicine application of effective parts of the traditional Chinese medicine is available. Therefore, the development of the effective components of the traditional Chinese medicine and the new preparation thereof for treating ulcerative colitis with clear action mechanism is still insufficient, and the market at present lacks of new clinical candidate traditional Chinese medicine with controllable chemical component quality, technical characteristics of substitute preparations and capability of treating ulcerative colitis.

Pogostemon cablin is the dry aerial part of Pogostemon cablin (Blanco) Benth, a labiate plant, is recorded in 2015 edition of Chinese pharmacopoeia, has the effects of eliminating turbid pathogen with aromatics, regulating the middle warmer, stopping vomiting, relieving summer-heat, and relieving summer-heat, is used for damp turbidity obstruction in middle warmer, abdominal fullness and vomiting, summer-heat and damp exterior syndrome, abdominal pain, vomiting and diarrhea and the like, has the main pharmacological effects of regulating gastrointestinal tract functions, resisting inflammation and bacteria, relieving pain, clearing heat and the like, and is a common traditional Chinese medicine prescription for treating digestive system diseases. The main component of patchouli is patchouli oil which is a volatile oil with pharmacological actions such as anti-inflammatory, antibacterial and antiallergic actions, and is also the prescription of various Chinese patent medicines such as patchouli qi-strengthening water, antiviral oral liquid, and hopcalite pills. Patchouli oil is used as a plant extract and is recorded in 2015 edition of Chinese pharmacopoeia, the main component of the patchouli oil is patchouli alcohol, and the content of the patchouli alcohol is not less than 26% specified in the pharmacopoeia. Domestic and foreign studies show that patchouli oil and patchouli alcohol have definite therapeutic effects on animals with ulcerative colitis. The premise that the patchouli oil has the efficacy of ulcerative colitis is that the patchouli oil has clear components, controllable quality, safety and stability.

However, the preparation method mainly extracts natural products, so that the production area, the growth environment and the extraction process of the plants all have certain influence on the components of the patchouli oil. The inspection of patchouli oil in the 'Chinese pharmacopoeia' of 2015 edition at present mainly comprises thin-layer identification and content determination, wherein the content mainly comprises determination of a single component of patchouli alcohol, and the quality of the patchouli oil is difficult to control comprehensively.

In order to ensure the clinical therapeutic effect of the patchouli oil, the quality of the patchouli oil needs to be strictly controlled, and a proper preparation technology or a proper dosage form needs to be developed according to the physicochemical property and the medication purpose of the patchouli oil. Because the patchouli oil is an oily extract and has the defects of strong volatility, poor stability and the like, the selection of the preparation is limited, and therefore, the preparation technology or preparation research of the volatile oil liquid solidification is very necessary. Researches report that the cyclodextrin inclusion technology can improve the stability of the volatile oil, and the preparation of the inclusion compound by adopting a saturated aqueous solution method is simple and easy. Although some research reports exist on the optimal dosage ratio, inclusion temperature, time and the like for preparing the patchouli oil-beta-cyclodextrin inclusion compound at present, the problems of difficult solidification of patchouli volatile oil, easy migration of medicinal components and poor stability still cannot be solved, so that the difficulty of developing a preparation from a liquid medicament of the patchouli volatile oil can not be well overcome by the conventional inclusion technology and a general preparation, and the problem of exploring proper auxiliary materials or technologies capable of solving the difficulty of preparing the volatile oil preparation is a key preparation to be solved at present.

Besides being prepared into inclusion compound by adopting a cyclodextrin inclusion technology, dry suspension can be considered, the dry suspension is a new formulation developed on the basis of the traditional suspension, is a powder or granular substance prepared from insoluble or oil medicaments and proper auxiliary materials, can be dispersed into suspension by adding water and shaking when in use, and is a solid preparation for oral administration. The dry suspension is simple in preparation method, suitable for industrial production, beneficial to solubilization of drugs, capable of improving uniformity of drug content, large in distribution area in gastrointestinal tracts, fast in absorption and high in bioavailability, and suitable for solving the drug delivery strategy of insoluble drugs, so that the dry suspension is suitable for development of the volatile oil drugs, and no research report for preparing the patchouli oil into the dry suspension exists at present. In the research of the prescription of the dry suspension, proper types and proportions of the filling agent, the suspending agent and the surfactant are selected to ensure that the dry suspension has good suspension effect, content uniformity and preparation stability.

Therefore, a simple and feasible quality detection method of patchouli oil and a proper dosage form of patchouli oil are still needed, so that the quality of traditional Chinese medicines can be rapidly detected, the standards of the traditional Chinese medicines are standardized, the pharmacological research of the traditional Chinese medicines is promoted, and a safe, reliable and convenient-to-store traditional Chinese medicine preparation is provided.

Disclosure of Invention

After various experiments, the inventor of the present disclosure finds that a patchouli oil sample is combined by two determination methods of GC-MS and GC-FID, qualitative attribution and identification of chemical components are performed by combining a characteristic spectrum and a fingerprint spectrum, and an obtained control spectrum can be used as a method for detecting the quality of patchouli oil. It is further found that the specific proportion relation of the patchouli alcohol and the patchouli ketone which are main components in the patchouli oil has clear influence on the drug effect of the patchouli oil and can be used as another condition for quality detection. The stability of the included patchouli oil can be improved by using the hydroxypropyl-beta-cyclodextrin and the sulfobutyl-beta-cyclodextrin to prepare the patchouli oil inclusion compound; simethicone is added to a formulation which enables the preparation of a dry suspension efficiently, and the present disclosure has been completed on this basis.

One object of the present disclosure is to provide a quality detection method of patchouli oil.

The invention also aims to provide the patchouli oil clathrate compound and the preparation method thereof.

The invention also aims to provide a patchouli oil dry suspension and a preparation method thereof.

The invention also aims to provide application of the patchouli oil inclusion compound or the patchouli oil dry suspension in preparation of medicines for treating ulcerative colitis.

According to one aspect of the present disclosure, there is provided a method for detecting quality of patchouli oil, comprising the steps of:

s1: measuring the map of the patchouli oil by using GC-MS;

s2: matching the map in the step S1 according to a GC-MS NIST database to obtain qualitative attribution information of characteristic peaks;

s3: according to the map in the step S1 and the qualitative attribution information in the step S2, in the map in the step S1, detecting peak areas corresponding to the patchouli, the delta-guaiene, the patchouli alcohol and the patchouli ketone, and if the sum of the peak areas is more than 70%, indicating that the quality of the patchouli oil is qualified.

According to another aspect of the present disclosure, there is provided a method for detecting quality of patchouli oil, comprising the steps of:

s1: measuring the map of the patchouli oil by using GC-FID;

s2: guiding the chromatogram in the step S1 into a traditional Chinese medicine chromatogram fingerprint similarity evaluation system in an AIA format, setting an S1 chromatogram as a reference chromatogram, performing multi-point correction on a chromatogram peak of retention time, and automatically matching to generate a reference fingerprint;

s3: and (4) according to the map in the step S1 and the comparison fingerprint map in the step S2, obtaining the proportion range of the patchouli alcohol and the patchouli ketone quantitatively by an internal standard method, wherein if the proportion range of the patchouli alcohol and the patchouli ketone is within 14: 1-35: 1, the quality of the patchouli oil is qualified.

According to another aspect of the present disclosure, there is provided a patchouli oil clathrate, wherein,

the patchouli oil inclusion compound is formed by a formula combining hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin inclusion carriers,

the patchouli oil: hydroxypropyl- β -cyclodextrin: the mass ratio of the sulfobutyl-beta-cyclodextrin mixture is 1:5: 0.1-1: 5: 5.

According to another aspect of the present disclosure, there is provided a method for preparing the patchouli oil clathrate, which comprises:

preparing a 1:2 patchouli volatile oil solution from patchouli volatile oil and absolute ethyl alcohol, mixing hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin, preparing a saturated solution from water, dripping patchouli oil into the saturated solution of cyclodextrin at normal temperature, continuously stirring for inclusion, then placing at low temperature, carrying out suction filtration, standing, and freeze drying to obtain the inclusion compound.

According to another aspect of the disclosure, the patchouli oil dry suspension is provided, wherein the mass fraction of patchouli oil in the dry suspension is 5-15%,

the filling agent is one or more of soluble starch, dextrin, lactose and the like, the mass fraction is 70-90%, the suspending agent is one or more of carbomer 940, agar, xanthan gum and sodium carboxymethylcellulose, the mass fraction is 1-8%, the surfactant is one or more of tween 80, tween 20, tween 85 and span 20, and the mass fraction is 1-10%.

According to another aspect of the present disclosure, there is provided a preparation method of the patchouli oil dry suspension, wherein,

the method comprises pulverizing, sieving, mixing, granulating and grading.

According to another aspect of the disclosure, there is provided a use of the patchouli oil clathrate or the patchouli oil dry suspension according to the present invention in the preparation of a medicament for treating ulcerative colitis.

Advantageous effects

According to the quality detection method of patchouli oil disclosed by the invention, the quality of traditional Chinese medicines can be rapidly detected, the standards of the traditional Chinese medicines are standardized, the pharmacological research of the traditional Chinese medicines is promoted, and a safe, reliable and convenient-to-store traditional Chinese medicine preparation is provided. According to the patchouli oil inclusion compound and the dry suspension disclosed by the invention, the solubility of the medicament can be increased, the bioavailability and the stability of the medicament are improved, and the medicament has higher in-vivo safety.

Drawings

Figure 1 is a graphical representation of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol, and patchouli alcohol self-microemulsions on the hematochezia of ulcerative colitis mice (. p < 0.05;. p < 0.01;. p < 0.001).

Figure 2 is a graphical representation of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol, and patchouli alcohol self-microemulsions on the changes in body weight in ulcerative colitis mice (. p < 0.001).

Figure 3 is a graphical representation of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol, and patchouli alcohol self-microemulsions on colon length in ulcerative colitis mice (. p < 0.05;. p < 0.001).

Figure 4 is a graphical representation of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol, and patchouli alcohol self-microemulsions on the extent of colonic lesions in ulcerative colitis mice (. p < 0.05;. p < 0.001).

Figure 5 is a graphical representation of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol self-microemulsions on the levels of the cytokines TNF- α, IL-1 β, IL-6, IL-23 in serum of mice with dextran sulfate induced ulcerative colitis (. p < 0.001).

FIG. 6 is a graph showing the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol self-microemulsions on the expression levels of TNF- α, IL-1 β, IL-6, IL-23mRNA in dextran sulfate-induced ulcerative colitis mouse colon tissue (p < 0.05;. p < 0.01;. p < 0.001).

FIG. 7 is a graph of the effect of control, model, patchouli oil (including low and high dose groups), patchouli alcohol, and patchouli alcohol self-microemulsions on intestinal permeability in dextran sulfate-induced ulcerative colitis mice (. p < 0.05;. p < 0.001).

FIG. 8 is an overlay of GC-MS profiles of patchouli oil samples from different sources.

FIG. 9 is a comparison of GC-MS characteristic maps of patchouli oil samples from different sources.

FIG. 10 is the overlapping graph of the fingerprint spectrum of patchouli oil measured by GC-FID method.

FIG. 11 shows the results of the GC-FID method for determining the content of patchouli oil from different sources.

Detailed Description

To make the features and effects of the present invention comprehensible to those having ordinary knowledge in the art, general description and definitions are made with respect to terms and phrases mentioned in the specification and claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

In this document, the terms "comprising," "including," "having," "containing," or any other similar term, are intended to be open-ended franslational phrase (open-ended franslational phrase) and are intended to cover non-exclusive inclusions. For example, a composition or article comprising a plurality of elements is not limited to only those elements recited herein, but may include other elements not expressly listed but generally inherent to such composition or article. In addition, unless expressly stated to the contrary, the term "or" is intended to mean an inclusive "or" rather than an exclusive "or". For example, the condition "a or B" is satisfied in any of the following cases: a is true (or present) and B is false (or not present), a is false (or not present) and B is true (or present), both a and B are true (or present). Furthermore, in this document, the terms "comprising," including, "" having, "" containing, "and" containing "are to be construed as specifically disclosed and to cover both closed and semi-closed conjunctions, such as" consisting of … "and" consisting essentially of ….

All features or conditions defined herein as numerical ranges or percentage ranges are for brevity and convenience only. Accordingly, the description of numerical ranges or percentage ranges should be considered to have covered and specifically disclosed all possible subranges and individual numerical values within the ranges, particularly integer numerical values. For example, a description of a range of "1 to 8" should be considered to have specifically disclosed all subranges such as 1 to 7, 2 to 8, 2 to 6, 3 to 6, 4 to 8, 3 to 8, and so on, particularly subranges bounded by all integer values, and should be considered to have specifically disclosed individual values such as 1, 2, 3, 4, 5, 6, 7, 8, and so on, within the range. Unless otherwise indicated, the foregoing explanatory methods apply to all matters contained in the entire disclosure, whether broad or not.

If an amount or other value or parameter is expressed as a range, preferred range, or a list of upper and lower limits, it is to be understood that all ranges subsumed therein for any pair of that range's upper or preferred value and that range's lower or preferred value, whether or not such ranges are separately disclosed, are specifically disclosed herein. Further, when a range of numerical values is recited herein, unless otherwise stated, the range is intended to include the endpoints thereof, and all integers and fractions within the range.

In this context, numerical values should be understood to have the precision of the number of significant digits of the value, provided that the object of the invention is achieved. For example, the number 40.0 should be understood to cover a range from 39.50 to 40.49.

In this document, where Markush group (Markush group) or Option language is used to describe features or examples of the invention, those skilled in the art will recognize that a sub-group of all elements or any individual element within a Markush group or list of options may also be used to describe the invention. For example, if X is described as "selected from the group consisting of₁、X₂And X₃The group "also indicates that X has been fully described as X₁Is claimed with X₁And/or X₂Claim (5). Furthermore, where Markush group or option terms are used to describe features or examples of the invention, those skilled in the art will recognize that any combination of sub-groups of all elements or individual elements within the Markush group or option list can also be used to describe the invention. Accordingly, for example, if X is described as "selected from the group consisting of₁、X₂And X₃Group consisting of "and Y is described as" selected from Y₁、Y₂And Y₃The group "formed indicates that X has been fully described as X₁Or X₂Or X₃And Y is Y₁Or Y₂Or Y₃Claim (5).

The following detailed description is merely exemplary in nature and is not intended to limit the invention or the application thereof. Furthermore, there is no intention to be bound by any theory presented in the preceding prior art or the summary of the invention or the following detailed description or examples.

According to one embodiment of the present disclosure, there is provided a method for detecting quality of patchouli oil, comprising the steps of:

s1: measuring the map of the patchouli oil by using GC-MS;

s3: according to the map in the step S1 and the qualitative attribution information in the step S2, in the map in the step S1, detecting peak areas of peaks corresponding to patchouli, delta-guaialene, patchouli alcohol and patchouli ketone, and if the sum of the peak areas is more than 70%, indicating that the quality of the patchouli oil is qualified.

The inventors of the present disclosure found that the drug effect of patchouli oil is closely related to the contents of the above four specific components. Therefore, the quality of the patchouli oil can be accurately controlled by controlling the peak areas of the four specific components.

According to another embodiment of the present disclosure, wherein

In the step S3, if the sum of the peak areas of the peaks corresponding to patchouli, delta-guaialene, patchouli alcohol and patchouli ketone is greater than 70%, and the relative peak area of patchouli alcohol is greater than 30%, it is determined that the quality of the patchouli oil is qualified.

The inventor of the present disclosure found that the drug effect of patchouli oil is also closely related to the content of patchouli alcohol. Therefore, the quality of the patchouli oil can be accurately controlled by controlling the relative peak area of the patchouli alcohol.

According to another embodiment of the present disclosure, wherein

Step S1 specifically includes: transferring patchouli oil sample, adding n-hexane, and shaking up to obtain test solution;

the chromatographic conditions were as follows: the chromatographic column is Agilent HP-5MS, 30m is multiplied by 0.25mm is multiplied by 0.25 mu m; the temperature is programmed to rise to 150 ℃ at 3 ℃/min at 70 ℃, then to 170 ℃ at 2 ℃/min, then to 230 ℃ at 5 ℃/min, and kept for 11 min; the detector is MS; the temperature of a sample inlet is 230 ℃; the temperature of the detector is 250 ℃; the carrier gas is He; the column flow rate was set to 1 mL/min; the sample injection amount is 1 mu L; the split ratio is 50: 1; the scanning type is SCAN; the molecular weight range of the SCAN mode is 50-550.

By using the specific method and conditions, the required peak area parameters can be accurately obtained, so that the quality of the patchouli oil can be accurately detected.

According to another embodiment of the present disclosure, there is provided a method for detecting quality of patchouli oil, comprising the steps of:

s1': measuring the map of the patchouli oil by using GC-FID;

s2': guiding the chromatogram in the step S1' into a traditional Chinese medicine chromatogram fingerprint similarity evaluation system in an AIA format, setting an S1 chromatogram as a reference chromatogram, performing multi-point correction on a chromatogram peak of retention time, and automatically matching to generate a reference fingerprint;

s3': and (3) according to the map in the step S1 'and the comparison fingerprint map in the step S2', quantitatively obtaining the proportion range of the patchouli alcohol and the patchouli ketone by an internal standard method, and if the proportion range of the patchouli alcohol and the patchouli ketone is within the range of 14: 1-35: 1, indicating that the quality of the patchouli oil is qualified.

The inventors of the present disclosure found that the drug effect of patchouli oil is closely related to the ratio of patchouli alcohol to patchouli ketone, and that the ratio of specific ingredients in patchouli oil can be more simply obtained by GC-FID. Therefore, the quality of patchouli oil can be accurately controlled by controlling the ratio of the patchouli alcohol and the patchouli ketone.

According to another embodiment of the present disclosure, wherein

In step S3' of the method using GC-FID, if the ratio of patchouli alcohol to patchouli ketone is in the range of 28:1 to 32:1, the quality of the patchouli oil is qualified.

When the ratio of patchouli alcohol to patchoulenone is within the above range. The quality of the patchouli oil is more excellent.

According to another embodiment of the present disclosure, wherein

The step S1' specifically includes: adding patchouli oil into n-hexane, and shaking up to obtain a solution to be detected;

the chromatographic conditions are as follows:

a chromatographic column: agilent HP-5, 30m × 0.32mm × 0.25 μm; temperature programming: heating to 150 deg.C at 70 deg.C at 2 deg.C/min, heating to 170 deg.C at 2 deg.C/min, heating to 230 deg.C at 5 deg.C/min, and maintaining for 11 min; a detector: FID; sample inlet temperature: 230 ℃; detector temperature: 250 ℃; carrier gas: he; column flow rate: 1 mL/min; sample introduction amount: 1 mu L of the solution; the split ratio is as follows: 50:1.

By using the specific method and conditions, the required proportion parameters of the specific components can be accurately obtained, so that the quality of the patchouli oil can be accurately detected.

According to another embodiment of the present disclosure, there is provided a patchouli oil clathrate, wherein,

The hydroxypropyl-beta-cyclodextrin and the sulfobutyl-beta-cyclodextrin are used together to prepare the inclusion compound, which is beneficial to improving the inclusion rate and the stability.

According to another embodiment of the present disclosure, there is provided a method of preparing the patchouli oil clathrate compound of claim 7, comprising:

preparing patchouli volatile oil and absolute ethyl alcohol into patchouli volatile oil solution with the ratio of 1:2, mixing hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin, preparing saturated solution by using water, slowly dripping patchouli oil into the saturated solution of cyclodextrin at normal temperature, continuously stirring for inclusion, then placing at low temperature, carrying out suction filtration, standing, and carrying out freeze drying to obtain the inclusion compound.

By the above method, the patchouli oil inclusion compound can be efficiently prepared in a simple procedure.

According to another embodiment of the disclosure, the patchouli oil dry suspension is provided, wherein the mass fraction of patchouli oil in the dry suspension is 5-15%,

By using the patchouli oil dry suspension, the problem of dissolubility of volatile oil can be solved, discomfort caused by disease flatulence can be relieved, and the patchouli oil dry suspension is suitable for a medicine prescription for the digestive tract opening.

According to another embodiment of the present disclosure, there is provided a preparation method of the patchouli oil dry suspension according to claim 9, wherein,

the method comprises pulverizing, sieving, mixing, granulating and grading.

By the above method, the patchouli oil dry suspension can be effectively prepared in simple steps.

According to another embodiment of the present disclosure, there is provided a use of the patchouli oil clathrate or the patchouli oil dry suspension according to the present disclosure in the preparation of a medicament for treating ulcerative colitis.

More specifically, according to an embodiment of the present disclosure, the method for establishing the feature map includes:

(1) preparation of control solutions: dissolving 1-2mg of commercially available patchouli alcohol and patchouli ketone reference substances in n-hexane respectively;

(2) preparation of a test solution: respectively transferring 50 mu L of a commercially available sample, respectively adding 200 mu L of n-hexane, and shaking up to obtain a sample solution;

(3) chromatographic conditions are as follows:

a chromatographic column: agilent HP-5MS, 30 m.times.0.25 mm.times.0.25 μm (SEQ ID NO: USN 398724H); temperature programming: heating to 150 deg.C at 70 deg.C/min, heating to 170 deg.C at 2 deg.C/min, heating to 230 deg.C at 5 deg.C/min, and maintaining for 11 min; a detector: MS; sample inlet temperature: 230 ℃; detector temperature: 250 ℃; carrier gas: he; column flow rate: 1 mL/min; sample introduction amount: 1 mu L of the solution; the split ratio is as follows: 50: 1; the scanning type is as follows: SCAN; SCAN pattern molecular weight range: 50-550.

(4) The analysis method comprises the following steps: and (3) adopting GC-MS technology for determination, analyzing the chromatographic and mass spectrum information of the reference solution and the test solution, matching with a GC-MS NIST database to obtain qualitative attribution information of 13 characteristic peaks, obtaining qualitative information of a characteristic spectrum and a compound composition of the characteristic spectrum, analyzing to obtain the chemical names, CAS numbers, molecular formulas and the like of the 13 characteristic peaks, and generating a characteristic spectrum overlapping graph and a comparison graph of the patchouli oil.

In the overlapped graph and the comparison graph of the characteristic graphs, 4 main common peaks in 13 characteristic peaks are patchouli alkene, delta-guaiene, patchouli alcohol and patchouli ketone, the sum of the peak areas is more than 70%, wherein the relative peak area of the patchouli alcohol serving as a main active ingredient is the highest and more than 30%.

(1) preparation of internal standard solution and preparation of reference solution: precisely weighing 142.24mg of n-octadecane into a volumetric flask, adding n-hexane to a constant volume of 10mL, and shaking up for later use; precisely weighing 6.399mg of a commercially available patchouli alcohol reference substance into a volumetric flask, precisely adding 0.2mL of an internal standard solution, and fixing the volume to 2mL by using n-hexane; precisely weighing 4.736mg of a commercially available pogostone reference substance into a volumetric flask, precisely adding 0.2mL of an internal standard solution, and fixing the volume to 2mL by using n-hexane;

(2) preparation of a test solution: transferring 50 mu L of a commercially available sample, respectively adding 200 mu L of n-hexane, and shaking up to obtain a sample solution;

(3) chromatographic conditions are as follows: a chromatographic column: agilent HP-5, 30m × 0.32mm × 0.25 μm; temperature programming: heating to 150 deg.C at 70 deg.C at 2 deg.C/min, heating to 170 deg.C at 2 deg.C/min, heating to 230 deg.C at 5 deg.C/min, and maintaining for 11 min; a detector: FID; sample inlet temperature: 230 ℃; detector temperature: 250 ℃; carrier gas: he; column flow rate: 1 mL/min; sample introduction amount: 1 mu L of the solution; the split ratio is as follows: 50: 1;

(4) the analysis method comprises the following steps: and respectively introducing GC-FID spectra of different batches of patchouli oil into a traditional Chinese medicine chromatogram fingerprint similarity evaluation system in an AIA format, setting an S1 chromatogram as a reference chromatogram, performing multi-point correction on a chromatogram peak of retention time, and automatically matching to generate a reference fingerprint. The S1 is used as a reference spectrum for fingerprint matching, so that a fingerprint is generated, 17 common fingerprint peaks (accounting for more than 95% of the total peak area) of the S1-S5 sample are calibrated, the separation degree of 5 characteristic peaks is good, the fingerprint characteristics are realized, and the quality of the patchouli volatile oil can be comprehensively reflected; similarity analysis is carried out on various patchouli oil batches, and the similarity of the S1-S5 fingerprint spectra is more than 0.998, which shows that the major components of various patchouli oil batches are not obviously different.

More specifically, according to one embodiment of the present disclosure, the content of patchouli alcohol and patchouli ketone in patchouli oil is determined by GC-FID method and internal standard method, and the data analysis is performed on the content determination results of 5 batches of patchouli oil to obtain the content ratio range and preferred content ratio of patchouli alcohol and patchouli ketone in patchouli oil.

More specifically, according to one embodiment of the present disclosure, the patchouli oil and absolute ethyl alcohol are prepared into a 1:2 patchouli oil solution, and the hydroxypropyl-beta-cyclodextrin and the sulfobutyl-beta-cyclodextrin are mixed according to a ratio of 5: 0-5: 5, and are prepared into a saturated solution with water. Feeding the patchouli oil solution at normal temperature according to the liquid-solid ratio of 1: 5-1: 10 of the patchouli oil and the two cyclodextrins, slowly dropping the patchouli oil solution into the cyclodextrin saturated solution, continuously stirring for 1-2h for inclusion, standing at 4 ℃, removing insoluble substances by suction filtration, standing at-80 ℃ overnight, and freeze-drying to obtain the inclusion compound.

More specifically, according to one embodiment of the present disclosure, the patchouli oil dry suspension uses patchouli oil as an active ingredient, and is prepared from patchouli oil, a filler, a suspending agent, a surfactant, a wetting agent and an aromatic agent, so as to obtain 8% to 14% of patchouli dry suspension. The filler is one or more of soluble starch, sucrose, dextrin, lactose and microcrystalline cellulose; the suspending agent is one or more of carbomer 940, agar, sodium carboxymethylcellulose and xanthan gum; the surfactant is one or more of tween 80, tween 20, tween 85, span 20 and sodium dodecyl sulfate; the wetting agent is water.

More specifically, according to one embodiment of the present disclosure, the preparation method of the patchouli oil dry suspension comprises the following steps:

(1) sieving auxiliary materials: crushing related solid auxiliary materials and sieving the crushed solid auxiliary materials with a 100-mesh sieve;

(2) mixing: placing the patchouli oil, simethicone and wetting agent in the prescription amount into a mortar, grinding for 30-45 min, adding a filling agent which is 40-60% of the weight of the filling agent, uniformly adsorbing, and uniformly mixing with the rest filling agent, the suspending agent, the surfactant and the wetting agent in the prescription amount by an equivalent gradual addition method;

(3) granulating and finishing: adding a binding agent to prepare a soft material, sieving with a 20-mesh sieve, granulating, drying in a drying oven at 40-60 ℃ for 2-3 h, and sieving with a 20-mesh sieve, and grading to obtain the patchouli oil dry suspension.

Preferably, the filling agent in the step (2) is selected from one or more of soluble starch, dextrin, lactose and the like with better adsorption effect.

Preferably, the carboxymethylcellulose sodium suspension in the step (2) is combined with xanthan gum, and the suspension effect is better when the ratio is 3:1, and the preferred ratio is adopted.

Preferably, the surfactant in the step (2) is one or more of tween 80, tween 20, tween 85 and span 20.

The present application is further described with reference to the following detailed description and accompanying drawings.

Quality detection method of patchouli oil

1. Instruments and reagents

1.1 instruments

Agilent 7890A-5977A gas chromatography mass spectrometer (GC-MS) (Agilent technologies, ltd), Agilent 7890B gas chromatograph (Agilent technologies, ltd), FID detector, XS205 electronic balance (mettlerltonido instruments (shanghai) ltd), XPR2 electronic balance (mettlerltonido instruments (shanghai) ltd).

1.2 reagents

Chemical reagent of national medicine group of n-hexane (analytical purity); octadecane (111636-; patchouli alcohol (5986-55-0, Doldmann Siteur Biotech limited, purity not less than 98%); patchoulenone (23800-56-8, China institute for food and drug testing, purity not less than 98%); commercially available patchouli oil (S1: Henchengcheng spice, 20180628; S2: Baicao spice, 20160102; S3: Lvyuan essential oil, 20191006; S4: Zhongxiang essential oil, 20191025; S5: Jiangxi Anbang, 20190901)

2. Experimental methods

2.1GC-MS chromatographic conditions

A chromatographic column: agilent HP-5MS, 30m × 0.25mm × 0.25 μm; temperature programming: heating to 150 deg.C at 70 deg.C/min, heating to 170 deg.C at 2 deg.C/min, heating to 230 deg.C at 5 deg.C/min, and maintaining for 11 min; a detector: MS; sample inlet temperature: 230 ℃; detector temperature: 250 ℃; carrier gas: he; column flow rate: 1 mL/min; sample introduction amount: 1 mu L of the solution; the split ratio is as follows: 50: 1; the scanning type is as follows: SCAN; SCAN pattern molecular weight range: 50-550.

2.2GC-FID chromatographic conditions

A chromatographic column: agilent HP-5, 30m × 0.32mm × 0.25 μm; temperature programming: heating to 150 deg.C at 70 deg.C at 2 deg.C/min, heating to 170 deg.C at 2 deg.C/min, heating to 230 deg.C at 5 deg.C/min, and maintaining for 11 min; a detector: FID; sample inlet temperature: 230 ℃; detector temperature: 250 ℃; carrier gas: he; column flow rate: 1 mL/min; sample introduction amount: 1 mu L of the solution; the split ratio is as follows: 50: 1; internal standard method.

3. Analysis of Experimental results

3.1 feature Pattern analysis

And matching the characteristic spectrums of all batches of patchouli oil with a GC-MS NIST database to obtain qualitative attribution information of 13 characteristic peaks. Wherein 4 main common peaks are patchouli alkene, delta-guaiene, patchouli alcohol and patchouli ketone, the sum of the peak areas is more than 70%, and the relative peak area of the main active component patchouli alcohol is the highest and more than 30%.

3.2 fingerprint analysis

GC-FID spectra of all batches of patchouli oil are respectively led into a traditional Chinese medicine chromatogram fingerprint similarity evaluation system in an AIA format, 17 common fingerprint peaks (accounting for more than 95% of the total peak area) of S1-S5 samples are calibrated, the separation degree of 5 characteristic peaks is good, the patchouli oil has fingerprint characteristics and can comprehensively reflect the quality of patchouli volatile oil; the similarity of the fingerprint spectrums of all the patchouli oil batches is more than 0.998, which shows that the patchouli oil batches have no obvious difference on the main components.

3.4 measurement of content

And (3) determining the contents of the patchouli alcohol and the patchouli ketone in each batch of patchouli oil by using a GC-FID (gas chromatography-flame ionization Detector) determination method and quantifying by using an internal standard method, wherein the content ratio range of the patchouli alcohol and the patchouli ketone (14: 1-35: 1) is obtained, and the optimal ratio is 30: 1.

Application of patchouli oil in preparation of medicines for treating ulcerative colitis

The following are the therapeutic effects of patchouli oil, patchouli alcohol and self-microemulsion preparations thereof of the present invention:

1. experimental methods

1.1 animal grouping and administration

The experimental animals were male C57BL/6 mice, and the grouping and administration design is shown in Table 1.

TABLE 1 Experimental group design

Note: the patchouli alcohol content in the patchouli alcohol self-microemulsion is 10.0%

1.2 Molding method

The mice of other groups except the normal group are molded by adopting the following method, the blank drinking water is firstly used for 7 days, then 2% dextran sulfate is given to the mice for 7 days, the daily drinking water is drunk for 14 days, and the treatment mode of 7 days/14 days at intervals of the dextran sulfate/7 days of the dextran sulfate is used for 3 cycles to induce the generation of chronic colitis. Drug treatment was given at each interval of the circulation.

1.3 preparation method of test sample and reference sample

1.3.1 solvent reference substance preparation and preservation method

Weighing the required amount of sodium carboxymethylcellulose, adding sterilized water for injection, dissolving and fixing the volume to the final concentration of 0.5%. And storing at 2-8 ℃ for later use after preparation.

1.3.2 preparation and preservation methods of patchouli volatile oil, patchouli alcohol self-microemulsion and sulfasalazine

Weighing or measuring required amounts of patchouli volatile oil, patchouli alcohol self-microemulsion and sulfasalazine, adding 0.5% sodium carboxymethylcellulose prepared according to required amounts, stirring, performing ultrasonic treatment until the mixture is uniformly mixed, and storing the mixture at 2-8 ℃ for later use after preparation.

1.4 dosing frequency and mode

The administration is carried out by intragastric administration once a day.

1.5 evaluation of drug efficacy

1.5.1 general case observations

Weighing was started 3 days before the experiment and marked. The animals treated with dextran sulfate were given 2% dextran sulfate solution in drinking water for 7 days, about 5 mL/d/mouse, and the dextran sulfate solution was changed every two days, and the control mice were given normal drinking water. After administration of dextran sulfate, the mice were weighed at a fixed time every day and observed for signs of loose stools, bloody stools, weight loss, or anorexia. The severity of the fecal blood was semi-quantified as a symptom score (clinical scores) using a double-blind method, and observed and recorded twice daily. The scoring method comprises the following steps: normally 0 point; slightly diluted feces are 1 minute; the dilution of the water sample is 2 min; superficial blood + loose stool 3 points; the stool blood was clearly divided into 4 points.

1.5.2 intestinal permeability assay in mice

At the end of the experiment, 5 mice were taken from each group and given fluorescein isothiocyanate-dextran (100mg/mL in phosphate buffer) at a dose of 44mg/100g body weight by gavage after 24h fasting. And (4) taking blood from the orbit after 4h, placing the blood in a micro container SST, collecting serum, diluting the serum with an equal amount of phosphate buffer solution, and placing 100 mu L of the serum in a 96-well plate under 485nm excitation light to detect the amount of fluorescein isothiocyanate-dextran.

1.5.3 serum Collection and Colon Length detection

When the experiment is finished, the eyeballs are picked to take blood, serum is collected by centrifugation and stored in a refrigerator at the temperature of minus 80 ℃; mice were sacrificed by cervical dislocation, the colon of the mice was isolated, rinsed with phosphate buffer, filtered dry with filter paper, the colon length of the mice was measured, and photographed.

1.5.4 pathological examination and scoring

The separated colon was fixed with 10% formalin solution, embedded in paraffin, and sectioned. After conventional dewaxing, sections were stained with hematoxylin-eosin for pathology analysis. Sections stained with H & E were visualized under light microscopy, and colitis and colon destruction were semi-quantitatively graded blindly: the scoring criteria were as follows: firstly, ulcer: three-stage, 0-none, 1-small ulcer (less than 3mm), 2-large ulcer (more than 3 mm); ② inflammation: 0-none, 1-mild, 2-severe; ③ granulation tissue: 0-none, 1-present; fourthly, lesion depth: 0-none, 1-submucosa, 2-muscularis, 3-serosa; fifth, fiberization: 0-none, 1-mild, 2-severe.

1.5.5 mouse peripheral blood inflammatory factor content

ELISA detection kit of Dake is adopted to detect the content of TNF-alpha, IL-1 beta, IL-6 and IL-23 in peripheral blood of mice, and the specific steps are carried out according to the instruction.

The assay for serum TNF- α was as follows:

1) dissolving cytokine standard substance with dilution buffer solution R (1X) on ice, mixing, standing for 10min, and diluting with dilution buffer solution R (1X) to 500, 250, 125, 62.5, 31.3, 15.6 and 7.8 pg/mL;

2) determining the number of required laths according to the number of experimental holes (blank and standard);

3) dilution of sample serum: each sample was diluted by pipetting 30. mu.L serum + 70. mu.L dilution buffer R (1X);

4) sample adding: adding the diluted cytokine standard substance according to 100 mu L/hole, adding the sample to the sample hole according to 100 mu L/hole, and adding the dilution buffer solution R (1X) according to 100 mu L/hole;

5) adding the corresponding detection antibody: 50 μ L/well of biotin-labeled antibody working solution was added. After mixing, covering a sealing plate film, and incubating for 90min at 37 ℃;

6) washing the plate: deducting liquid in the hole, and adding washing buffer solution R (1X) working solution into 300 mu L/hole; after staying for 1min, the liquid in the pores is discarded. Repeating for 4 times, and drying on the filter paper each time;

7) adding an enzyme: horseradish peroxidase labeled streptavidin working solution is added into each 100 mu L/hole. Covering a sealing plate membrane, and incubating at 37 ℃ for 30 min;

8) washing the plate: deducting liquid in the hole, and adding washing buffer solution R (1X) working solution into 300 mu L/hole; after staying for 1min, the liquid in the pores is discarded. Repeating for 4 times, and drying on the filter paper each time;

9) color development: adding 1% 3,3',5,5' -Tetramethylbenzidine (TMB) solution into 100 μ L/well, incubating at 37 deg.C in dark for 15min, and determining termination reaction according to the color shade (dark blue) in the well;

10) and (3) terminating the reaction: adding stop solution into 100 mu L/hole to stop reaction;

11) reading a plate: within 10min of terminating the reaction, reading the value by using the detection wavelength of 450nm, and simultaneously reading the plate by using the correction wavelength of 630 nm;

12) and (4) analyzing results: the optimal standard curve was fitted by Excel and the corresponding concentration was calculated from the OD values of the samples.

The assay procedure for serum IL-1 β, IL-6 and IL-17 was similar to the TNF- α assay procedure.

1.5.6 changes in colonic mucosal inflammatory factor expression in mice

Taking a mouse colon, cleaning, separating an intestinal mucosa, putting the colon into a 1.5mL EP centrifuge tube, shearing, adding 1mL Trizol solution, standing for 3min, extracting total mRNA, and detecting the expression of inflammatory factors TNF-alpha, IL-1 beta, IL-6 and IL-23mRNA by real-time fluorescence quantitative PCR (q-PCR).

Firstly, RNA extraction:

1) fully grinding colon tissues of mice and adding a proper amount of Trizol solution;

2) adding 200 mu L of chloroform;

3) after centrifugation, a 200 mu L pipette is used for sucking the transparent water phase at the upper layer in the original EP centrifuge tube into a new EP centrifuge tube, and the volume of the water phase taken out is about 400-500 mu L;

4) adding 500 mu L of isopropanol to form a precipitate;

5) centrifuging and removing supernatant; mixing with 75% ethanol, washing precipitate;

6) slightly absorbing 75% ethanol on the upper layer by using a 200 mu L pipette gun, standing at room temperature, and air-drying for 5-10 minutes, wherein water can not be obviously seen by naked eyes;

7) adding appropriate amount of diethyl pyrocarbonate treated water (DEPC-treated water), beating with fingers to help complete dissolution;

8) taking 2 mu L of RNA sample to read at 260nm and 280nm to detect the RNA concentration, wherein the optimal RNA concentration is 200-500ng/mL

Reverse transcription to synthesize cDNA:

the real-time fluorescent quantitative PCR (q-PCR) experiment used a reverse transcription kit produced by Yeasen and a gene reaction of reverse transcription using a real-time fluorescent quantitative PCR (q-PCR) instrument in a 20. mu.L reaction system, in strict compliance with the instructions.

Reaction conditions are as follows: 15min at 37 ℃; 5s at 85 ℃; infinity at 4 ℃; the reaction system is shown in Table 2.

TABLE 2 reverse transcription reaction System

③ real-time fluorescent quantitative PCR (q-PCR)

1) The primers were designed using Pubmed Primer Blast, synthesized by Huajin Biotechnology Ltd, Shanghai, and the sequences of the primers are shown in Table 3.

TABLE 3 primer sequences

Primer sequences (5 '-3')	Primer name
		ATCTATGAGGGTTACGCGCTCC	(M)β-actin(F)
CAGCTGTGGTGGTGAAGCTG	(M)β-actin(R)
		GCCAGGAGGGAGAACAGAAACT	(M)TNF-α(F)
AAGAGGCTGAGACATAGGCACC	(M)TNF-α(R)
		ACAAGTCGGAGGCTTAATTACACAT	(M)IL-6(F)
TTGCCATTGCACAACTCTTTTC	(M)IL-6(R)
		TCGCTCAGGGTCACAAGAAA	(M)IL-1β(F)
CATCAGAGGCAAGGAGGAAAA	(M)IL-1β(R)
		AGTGTGAAGATGGTTGTGACCCAC	(M)IL-23(F)
GAAGATGTCAGAGTCAAGCAGGTG	(M)IL-23(R)

2) The reaction system was prepared according to the formulation used in the following table with reference to the instructions of the two-step fluorescent quantitative thermostable reverse transcription PCR kit (Thermo Scientific SYBR Green q-PCR), and the reaction was performed in a 96-well plate. The conditions set for the reaction were: step 1, 95 ℃ for 10 min; step 2: 95 ℃ for 15 s; 60 ℃ for 60 s; the 40 cycles are repeated, and the reaction system is shown in Table 4.

TABLE 4.q-PCR reaction System

2×SYBR Green q-PCR	5μL
		Forward Primer (Forward Primer)10nM	0.5μL
Reverse Primer (Reverse Primer)10nM	0.5μL
		cDNA	1μL
ddH2O	3μL

3) Result processing and analysis

As the reaction is extended, the later stage of the PCR reaction will increase in the form of an exponential increase in the amount of DNA product, and the level of fluorescence will rise, so that the initial cDNA template can be quantitatively analyzed at a certain point in the exponential phase of the DNA. Specifically, a fluorescence threshold value of the exponential phase of DNA is first defined, and the number of cycles that the reaction has undergone at that time point after the threshold value is exceeded is defined as the Ct value. Therefore, by detecting the ratio of the target gene to the reference gene, the content of the target gene in the sample can be relatively quantified.

-ΔΔCt＝ΔCt_{Experimental group}-ΔCt_{Control group}

Wherein Δ Ct ═ Ct_{Target gene}-Ct_{Internal reference gene}

Calculation 2^-ΔΔCtThat is, the expression ratio of the target gene in the experimental group to the target gene in the control group.

1.6 statistical analysis

Statistical processing is carried out by adopting SPSS20.0 software, all data are expressed by x +/-s, the difference is detected by single-factor variance analysis, and the difference is obvious when p is less than 0.05.

2. Results of the experiment

2.1 therapeutic action of patchouli volatile oil, patchouli alcohol self-microemulsion on mice with ulcerative colitis induced by dextran sulfate

In the experiment, the weight of the blank group of mice is continuously increased, the diet and drinking water are normal, the mental state is good, the activity is frequent, and the excrement form is not obviously abnormal; the mice of the dextran sulfate model group are obviously reduced in weight, poor in appetite, cachexia, dislike of activity, dull and lusterless hair, diarrhea, macroscopic bloody stool, pus stool and other symptoms, and appear early and serious. As shown in figure 1, the mice in each administration group have obviously reduced loose stools and bloody stools, and the symptoms are obviously improved compared with the mice in the model group (p < 0.05; p < 0.01; p < 0.001). As shown in figure 2, the body weight of each group of mice began to rise to different degrees after the administration of patchouli volatile oil, patchouli alcohol self-microemulsion compared to the model group. At the end of dosing, the difference in the final body weight of mice in each dosing group was not statistically significant. The hematochezia degree of the mice in the self-microemulsion group of the patchouli alcohol is obviously lower than that of the patchouli alcohol (p < 0.05).

2.2 the patchouli volatile oil, patchouli alcohol and patchouli alcohol self-microemulsion reduce the pathological change degree of mouse ulcerative colitis induced by dextran sulfate

After dissection, the colon of each mouse was taken and measured, and as shown in FIG. 3, the colon length of the model group mice was significantly shorter (p <0.001) than that of the blank group, while the colon length of the mice in each administration group was increased to a different extent (p <0.05 or p <0.001) than that of the model group. The colon length of mice in the high and low dose of patchouli volatile oil group is not statistically different, and the colon length of the mice in the low dose of patchouli volatile oil group is obviously higher than that of the patchouli alcohol group (p < 0.05). The length of colon of the patchouli alcohol self-microemulsion mouse is obviously higher than that of the patchouli alcohol (p is less than 0.001). The difference between the lengths of the colon of the mice in the self-microemulsion group of the patchouli volatile oil and patchouli alcohol at different dosages compared with the sulfasalazine group has no statistical significance.

H & E staining of colon tissues is shown in figure 4, and results show that severe inflammatory cell infiltration occurs in a colon mucosa layer of a mouse of a dextran sulfate model group, local foam tissue cells are gathered, necrosis of different degrees occurs locally, fibroblast hyperplasia exists at the necrotic part, and inflammatory cell infiltration occurs in a mucous muscle layer tissue; the mucosal inflammation of mice in each administration group is obviously improved, the colon mucosal structure of the mice is recovered to a certain degree, the epithelial structure is complete, the infiltration of inflammatory cells is reduced, and the condition of the mice in the administration group is obviously improved compared with that in a model group (p is less than 0.001). Wherein, the low and high dose patchouli volatile oil and patchouli alcohol self-microemulsion mouse colon lesion degree has no statistical significance compared with the difference of the sulfasalazine group, and the patchouli alcohol colon lesion is obviously more serious than the sulfasalazine group (p is less than 0.001). The colon lesion degree of the high-low dose patchouli volatile oil mice is not statistically different, and the colon lesion degree of the low dose patchouli volatile oil mice is obviously lower than that of the patchouli alcohol (p < 0.05). The lesion degree of the patchouli alcohol self-microemulsion mouse ulcerative colitis is obviously lower than that of the patchouli alcohol (p < 0.001).

2.3 Effect of patchouli volatile oil, patchouli alcohol self-microemulsions on the cytokine levels in serum of mice with dextran sulfate induced ulcerative colitis

Compared with the normal group, the contents of inflammatory cytokines such as TNF-alpha, IL-1 beta, IL-6, IL-23 and the like in the serum of the model group mouse are obviously increased (p is less than 0.001); patchouli volatile oil with different dosages, patchouli alcohol and patchouli alcohol self-microemulsion can both obviously reduce the levels (p is less than 0.001) of cytokines such as TNF-alpha, IL-1 beta, IL-6, IL-23 and the like in serum of mice with ulcerative colitis induced by dextran sulfate, as shown in figure 5. The contents of inflammatory cytokines in the serum of mice in the high and low dose patchouli volatile oil group and patchouli alcohol self-microemulsion group are not statistically different from those in the sulfasalazine group, and the content of the inflammatory cytokines in the serum of the patchouli alcohol group is obviously higher than that in the sulfasalazine group (p is less than 0.001). The difference of the cytokine level in the serum of the patchouli volatile oil with high and low doses has no statistical significance, and the content of the inflammatory cytokine in mice with the patchouli volatile oil with low dose is obviously lower than that of the patchouli alcohol (p is less than 0.001). The cytokine levels in serum administered to the patchouli alcohol self-microemulsions were significantly lower than patchouli alcohol (p < 0.001).

2.4 Effect of patchouli volatile oil, patchouli alcohol and patchouli alcohol self-microemulsion on expression level of colon tissue inflammatory factor mRNA of mice with dextran sulfate induced ulcerative colitis

Compared with the normal group, the expression level of mRNA such as TNF-alpha, IL-1 beta, IL-6, IL-23 and the like in colon tissues of the mice in the model group is obviously increased (p is less than 0.001); patchouli volatile oil with different doses, patchouli alcohol and patchouli alcohol self-microemulsion can both obviously reduce the expression level of mRNA (p is less than 0.001) such as TNF-alpha, IL-1 beta, IL-6, IL-23 and the like in colon tissues of mice with ulcerative colitis induced by dextran sulfate, as shown in figure 6. The expression of inflammatory factor mRNA in colon tissues of mice in the low-dose pogostemon cablin volatile oil group is not statistically different from that in the sulfasalazine group, the expression of TNF-alpha and IL-1 beta mRNA in the high-dose pogostemon cablin volatile oil group is obviously lower than that in the sulfasalazine group (p is less than 0.05), and the expression of TNF-alpha mRNA in the low-dose pogostemon cablin volatile oil group is obviously higher than that in the high-dose pogostemon cablin volatile oil group (p is less than 0.05). The expression of the mouse inflammatory cytokine mRNA in the low-dose group of the patchouli volatile oil is obviously lower than that in the patchouli alcohol group (p <0.01 or p < 0.01). The expression level of mRNA of TNF-alpha, IL-1 beta and IL-23 in the self-microemulsion group of patchouli alcohol is obviously lower than that in the sulfasalazine group (p is less than 0.05), and the expression level of mRNA of inflammatory factors in the self-microemulsion group of patchouli alcohol is obviously lower than that in the patchouli alcohol group (p is less than 0.001).

2.5 Effect of patchouli volatile oil, patchouli alcohol self-microemulsion on dextran sulfate induced ulcerative colitis mouse intestinal permeability

Compared with the normal group, the content of fluorescein isothiocyanate-glucan in the serum of the model group mice is obviously increased (p is less than 0.001), which indicates that the intestinal permeability is increased; patchouli volatile oil, patchouli alcohol and patchouli alcohol self-microemulsion with different dosages can obviously reduce the content of fluorescein isothiocyanate-glucan (p is less than 0.001) in the serum of ulcerative colon mice induced by dextran sulfate, namely reduce the intestinal permeability of the ulcerative colon mice, as shown in figure 7. Wherein the content of fluorescein isothiocyanate-glucan in the serum of the patchouli alcohol group mice is obviously higher than that of the sulfasalazine group (p is less than 0.001), and the content of fluorescein isothiocyanate-glucan in the serum of other groups of mice has no statistical difference with that of the sulfasalazine group. The difference of the intestinal permeability of the high and low dose of the patchouli volatile oil has no statistical significance, and the intestinal permeability of the mice in the low dose group of the patchouli volatile oil is obviously lower than that of the patchouli alcohol group (p is less than 0.01). The intestinal permeability of the patchouli alcohol self-microemulsion mice is obviously lower than that of the patchouli alcohol (p is less than 0.001).

3. Conclusion

The patchouli volatile oil, the patchouli alcohol and the patchouli alcohol self-microemulsion have a certain treatment effect on mice with the ulcerative colitis induced by the dextran sulfate, can relieve the pathological change degree of the mice with the ulcerative colitis induced by the dextran sulfate, can reduce the levels of cytokines such as TNF-alpha, IL-1 beta, IL-6, IL-23 and the like in the serum of the mice, can reduce the mRNA expression levels of the TNF-alpha, IL-1 beta, IL-6 and IL-23 in colon tissues, and can reduce the intestinal permeability of the mice with the ulcerative colitis. The treatment effect of the patchouli volatile oil on the mouse ulcerative colitis is equivalent to that of a positive medicament, and no obvious dose dependence exists; the low dose of the patchouli volatile oil has better drug effect than equal patchouli alcohol; the therapeutic effect of the patchouli alcohol self-microemulsion on mouse ulcerative colitis is obviously better than that of patchouli alcohol, and the consideration is mainly that the bioavailability of oral administration of patchouli alcohol is improved due to the patchouli alcohol self-microemulsion.

Curing technology of patchouli oil

1 patchouli oil inclusion compound preparation technology

Preparing patchouli oil solution with ratio of 1:2 by using the patchouli volatile oil and absolute ethyl alcohol; and (3) mixing the hydroxypropyl-beta-cyclodextrin and the sulfobutyl-beta-cyclodextrin according to the proportion of 5 (0-5), and preparing a saturated solution by using water. At normal temperature, according to the following weight percentage of patchouli oil: hydroxypropyl- β -cyclodextrin: and (2) adding the sulfobutyl-beta-cyclodextrin (1: 5) (0-5) into a cyclodextrin saturated solution at a feeding ratio, dropwise adding the patchouli oil solution into the cyclodextrin saturated solution at a slow speed, continuously stirring for 1-2h for inclusion, standing at 4 ℃, performing suction filtration to remove insoluble substances, standing at-80 ℃ overnight, and performing freeze drying to obtain the inclusion compound.

2 preparation of patchouli oil dry suspension

2.1 preparation method

2.1.1 sieving the auxiliary materials: crushing related solid auxiliary materials and sieving the crushed solid auxiliary materials with a 100-mesh sieve;

2.1.2 mixing: placing the patchouli oil, simethicone and wetting agent in a mortar according to the prescription amount, grinding for 30-45 min, adding a filling agent which is 40-60% of the weight of the filling agent, adsorbing and uniformly mixing, and uniformly mixing with the rest filling agent, the suspending agent and the wetting agent according to the equivalent progressive method;

2.1.3 granulation and finishing: adding an adhesive to prepare a soft material, sieving with a 20-mesh sieve, granulating, drying in a drying oven at 40-60 ℃ for 2-3 h, spraying essence, and sieving with a 20-mesh sieve to obtain the patchouli oil dry suspension.

2.1.4 preparation description: patchouli oil is viscous oily liquid, has poor fluidity and is not easy to be uniformly mixed with solid auxiliary materials, so in the preparation process of the dry suspension, part of filler is used for adsorbing the patchouli oil, and then the patchouli oil is stirred with the rest solid auxiliary materials according to an equivalent progressive method and then is sieved and mixed, and then wet granulation and size stabilization are carried out. Wherein, the sieving method has the advantages of simple operation, low energy consumption and easy and uniform mixing. Wet granulation can reduce the specific surface area of the particles and reduce the hygroscopicity of the particles.

2.2 prescription screening

(I) Filler screening

Fixing other adjuvants, and screening common filler mainly comprising soluble starch, sucrose, dextrin, lactose, microcrystalline cellulose, etc. The results of the screening according to taste, adsorption effect, suspension effect, etc. are shown in Table 5.

TABLE 5 Filler screening results

Species of	Taste of the product	Adsorption effect	Suspension effect
				Soluble starch	In general	Good taste	Good taste
Sucrose	Is preferably used	Difference (D)	In general
				Dextrin	In general	Good taste	In general
Lactose	Is preferably used	In general	Good taste
				Microcrystalline cellulose	Difference (D)	In general	Difference (D)

The result shows that the sucrose is better in taste, but has poorer adsorption effect, the microcrystalline cellulose is poorer in suspension effect, and one or more of soluble starch, dextrin, lactose and the like with better adsorption effect are considered to be preferred to be used as the filler of the patchouli oil dry suspension agent in combination with the property of the patchouli oil.

(II) screening suspending agent

Fixing other adjuvants, and screening conventional suspending agent mainly comprising carbomer 940, agar, xanthan gum, sodium carboxymethylcellulose, etc., and examining according to its solubility and suspending effect, the results are shown in Table 6.

TABLE 6 suspending agent screening results

Species of	Dissolution behavior	Suspension effect
			Carbomer 940	Is difficult to be dissolved when forming into clusters in water	Difference (D)
Agar-agar	Poor solubility	Difference (D)
			Xanthan gum	Slow dissolution	Has good suspension effect
Sodium carboxymethylcellulose	Is well dissolved	In general

The results show that the suspending effect of carbomer 940 and agar is poor, the suspending effect of the reducing agent is good, but the dissolution is slow, and the suspending effect of sodium carboxymethylcellulose is general, but the solubility is good, so that one or more of carbomer 940, agar, xanthan gum and sodium carboxymethylcellulose are considered to be selected for screening. In order to examine the optimal proportion, the xanthan gum is mixed with other suspending agents for use, and the suspending agent is further screened and examined.

(III) suspension agent combination proportion screening

Through the tests, the use ratio of the suspension carboxymethylcellulose sodium and the xanthan gum is considered to be combined, the screening is further carried out according to the ratio of the carboxymethylcellulose sodium to the xanthan gum of 1:1, 3:1 and 5:1, and the suspension effect is shown in table 7.

TABLE 7 suspension ratio Screen

Species of	Ratio of	Results
			Sodium carboxymethylcellulose xanthan gum	1:1	High viscosity
Sodium carboxymethylcellulose xanthan gum	3:1	Is preferably used
			Sodium carboxymethylcellulose xanthan gum	5:1	Poor suspension

The results show that the preferred ratio is when the ratio of sodium carboxymethylcellulose to xanthan gum is 3: 1.

(IV) surfactant screening

Fixing other auxiliary materials, screening common surfactants, mainly comprising common Tween 80, Tween 20, Tween 85, span 20 and 0.5% sodium dodecyl sulfate solution, determining stability according to suspension effect and suspension settlement condition, and examining, wherein the screening result is shown in Table 8.

TABLE 8 surfactant screening results

The result shows that the effect of the Tween 80 and the Tween 85 is better, the sodium dodecyl sulfate has certain bubbles, and the suspension effect of the Tween 20 and the span 20 is general, so that one or more of the Tween 80, the Tween 20, the Tween 85 and the span 20 are considered to be selected as the surfactant.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and additions can be made without departing from the principle of the present invention, and these should also be considered as the protection scope of the present invention.

The invention will be further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Furthermore, it should be understood that various changes and modifications can be made by those skilled in the art after reading the disclosure of the present invention, and equivalents fall within the scope of the appended claims.

Example 1

A construction method of a GC-MS characteristic spectrum of patchouli oil comprises the following steps:

(1) preparation of control solutions: and (3) dissolving 1-2mg of patchouli alcohol and patchouli ketone reference substances in n-hexane respectively.

(2) Preparation of a test solution: and respectively transferring 50 mu L of a commercially available sample, respectively adding 200 mu L of n-hexane, and shaking up to obtain a sample solution.

(3) The chromatographic and mass spectrometric detection conditions are shown in table 9:

TABLE 9 GC-MS chromatography and Mass Spectrometry conditions

(4) Analysis and determination: absorbing 1 mu L of a test solution to be tested to be injected into a gas mass spectrometer for GC-MS detection, analyzing the chromatographic and mass spectrum information of a reference solution and the test solution, matching with a GC-MS NIST database to obtain qualitative attribution information of 13 characteristic peaks, obtaining qualitative information of a characteristic spectrum and the composition of a compound of the characteristic spectrum, and analyzing to obtain the chemical names, CAS numbers, molecular formulas and other results of the 13 characteristic peaks shown in Table 10, wherein each batch of samples all represent 13 chromatographic peaks, except 11 peaks in each sample, the attributions of the other 12 peaks are the same substances, which indicates that the components of each batch of samples are basically consistent, and the types and the number of the detected compounds have better similarity, wherein the relative peak area of patchouli alcohol in each batch of volatile oil is the highest and is 30.92-33.16%. And generating a feature map overlapping graph and a comparison graph of patchouli oil, which are respectively shown in figure 8 and figure 9.

TABLE 10.5 information on the compounds in the characteristic profile of the patchouli oil samples

Example 2

And (3) detecting GC-FID (gas chromatography-FID) fingerprint of the patchouli oil:

(1) preparation of internal standard solution and preparation of reference solution: precisely weighing 142.24mg of n-octadecane into a volumetric flask, adding n-hexane to a constant volume of 10mL, and shaking up for later use; accurately weighing 6.399mg of patchouli alcohol reference substance into a volumetric flask, accurately adding 0.2mL of internal standard solution, and diluting to 2mL with n-hexane; accurately weighing 4.736mg of patchoulenone reference substance into a volumetric flask, accurately adding 0.2mL of internal standard solution, and carrying out constant volume treatment to 2mL by using n-hexane.

(2) Preparation of a test solution: and transferring 50 mu L of a commercially available sample, respectively adding 200 mu L of n-hexane, and shaking up to obtain a sample solution.

(3) The chromatographic conditions are shown in Table 11:

TABLE 11 chromatographic conditions determined by GC-FID method

(4) Analyzing and detecting:

and respectively introducing GC-FID spectra of samples in different batches into a traditional Chinese medicine chromatogram fingerprint similarity evaluation system in an AIA format, setting an S1 chromatogram as a reference chromatogram, performing multi-point correction on a chromatogram peak of retention time, automatically matching, and generating a reference fingerprint, wherein the result is shown in figure 10. Similarity evaluation is carried out on 5 batches of samples by using traditional Chinese medicine chromatographic fingerprint similarity evaluation software, the similarity of 5 batches of patchouli oil fingerprints reaches 0.998, which shows that the samples of each batch have no obvious difference in main components, and the patchouli oil is proved to have good quality stability, and the results are shown in Table 12.

TABLE 12.5 similarity of fingerprint spectra of patchouli oil batches

Atlas	S1	S2	S3	S4	S5
						S1	1.000	0.999	0.998	0.999	1.000
S2	0.999	1.000	0.999	1.000	1.000
						S3	0.998	0.999	1.000	0.999	0.999
S4	0.999	1.000	0.999	1.000	1.000
						S5	1.000	1.000	0.999	0.999	1.000

Example 3

Measuring the content of patchouli ketone and patchouli alcohol in patchouli oil:

(1) preparation of control solutions: dissolving 1-2mg of pogostone and pogostenol respectively in n-hexane.

(3) The chromatographic conditions are shown in Table 11 of example 2.

(4) Analyzing and detecting: and (4) quantifying by using an internal standard method by adopting a GC-FID method, and measuring and calculating to obtain the content of the patchouli spring and the content of the patchouli ketone.

(5) The content of patchouli alcohol and patchouli ketone is shown in Table 13 and figure 11.

TABLE 13 determination of patchouli oil content in different batches (n ═ 2)

Numbering	Name (R)	Content of patchouli alcohol/%)	Content/% of patchoulenone	Alcohols/ketones
					1	S1	33.3	1.08	30:1
2	S2	33.6	2.28	14:1
					3	S3	33.3	1.43	23:1
4	S4	33.6	1.96	17:1
					5	S5	33.7	1.53	22:1

According to the regulation of the 'Chinese pharmacopoeia' of the 2015 edition, the patchouli alcohol contained in the patchouli oil is less than 26%, so that 5 batches of samples are higher than the requirements of the pharmacopoeia. The content range ratio of the patchouli alcohol to the patchouli ketone is 14: 1-35: 1; wherein, the preferable content ratio of the patchouli alcohol to the patchouli ketone is 30: 1.

Example 5

Preparing the patchouli oil inclusion compound:

preparing patchouli oil solution with the ratio of 1:2 by using patchouli volatile oil and absolute ethyl alcohol, mixing hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin according to the proportion of 5:0, preparing saturated solution by using 20mL of water, dripping the patchouli oil solution into the cyclodextrin saturated solution according to the feeding ratio of the patchouli oil to the two cyclodextrins of which the liquid-solid ratio is 1:8 at normal temperature, continuously stirring for 1-2h for inclusion, standing at 4 ℃, removing insoluble substances by suction filtration, standing overnight at-80 ℃, and freeze-drying to obtain the inclusion compound. The inclusion rate is 73.3 percent, and the drug loading rate is 12.2 percent.

Example 6

Preparing the patchouli oil inclusion compound:

preparing patchouli oil solution with the ratio of 1:2 by using patchouli volatile oil and absolute ethyl alcohol, mixing hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin according to the proportion of 5:3, preparing saturated solution by using 25mL of water, dripping the patchouli oil solution into the cyclodextrin according to the liquid-solid ratio of the patchouli oil to the two cyclodextrins of 1:8 at normal temperature, continuously stirring for 1.5h for inclusion, standing at 4 ℃, performing suction filtration to remove insoluble substances, standing at-80 ℃ overnight, and performing freeze drying to obtain the inclusion compound. The inclusion rate was 83.3% and the drug loading was 9.3%.

Example 7

Preparing the patchouli oil inclusion compound:

preparing patchouli oil solution with the ratio of 1:2 by using patchouli volatile oil and absolute ethyl alcohol, mixing hydroxypropyl-beta-cyclodextrin and sulfobutyl-beta-cyclodextrin according to the proportion of 5:5, preparing saturated solution by using 40mL of water, dripping the patchouli oil solution into the cyclodextrin according to the liquid-solid ratio of the patchouli oil to the two cyclodextrins of 1:10 at normal temperature, continuously stirring for 2h for inclusion, standing at 4 ℃, carrying out suction filtration to remove insoluble substances, standing at-80 ℃ overnight, and carrying out freeze drying to obtain the inclusion compound with the inclusion rate of 83.5% and the drug loading rate of 7.59%.

Example 8

Preparing patchouli oil dry suspension:

(1) prescription:

composition of	Mass/g
		Patchouli oil
	10
		Simethicone	1
Soluble starch	50
		Sodium carboxymethylcellulose	3
Xanthan gum	1
		Tween 80	5
Water (W)	Proper amount of

(2) The preparation process comprises the following steps:

sieving auxiliary materials: crushing related solid auxiliary materials and sieving the crushed solid auxiliary materials with a 100-mesh sieve;

mixing: placing the patchouli oil, simethicone and wetting agent in a mortar according to the prescription amount, grinding for 30-45 min, adding a filling agent which is 40-60% of the weight of the filling agent, uniformly adsorbing, and uniformly mixing with the rest filling agent, the suspending agent and the wetting agent according to the equivalent progressive method;

granulating and finishing: adding a binding agent to prepare a soft material, sieving with a 20-mesh sieve, granulating, placing in a drying oven at 40-60 ℃ for drying for 2-3 h, spraying essence, sieving with the 20-mesh sieve, and grading to obtain the patchouli oil dry suspension.

And (4) checking: according to the general inspection of pharmacopeia preparations, the drying weight loss is 0.31 percent, and the sedimentation ratio of the suspension is 0.98.

Example 9

Preparing the patchouli oil dry suspension:

(1) prescription:

composition of	Mass/g
		Patchouli oil
	10
		Simethicone	1
Soluble starch	50
		Lactose	50
Sodium carboxymethylcellulose	3
		Xanthan gum	1
Tween 80	5
		Water (W)	Proper amount of

(2) The preparation process comprises the following steps:

granulating and finishing: adding a binding agent to prepare a soft material, sieving with a 20-mesh sieve, granulating, drying in a drying oven at 40-60 ℃ for 2-3 h, and sieving with a 20-mesh sieve, and grading to obtain the patchouli oil dry suspension.

2.4 checking: according to the general inspection of pharmacopeia preparations, the drying weight loss is 0.54 percent, and the sedimentation ratio of the suspension is 0.93.

Example 10

Preparing a patchouli dry suspension:

(1) prescription:

(2) the preparation process comprises the following steps:

And (4) checking: according to the general inspection of pharmacopeia preparations, the drying weight loss is 0.58 percent, and the sedimentation ratio of the suspension is 0.96.

Claims

1. A quality detection method for patchouli oil comprises the following steps:

s1: measuring the map of the patchouli oil by using GC-MS;

2. The method for detecting the quality of patchouli oil according to claim 1, wherein

In step S3, if the ratio of the sum of the peak areas corresponding to patchouli, delta-guaiene, patchouli alcohol and patchouli ketone is greater than 70%, and the relative peak area of patchouli alcohol is greater than 30%, it is determined that the quality of patchouli oil is acceptable.

3. The method for detecting the quality of patchouli oil according to claim 1, wherein

Step S1 includes: transferring patchouli oil sample, adding n-hexane, and shaking up to obtain test solution;

4. A quality detection method for patchouli oil comprises the following steps:

s1: measuring the map of the patchouli oil by using GC-FID;

s3: and (4) quantitatively obtaining the proportion range of the patchouli alcohol and the patchouli ketone by an internal standard method according to the map in the step S1 and the comparison fingerprint map in the step S2, wherein if the proportion range of the patchouli alcohol and the patchouli ketone is 14: 1-35: 1, the quality of the patchouli oil is qualified.

5. The method for detecting the quality of patchouli oil according to claim 4, wherein,

in step S3, if the ratio of patchouli alcohol to patchouli ketone is in the range of 28:1 to 32:1, the quality of patchouli oil is qualified.

6. The method for detecting the quality of patchouli oil according to claim 4, wherein,

step S1 specifically includes: adding patchouli oil into n-hexane, and shaking up to obtain a solution to be detected;

the chromatographic conditions are as follows:

7. A patchouli oil clathrate is prepared from patchouli oil, and water, wherein,

the mass ratio of the patchouli oil to the hydroxypropyl-beta-cyclodextrin to the sulfobutyl-beta-cyclodextrin is 1:5: 0.1-1: 5: 5.

8. A process for the preparation of patchouli oil clathrate according to claim 7, the process comprising:

9. A patchouli oil dry suspension, wherein the mass fraction of patchouli oil in the dry suspension is 5-15%,

10. The preparation method of patchouli oil dry suspension according to claim 9,

the method comprises pulverizing, sieving, mixing, granulating and grading.

11. Use of patchouli oil clathrate according to claim 7 or patchouli oil dry suspension according to claim 9 in the manufacture of a medicament for the treatment of ulcerative colitis.