CN113528624A

CN113528624A - Method and kit for amplifying and detecting nucleic acid

Info

Publication number: CN113528624A
Application number: CN202010307560.7A
Authority: CN
Inventors: 石超; 刘蒙蒙; 李阳; 马翠萍
Original assignee: Qingdao University
Current assignee: Qingdao jiancodegene Technology Co.,Ltd.
Priority date: 2020-04-17
Filing date: 2020-04-17
Publication date: 2021-10-22

Abstract

Provided herein are methods of denatured vesicle-mediated amplification of target nucleic acids and related kits and uses thereof. The method promotes the generation of the modified bubbles in the double-stranded target nucleic acid molecules through the thermal cycle of rapid temperature change, thereby accelerating the strand displacement amplification (SEA) reaction. The kit comprises specifically designed primers and a polymerase for performing the method. The methods and kits disclosed herein can be used in a variety of contexts, such as diagnosis of infectious or genetic diseases, sample quality control, and Single Nucleotide Polymorphism (SNP) analysis.

Description

Method and kit for amplifying and detecting nucleic acid

Technical Field

The invention relates to the technical field of biology, in particular to an improved denatured vacuole mediated target nucleic acid amplification method, a special kit and application thereof.

1. Background of the invention

Nucleic acids can be divided into deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), which are essential elements of all life forms. DNA carries genetic information and is responsible for the basic unit of amino acids that encode proteins. RNA plays an important role in the coding, decoding, regulation and expression of genes. Thus, nucleic acids have been applied as important biomarkers for biological research and medical diagnosis. The nucleic acid amplification technology provides an important theoretical basis for the detection of pathogenic microorganisms, the tracing and identification of biological materials (such as meat) and the detection of other genes. The establishment of a simple, easy to operate, sensitive and rapid nucleic acid detection method is a major goal in the field of biological detection.

Ever since the invention of Polymerase Chain Reaction (PCR), it has been the focus of research by researchers to continuously improve the detection efficiency and sensitivity of this technology. However, the limitations of polymerase kinetics and the temperature ramp rate of the thermal cycler allow the PCR amplification reaction to be completed in an hour or more. Therefore, improving these two key factors (enzyme system and instrument performance) is the key to shortening the amplification time. With improvements in enzyme systems and commercial rapid ramping instruments, PCR amplification time has been reduced from the early 4 hours to about 1 hour today. However, no commercial apparatus is currently available that can further shorten the reaction time.

The current commercial thermal cycler mainly carries out energy transfer through a typical 25-50 muL reaction system, which is also the main reason that the energy transfer rate is limited and the intrinsic reaction time is difficult to reduce. Thus, some researchers have begun to rapidly perform energy transfer and heating on liquid samples using infrared lamps, droplet infrared lasers, microwaves, droplet microwave fields, and the like. However, these non-contact heating methods still have deficiencies in sensitivity and accuracy, thereby limiting their application in research. On the other hand, researchers have utilized microfluidic technology to reduce the volume of the reaction chamber, increasing the reaction rate by reducing the time to transfer energy into and out of the sample. For example, the new platform of small volume PCR, droplet PCR, etc., can realize rapid PCR amplification, but still has the problems of small flux, complex process, etc. Despite various attempts, methods based on rapid PCR amplification (e.g., rapid cycle PCR and rapid PCR) are still limited by the development and commercialization of customized thermal cycling devices. There is no report on whether the above-mentioned problems can be solved by optimizing the current isothermal nucleic acid amplification technology.

In this case, a series of Isothermal nucleic Acid Amplification techniques, such as Loop-Mediated Isothermal Amplification (LAMP), Helicase-dependent Isothermal Amplification of nucleic acids (HDA), and Strand Exchange Amplification (SEA) based on denatured vacuole Mediated Strand displacement, have been developed in succession to replace PCR. The LAMP technology is well known because of high sensitivity and strong specificity, but the LAMP technology is easy to cause sample pollution, is difficult to design primers and cannot realize the detection of targets of highly mutant species. Two enzymes are needed in the reaction system of the HDA technology, and the double-enzyme system is easy to cause nonspecific amplification and influence the judgment of experimental results. These disadvantages limit the widespread use of these technologies to some extent.

A denatured vesicle-Mediated Strand displacement Amplification (SEA) technology is a denatured vesicle-Mediated isothermal Amplification technology of nucleic acid based on DNA respiration, and the reaction can be completed only by one enzyme and one pair of primers. The primers are exponentially amplified by invading the denatured bubble portion produced by DNA respiration, extending and displacing the original complementary strand under the action of the polymerase. The SEA technology described in patent CN 109136337A enables amplification and detection of 1.0X 10 ^-14M nucleic acid.

Based on the above-mentioned existing research, there is still a need to establish a high-throughput and stable nucleic acid amplification technology suitable for the traditional laboratory. The present invention addresses this need in the art.

2. Summary of the invention

SEA is an isothermal nucleic acid amplification method based on the principle that DNA respiration causes the spontaneous formation of a denatured bubble in double-stranded DNA (dsDNA), and then a pair of primers invades the denatured bubble to bind to one of the DNA strands and extend under the action of polymerase to displace the original complementary strand to produce an amplification product. Thus, the method does not need to rely on a thermal cycler, and can directly initiate an isothermal PCR reaction using denatured bubbles spontaneously formed from template DNA at a constant temperature (Shi et al, "triggeralternate PCR by condensation-mediated strand and exchange amplification" Chem Commun (Camb) (2016) 4; 52(77): 11551-4).

The present invention discloses the significant discovery in the course of improving SEA technology that by rapidly varying the reaction temperature, the efficiency and rate of the amplification reaction can be significantly increased even for a small range of temperature variations. Therefore, this application is referred to as "fast SEA". Accordingly, one aspect of the present disclosure provides a novel method for amplifying and detecting a target nucleic acid in a sample. In some embodiments, the method comprises an amplification mixture comprising a polymerase, a pair of primers, and a sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; the amplification mixture is then subjected to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA; and wherein the difference between the first temperature and the second temperature is less than about 30 ℃. In some embodiments, the method comprises an amplification mixture comprising a polymerase, a pair of primers, and a sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; the amplification mixture is then subjected to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA; and wherein the difference between the first temperature and the second temperature is less than about 25 ℃. In some embodiments, the method comprises an amplification mixture comprising a polymerase, a pair of primers, and a sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; then subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA; and wherein the difference between the first temperature and the second temperature is less than about 20 ℃. In some embodiments, the method further comprises detecting the sequence of the amplification product. In some embodiments, the method further comprises performing a diagnosis based on the detection.

In a particular embodiment, the difference between the first temperature and the second temperature is about 10-15 ℃. In more specific embodiments, the difference between the first and second temperatures is about 10 ℃, about 11 ℃, about 12 ℃, about 13 ℃, about 14 ℃, or about 15 ℃.

In some embodiments, the polymerase has an optimal temperature for catalyzing primer extension during PCR. In a particular embodiment, the optimal temperature is within a range of ± 6 ℃ of the first temperature. In a particular embodiment, the optimal temperature is within ± 6 ℃ of the second temperature. In a particular embodiment, the optimal temperature is between the first temperature and the second temperature.

In some embodiments, the sequence of the target nucleic acid molecule amplified by the present method has a first melting temperature, and wherein the first temperature is within ± 5 ℃ of the first melting temperature. In some embodiments, the pair of oligonucleotide primers has an average melting temperature, and wherein the second temperature is within ± 5 ℃ of the average melting temperature. In some embodiments, the mean melting temperature is within ± 5 ℃ of the optimal temperature for the polymerase. In some embodiments, one of the pair of oligonucleotide primers has a second melting temperature and the other of the pair of oligonucleotide primers has a third melting temperature, wherein the difference between the second and third degrees of melting is less than about 3 ℃.

In some embodiments, the first melting temperature is determined using a computer algorithm based on the sequence of the target nucleic acid molecule. Additionally or alternatively, in some embodiments, the second melting temperature is determined using a computer algorithm based on the sequence of the oligonucleotide primer. Additionally or alternatively, in some embodiments, the third melting temperature is determined using a computer algorithm based on the sequence of the oligonucleotide primer. In some embodiments, the computer algorithm is selected from NUPACK, DNAMelt, NOVOPRO, BLAST, Primer Premier, alignnminer, Oligo, PerlPrimer, Primer3Web, and DNAstar. In some embodiments, the method further comprises determining the first, second and/or third melting temperatures.

In some embodiments, the polymerase is a thermostable polymerase. In some embodiments, the polymerase has strand displacement activity. In some embodiments, the polymerase has reverse transcriptase activity.

In some embodiments, the polymerase is Bst DNA polymerase or an isomerase thereof, or a functional derivative having at least 80% sequence identity. In particular embodiments, the polymerase is a Bst DNA polymerase large fragment or isomerase thereof, or a functional mutant with at least 80% sequence identity. In particular embodiments, the polymerase is full-length Bst DNA polymerase, Bst DNA polymerase large fragment, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase or Bst 3.0 DNA polymerase. In a particular embodiment, when the polymerase is any polymerase described in this paragraph, the first temperature is in the range of about 68-78 ℃ and the second temperature is in the range of about 55-69 ℃.

In some embodiments, the polymerase is DNA polymerase I or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is a DNA polymerase I large fragment (Klenow), or isomerase enzyme thereof, or functional mutant having at least 80% sequence identity. In particular embodiments, the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow) or Klenow exo^-. In particular embodiments, when the polymerase is any polymerase described in this paragraph, the first temperature is in the range of about 50-60 ℃ and the second temperature is in the range of about 30-40 ℃.

In some embodiments, the polymerase is Vent DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In particular embodiments, the polymerase is Vent DNA polymerase, Vent (exo-) DNA polymerase, Deep Vent DNA polymerase, or Deep Vent (exo-) DNA polymerase. In a particular embodiment, when the polymerase is any polymerase described in this paragraph, the first temperature is in the range of about 70-80 ℃ and the second temperature is in the range of about 55-70 ℃.

In some embodiments, the polymerase is phi29 DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In particular embodiments, when the polymerase is any polymerase described in this paragraph, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is selected from the range of about 20-37 ℃.

In some embodiments, the polymerase is Taq DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In particular embodiments, the polymerase is Taq DNA polymerase, hot start Taq DNA polymerase, EpiMark hot start Taq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase. In particular embodiments, when the polymerase is any polymerase described in this paragraph, the first temperature is in the range of about 70-88 ℃ and the second temperature is in the range of about 58-70 ℃.

In some embodiments, the length of the amplified sequence and the length of the at least one primer are in the range of about 30-60%. In particular embodiments, the amplified sequence is about 20-50 base pairs (bp) in length. In particular embodiments, the primer is about 15 to about 25 nucleotides (nt) in length.

In some embodiments, the melting temperature (T) of at least one primer_mValue) is within ± 5 ℃ of the optimal temperature of the polymerase. In some embodiments, T of the primer_mThe difference between the values is less than 1 deg.c. In some embodiments, the G/C content of at least one primer is about 40% to about 60%. In some embodiments, the difference in percent G/C content between primers is less than 20%. In some embodiments, each primer comprises an extension end to which the polymerase can add nucleotides during PCR, and wherein the primer has a G or C at the extension end. In some embodiments, each primer comprises an extension end to which the polymerase can add nucleotides during PCR, and wherein the primers have a G/C content of at least 40% in a contiguous 5-nucleotide region comprising the extension end.

In some embodiments, each thermal cycle comprises incubating the amplification mixture at the first temperature for less than 2s, and incubating the amplification mixture at the second temperature for less than 2 s. In some embodiments, each thermal cycle further comprises a ramp time of less than 10 seconds. In some embodiments, each thermal cycle comprises incubating the amplification mixture at the first temperature for about 1s and incubating the amplification mixture at the second temperature for about 1s, and wherein the temperature change time is less than 2 s. In some embodiments, the method completes at least 35 thermal cycles in less than 10 minutes, or completes at least 40 thermal cycles in less than 8 minutes.

In some embodiments, the amplification mixture further comprises dUTPs. In some embodiments, the amplification mixture does not comprise dTTPs. In some embodiments, the amplification mixture further comprises uracil-DNA glycosylase (UDG). In some embodiments, the amplification mixture further comprises a single-chain binding protein (SSB). In some embodiments, the amplification mixture further comprises polyethylene glycol.

In some embodiments, the amplification mixture comprises no more than 1.0X 10^-12A target nucleic acid for M. In some embodiments, the amplification mixture comprisesLess than 10 copies of the target nucleic acid. In some embodiments, the amplification mixture comprises a polymerase at a concentration of not less than 0.1U/. mu.L. In some embodiments, the amplification mixture comprises a concentration of not less than 1.0X 10 ^-6At least one primer of M. In some embodiments, the amplification mixture comprises at least 0.5% volume fraction of polyethylene glycol. In some embodiments, the amplification mixture comprises SSB at a concentration of at least 1 μ g/mL. In some embodiments, the volume of the amplification mixture is about 1-30 μ L.

In some embodiments, the thermocycling step is performed at an ramping rate of at least 10 ℃/s by adding the amplification mixture to the microfluidic device. In some embodiments, the target nucleic acid is a double-stranded nucleic acid molecule or a single-stranded nucleic acid molecule. In some embodiments, the target nucleic acid is DNA or RNA.

In another aspect, the present disclosure also provides related methods for detecting a target nucleic acid molecule in a sample. In some embodiments, the method comprises the steps of including in the amplification mixture a polymerase, a pair of primers, and a nucleic acid sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; then subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA to detect amplification products in the amplification mixture; and wherein the difference between the first and second temperatures is less than about 30 ℃. In some embodiments, the method comprises the steps of including in the amplification mixture a polymerase, a pair of primers, and a nucleic acid sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; then subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA to detect amplification products in the amplification mixture; and wherein the difference between the first and second temperatures is less than about 25 ℃. In some embodiments, the method comprises the steps of including in the amplification mixture a polymerase, a pair of primers, and a nucleic acid sample; in the reaction process, the primer and the target nucleic acid carry out specific molecular hybridization; then subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the sequence of the target nucleic acid molecule by rapid SEA to detect amplification products in the amplification mixture; and wherein the difference between the first and second temperatures is less than about 20 ℃. In particular embodiments, the detection is performed every 1, 2, 5, or 10 thermal cycles. In particular embodiments, the change in product yield is detected by detecting a fluorescent signal of the amplified product during the reaction.

In another aspect, the present disclosure also provides related methods for diagnosing a pathogen infection in a subject. In some embodiments, the method comprises providing a sample comprising nucleic acids collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primer specifically hybridizes to an infectious pathogen nucleic acid; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the pathogen sequence by Polymerase Chain Reaction (PCR) to detect the presence or absence of an amplification product in the amplification mixture; wherein the difference between the first and second temperatures is less than about 30 ℃. In some embodiments, the method comprises providing a sample comprising nucleic acids collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primer specifically hybridizes to an infectious pathogen nucleic acid; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the pathogen sequence by Polymerase Chain Reaction (PCR) to detect the presence or absence of an amplification product in the amplification mixture; wherein the difference between the first and second temperatures is less than about 25 ℃. In some embodiments, the method comprises providing a sample comprising nucleic acids collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primer specifically hybridizes to an infectious pathogen nucleic acid; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the pathogen sequence by Polymerase Chain Reaction (PCR) to detect the presence or absence of an amplification product in the amplification mixture; wherein the difference between the first and second temperatures is less than about 20 ℃. In particular embodiments, the sample comprises genomic nucleic acid from the subject or episomal nucleic acid from the subject. In a particular embodiment, the sample is a bodily fluid sample. In particular embodiments, the pathogen is a virus, bacterium, fungus, or parasite.

In another aspect, the present disclosure also provides related methods for detecting a genetic alteration in a subject. In some embodiments, the method comprises providing a nucleic acid-containing sample collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primers are designed to amplify a target sequence of a genome of a subject suspected of containing a genetic alteration; subjecting the amplification mixture to a plurality of thermal cycles at a temperature between a first temperature and a second temperature, thereby amplifying the target sequence by Polymerase Chain Reaction (PCR); wherein the difference between the first and second temperatures is less than about 30 ℃. The amplified sequence is sequenced to determine whether a genetic alteration is present. In particular embodiments, the genetic alteration is a mutation in the gene due to a nucleotide substitution, deletion, insertion, or copy number variation. In some embodiments, the method comprises providing a nucleic acid-containing sample collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primers are designed to amplify a target sequence of a genome of a subject suspected of containing a genetic alteration; subjecting the amplification mixture to a plurality of thermal cycles at a temperature between a first temperature and a second temperature, thereby amplifying the target sequence by Polymerase Chain Reaction (PCR); wherein the difference between the first and second temperatures is less than about 25 ℃. The amplified sequence is sequenced to determine whether a genetic alteration is present. In particular embodiments, the genetic alteration is a mutation in the gene due to a nucleotide substitution, deletion, insertion, or copy number variation. In some embodiments, the method comprises providing a nucleic acid-containing sample collected from a subject, contacting with a polymerase and a pair of oligonucleotide primers, thereby forming an amplification mixture; wherein the primers are designed to amplify a target sequence of a genome of a subject suspected of containing a genetic alteration; subjecting the amplification mixture to a plurality of thermal cycles at a temperature between a first temperature and a second temperature, thereby amplifying the target sequence by Polymerase Chain Reaction (PCR); wherein the difference between the first and second temperatures is less than about 20 ℃. The amplified sequence is sequenced to determine whether a genetic alteration is present. In particular embodiments, the genetic alteration is a mutation in the gene due to a nucleotide substitution, deletion, insertion, or copy number variation. In a particular embodiment, the genetic alteration is a single nucleotide polymorphism. In some embodiments, the method further comprises diagnosis or prognosis of a genetic condition associated with the genetic alteration.

In another aspect of the disclosure, kits for performing the present methods are also provided. In some embodiments, kits for amplifying a target nucleic acid molecule are provided. In some embodiments, the kit comprises a plurality of components comprising a thermostable polymerase and a pair of oligonucleotide primers, wherein the pair of primers is designed to amplify a target nucleic acid of about 20-50 base pairs (bp) by Polymerase Chain Reaction (PCR). Wherein the thermostable polymerase has strand displacement activity.

In some embodiments of the kit, the melting temperature of at least one primer is within ± 5 ℃ of the optimal temperature for the thermostable polymerase. In some embodiments, the G/C content of at least one primer is about 40% -60%. In some embodiments, the difference in percent G/C content between primers is less than 20%. In some embodiments, each primer comprises an extended end to which the polymerase can add nucleotides during PCR, and wherein at least one primer has a G/C content of at least 40% over a contiguous 5-nucleotide region of the extended end. In some embodiments, each primer comprises an extension end to which the polymerase can add nucleotides during PCR, and wherein at least one primer has a G or C at the extension end. In some embodiments, at least one primer is about 15-25 nucleotides in length.

In some embodiments of the kit, the polymerase is Bst DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is a Bst DNA polymerase large fragment, or an isomerase thereof, or a functional mutant with at least 80% sequence identity. In some embodiments, the polymerase is full length Bst DNA polymerase, Bst DNA polymerase large fragment, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase or Bst 3.0 DNA polymerase.

In some embodiments, the polymerase enzymeIs a DNA polymerase I or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is a DNA polymerase I large fragment (Klenow), or isomerase enzyme thereof, or functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow) or Klenow exo^-。

In some embodiments, the polymerase is Vent DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is Vent DNA polymerase, Vent (exo)^-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo) ^-) A DNA polymerase. In some embodiments, the polymerase is phi29 DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

In some embodiments, the polymerase is Taq DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity. In some embodiments, the polymerase is Taq DNA polymerase, hot start Taq DNA polymerase, EpiMark hot start Taq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase, or LongTaq DNA polymerase.

In some embodiments, the kit further comprises dUTPs. In some embodiments, the kit does not comprise dTTPs. In some embodiments, the kit further comprises uracil-DNA glycosylase (UDG). In some embodiments, the kit further comprises a buffer solution suitable for the polymerase. In some embodiments, further comprising polyethylene glycol. In some embodiments, the kit further comprises a single-chain binding protein (SSB), preferably a thermostable SSB. In some embodiments, the SSB protein is derived from a bacterium or a bacteriophage. In some embodiments, the SSB protein is selected from T4 phage 32SSB, T7 phage 2.5SSB, phage 29SSB, e.

In some embodiments, the components of the kit are (a) contained in one container, and the kit further comprises instructions for adding an amount of sample to form an amplification mixture; or (b) is contained inAt least two separate containers, and wherein the kit further comprises instructions for mixing the components of the separate containers with an appropriate amount of sample to form an amplification mixture. In some embodiments, the amplification mixture comprises a polymerase at a concentration of not less than 0.1U/. mu.L. In some embodiments, the amplification mixture comprises a concentration of not less than 1.0X 10^-6At least one primer of M. In some embodiments, the amplification mixture comprises about 0.5% to 10% polyethylene glycol by volume fraction. In some embodiments, the amplification mixture comprises SSB at a concentration of about 1-50 μ g/mL. In some embodiments, the volume of the amplification mixture is about 1-30 μ L.

In some embodiments, the kit further comprises instructions for performing PCR using a protocol comprising a plurality of thermal cycles, wherein each thermal cycle comprises incubating at a first temperature for no more than 2s, incubating at a second temperature for no more than 2s, and wherein the difference between the first and second temperatures is less than 30 ℃. In some embodiments, the kit further comprises instructions for performing PCR using a protocol comprising a plurality of thermal cycles, wherein each thermal cycle comprises incubating at a first temperature for no more than 2s, incubating at a second temperature for no more than 2s, and wherein the difference between the first and second temperatures is less than 25 ℃. In some embodiments, the kit further comprises instructions for performing PCR using a protocol comprising a plurality of thermal cycles, wherein each thermal cycle comprises incubating at a first temperature for no more than 2s, incubating at a second temperature for no more than 2s, and wherein the difference between the first and second temperatures is less than 20 ℃. In particular embodiments, the polymerase is full length Bst DNA polymerase, Bst DNA polymerase large fragment, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase, or Bst 3.0 DNA polymerase, and wherein the first temperature is in the range of about 68-78 ℃. And the second temperature is in the range of about 55-69 deg.c. In particular embodiments, the polymerase is full length Bst DNA polymerase, Bst DNA polymerase large fragment, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase or Bst 3.0 DNA polymerase, wherein each thermal cycle comprises incubation at a first temperature selected from the temperature range of about 72-76 ℃ for about 1s, and incubation at a second temperature selected from about 61-65 ℃ for about 1s, total temperature swing time less than 2s, and total reaction time less than 8 minutes.

In particular embodiments, the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow) or Klenow exo^-And wherein the first temperature is in the range of about 30-40 ℃ and the second temperature is in the range of about 50-60 ℃. In a particular embodiment, the polymerase is Vent DNA polymerase, Vent (exo)^-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo)^-) A DNA polymerase, and wherein the first temperature is in the range of about 70-80 ℃ and the second temperature is in the range of about 55-70 ℃. In a particular embodiment, the polymerase is phi29 DNA polymerase, and wherein the first temperature is selected from the range of about 40-55 ℃ and the second temperature is selected from the range of about 20-37 ℃.

In a particular embodiment, the polymerase is Taq DNA polymerase, hot start Taq DNA polymerase, EpiMark hot start Taq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase, wherein the first temperature is selected from the range of about 70-88 ℃ and the second temperature is selected from the range of about 58-70 ℃.

In some embodiments, each thermal cycle further comprises a ramp time of less than 10 seconds. In some embodiments, the number of thermal cycles is less than 40 cycles, and the thermal cycles further comprise a total reaction time of less than 10 minutes.

In some embodiments, the amplification region has a first melting temperature, and wherein the first temperature is within ± 5 ℃ of the first melting temperature. In some embodiments, a pair of primers in a kit has an average melting temperature, and wherein the second temperature is within ± 5 ℃ of the average melting temperature. In some embodiments, one of the pair of oligonucleotide primers has a second melting temperature and the other of the pair of oligonucleotide primers has a third melting temperature, wherein the difference between the second and third melting temperatures is less than about 3 ℃.

3. Description of the drawings

FIG. 1 is a schematic diagram of the principle of a denatured bubble-mediated strand displacement amplification reaction of double-stranded nucleic acid (e.g., DNA).

FIG. 2 is a graph showing real-time amplification of a target sequence from a hypervariable region of the 16S rRNA-encoding gene of Listeria monocytogenes under rapid thermal cycling at 76 ℃ and 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different primer concentrations.

FIG. 3 is a graph showing real-time amplification of a target sequence from a hypervariable region of the 16S rRNA coding gene of Listeria monocytogenes under rapid thermal cycling at 76 ℃ and 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different enzyme concentrations.

FIG. 4 is a graph showing real-time amplification of a target sequence of a hypervariable region of a 16S rRNA-encoding gene of Listeria monocytogenes under rapid thermal cycling at a high temperature of between 74 ℃ and 78 ℃ and a low temperature of 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent respectively different temperatures.

FIG. 5 is a graph of real-time amplification of artificially synthesized DNA fragments under rapid thermal cycling at 76 ℃ and 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different target concentrations.

FIG. 6A is a graph of real-time amplification of synthetic RNA fragments under rapid thermal cycling at 76 ℃ and 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different target concentrations.

FIG. 6B is a polyacrylamide gel electrophoresis (PAGE) image, showing thatExample 2As described inAmplification products from rapid SEA reactions. Lane M is a gradient molecular weight DNA marker (DNA ladder) and the band positions of 20bp and 40bp DNA are marked, the remaining lanes show the specific 43bp amplification product from three replicate control reactions with initial target concentrations of 1.0X 10^-12M, and no specific amplification product was present in the negative control. Bands smaller than 20bp are derived from the remaining primer molecules.

FIG. 7A is a graph of real-time amplification of the hypervariable region of the 16S rRNA-encoding gene of Listeria monocytogenes under rapid thermal cycling at 76 ℃ and 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different initial target concentrations.

FIG. 7B is a polyacrylamide gel electrophoresis (PAGE) image showing the resultsExample 3The rapid SEA reaction described in (1) produces a 43bp amplification product. Lane M is a gradient molecular weight DNA marker (DNA ladder) and the band positions of 20bp and 40bp DNA are marked, the remaining lanes show the 43bp specific amplification product after amplification of different initial concentrations of target, and no specific amplification product appears in the negative control.

FIG. 7C is a graph showing real-time amplification of the target gene of the hypervariable region of the 16S rRNA-encoding gene of Listeria monocytogenes at a constant temperature of 62 ℃. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different initial target concentrations.

FIG. 8 is a graph showing real-time amplification of a 50bp fragment of the 16S rRNA-encoding gene of Staphylococcus aureus at 76 ℃ and 61 ℃ under rapid thermal cycling. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Wherein different symbols represent different target concentrations.

FIG. 9 lists the manufacturer's descriptions and recommendations for several Bst DNA polymerases that may be used in conjunction with the methods and kits of the present invention in a specific embodiment.

FIGS. 10A-E are real-time amplification curves of SEA reactions performed at a series of constant reaction temperatures (57 ℃, 59 ℃, 61 ℃, 63 ℃ and 65 ℃) using five different pairs of primers (Mp1-Mp5) using purified M.pneumoniae 16S rRNA-encoding gene fragments as templates. Specifically, FIG. 10A is an amplification curve using a primer pair Mp1(Tm value about 65 ℃) at five different reaction temperatures. Specifically, FIG. 10B is an amplification curve using the primer pair Mp2(Tm value: about 63 ℃) at five different reaction temperatures. Specifically, FIG. 10C is an amplification curve using the primer pair Mp3(Tm value: about 61 ℃) at five different reaction temperatures. Specifically, FIG. 10D is an amplification curve using the primer pair Mp4(Tm value about 59 ℃) at five different reaction temperatures. Specifically, FIG. 10E is an amplification curve using the primer pair Mp5(Tm value about 57 ℃) at five different reaction temperatures. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 10F is a real-time amplification curve for the SEA reaction performed at the five different reaction temperatures shown, using the extracted Mycoplasma pneumoniae genome as the template and Mp3 as the reaction primers. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 11A is a real-time amplification curve of an SEA reaction using three pairs of specific primer pairs (Ct1-Ct3) and using a fragment of the gene encoding Chlamydia trachomatis 16S rRNA as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 11B is a real-time amplification curve for SEA reaction using three pairs of specific primer pairs (Sd1-Sd3) and a domestic pig 18S rRNA-encoding gene fragment as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 12A is a real-time amplification curve of SEA reaction using different specific primer pairs (Mp3, Mp6 and Mp7) and using a fragment of the Mycoplasma pneumoniae 16S rRNA-encoding gene as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 12B is a real-time amplification curve of SEA reaction using different specific primer pairs (Ct1, Ct4 and Ct5) with the C.trachomatis 16S rRNA-encoding gene fragment as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 13A is a real-time amplification curve of the SEA reaction using different specific primer pairs (Ct1, Ct2 and Ct6) with the C.trachomatis 16S rRNA-encoding gene fragment as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 13B is a real-time amplification curve of SEA reaction using different specific primer pairs (Bc1-Bc3) and a Bacillus cereus 16S rRNA-encoding gene fragment as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

FIG. 14 is a graph showing the real-time amplification curve of SEA reaction using two pairs of specific primer sets (Sa1 and Sa2) and using a gene fragment encoding 16S rRNA of Staphylococcus aureus as a template. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The above figure also shows the negative control (NTC) results.

Fig. 15 is a real-time amplification curve for accelerated SEA reactions using a microfluidic device. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. Different symbols represent different target molecule concentrations.

FIG. 16 shows a real-time amplification curve of an accelerated SEA reaction using dUTPs or dTTPs. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction. The experiment also included a negative control group (NTC).

FIG. 17 is an image of an electrophoresis gel of UDG enzyme digestion of uracil containing amplification products.

FIG. 18 is a real-time amplification curve for rapid SEA reactions using dUTPs with and without UDG enzyme. The X-axis represents amplification time in minutes (min) indicating the number of thermal cycles elapsed for the amplification reaction, and the Y-axis represents fluorescence signal intensity in Relative Fluorescence Units (RFU) indicating the amount of amplification of the reaction.

FIG. 19 shows a real-time amplification curve of a target DNA fragment synthesized under rapid thermal cycling between 76 ℃ and 61 ℃. The X-axis shows the amplification time in minutes (min) and the Y-axis shows the intensity of the fluorescence signal in Relative Fluorescence Units (RFU), indicating the amount of amplification product produced by the reaction.

Figure 20 shows a real-time amplification curve of a target sequence in the human β -actin gene under rapid thermal cycling between 76 ℃ and 61 ℃. The X-axis shows the amplification time in minutes (min) and the Y-axis shows the intensity of the fluorescence signal in Relative Fluorescence Units (RFU), indicating the amount of amplification product produced by the reaction.

FIG. 21 shows a real-time amplification curve of a target DNA fragment synthesized under rapid thermal cycling between 76 ℃ and 55 ℃. The X-axis shows the amplification time in minutes (min) and the Y-axis shows the intensity of the fluorescence signal in Relative Fluorescence Units (RFU), indicating the amount of amplification product produced by the reaction. As shown, different symbols represent different target concentrations.

FIG. 22 shows real-time amplification curves of small target RNA fragments synthesized under rapid thermal cycling between 60 ℃ and 34 ℃. The X-axis shows the amplification time in minutes (min) and the Y-axis shows the intensity of the fluorescence signal in Relative Fluorescence Units (RFU), indicating the amount of amplification product produced by the reaction. As shown, different symbols represent different target concentrations.

4. Detailed description of the invention

The present specification provides methods for amplifying and detecting a target nucleic acid in a sample.

In one aspect, the present disclosure provides a technical solution for amplifying a target nucleic acid. The method includes directly contacting a thermostable polymerase and a pair of oligonucleotide primers with the sample to form an amplification mixture. The amplification mixture is subjected to Polymerase Chain Reaction (PCR) amplification of the target nucleic acid sequence under thermal cycling of a first temperature of 68-78 ℃ and a second temperature of 55-69 ℃ which are continuously alternated.

In another aspect of the disclosure, a kit for practicing the subject technology is provided. The kit comprises at least one thermostable polymerase and a pair of oligonucleotide primers with a sample, and instructions for using the kit to perform the protocol. Additional features of the present description (herein the word Additional features) will be readily apparent to those skilled in the art in view of the detailed description of specific embodiments.

4.1 general technique

The techniques and procedures described and referred to herein are derived from conventional techniques and procedures readily understood and/or commonly employed by those skilled in the art, such as those described and referred to in Sambrook et al, molecular gramsAnd (2) Longding: a laboratory Manual (third edition: 2001) ((R))Molecular Cloning:A Laboratory Manual(3d ed. 2001)) and Ausubel et al, modern molecular biology laboratory techniques (2003) (Current Protocols in Molecular Biology(Ausubel et al. eds.,2003)) are described in the literature.

4.2 terminology

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For the purpose of explaining the present specification, the following description will be used, and terms used in the singular will also include the plural and vice versa, as appropriate. All patents, applications, published applications and other publications are herein incorporated by reference in their entirety. In the event that any description of a term conflicts with any document incorporated by reference herein, the following description of the term prevails.

As used herein, the singular terms "a", "an" and "the" include the plural forms unless the context clearly dictates otherwise.

As used herein, the term "about" means approximately, within a certain range, roughly, or nearby. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. Generally, the term "about" is used herein to modify a numerical value above and below (5% ± 5%) of the stated numerical value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently.

The term "amino acid" refers to naturally occurring and non-naturally occurring alpha-amino acids, as well as analogs and mimetics of alpha-amino acids that function similarly to naturally occurring alpha-amino acids. Naturally encoded amino acids are 22 common amino acids (alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, pyrrolysine, and selenocysteine). Amino acid analogs or derivatives refer to compounds having the same basic chemical structure as a natural amino acid, i.e., a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and a side chain R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methanesulfonic acid. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a natural amino acid. Amino acids may be referred to herein by their well known three letter symbols or by one letter symbol recommended by the IUPAC-IUB Biochemical nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

As used herein, the term "conservative substitution" refers to the substitution of one amino acid residue for another, biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic amino acid residue, such as Ile, Val, Leu or Met, for another, or the substitution of one polar amino acid residue for another, such as between Arg and Lys, between Glu and Asp or between Gln and Asn, and the like. In some cases, the substitution of an ionic amino acid residue with Asp of a similar or oppositely charged ionic amino acid residue (e.g., Lys) is considered conservative in the art, as those ionic amino acid groups are believed to provide solubility assistance only. The terms "nonionic" and "ionic" amino acid residues are used herein in their ordinary sense to refer to amino acid residues that are generally uncharged or generally charged at physiological pH. Exemplary non-ionic amino acid residues include Thr and Gln, while exemplary ionic amino acid residues include Arg and Asp.

The term "unnatural amino acid" or "non-proteinogenic amino acid" or "unnatural amino acid" refers to an alpha-amino acid that comprises different side chains (different R groups) relative to the twenty-two common or natural amino acids listed above. Furthermore, these terms may also refer to amino acids that are described as having a D-stereochemical conformation rather than the L-stereochemical conformation of the natural amino acid, although some amino acids do exist in the D-stereochemical form in nature (e.g., D-alanine and D-serine).

As used herein, the term "Bst DNA polymerase" refers to a wild-type DNA polymerase derived from bacillus stearothermophilus or a mutated or truncated form thereof that retains at least the polymerase and strand displacement activities. The enzyme can be isolated from Bacillus stearothermophilus or produced synthetically. An exemplary embodiment of a Bst DNA polymerase that is particularly useful for the present disclosure is Bst DNA polymerase (large fragment), which is reported to have good strand displacement activity at about 65 ℃ and intrinsic reverse transcriptase activity ("j.am.chem.soc. (2015)137, 13804-. Other Bst DNA polymerases suitable for use in the examples according to the present invention include, but are not limited to, Bst DNA polymerase (full length), mutant Bst DNA polymerases, such as those available from New England

Commercial Bst 2.0 DNA polymerase, Bst WarmStart DNA polymerase and Bst 3.0 DNA polymerase.

The term "functional derivative" of a reference enzyme or protein as used herein refers to an enzyme or protein having a different amino acid sequence compared to the reference enzyme or protein, but retaining the same function of the reference enzyme or protein. In certain instances, the term is used with respect to one or more activities of interest, and a variant can be considered a functional derivative as long as it retains the activity of interest of the reference, even though it may not contain other functions or activities of reference. In some cases, a functional derivative may retain the same activity as a reference even if the level of activity of the derivative is increased or decreased, and such a derivative may still be considered a functional derivative of the reference.

The term "G/C content" in terms of the field of molecular biology and genetics refers to the percentage of the nitrogenous base guanine (G) or cytosine (C) in a DNA or RNA molecule.

The term "genetic polymorphism" refers to the phenomenon of the coexistence of two or more DNA sequences in the same hybridization population.

The term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules as determined by aligning and comparing the sequences. Percent (%) relative to a reference polynucleotide sequence "sequence identity" is defined as the percentage of nucleotides in which a candidate nucleotide sequence is identical to the reference nucleotide sequence, the maximum percent sequence identity being obtained after aligning the sequences and introducing gaps, if necessary, and not considering any substitutions as part of the sequence identity. Alignment to determine percent nucleic acid sequence identity can be accomplished in a variety of ways within the skill in the art, for example, using publicly available computer software, such as BLAST, BLAST-2, ALIGN, or MEGALIGN (DNAStar, Inc.) software. One skilled in the art can determine suitable parameters for aligning sequences, including any algorithms required to achieve maximum alignment over the full length of the sequences being compared. Exemplary parameters for determining the relatedness of two or more sequences using the BLAST algorithm can be found, for example, as follows. Briefly, sequence alignments can be performed using BLASTP 2.0.8 version (Jan-05-1999) and the following parameters: matrix: 0BLOSUM 62; opening of vacant sites: 11; notch extension: 1; x _ dropoff: 50; it is desired that: 10.0; the character size is as follows: 3; a filter: and (4) opening. Nucleic acid sequence alignments can be performed using BLASTN version 2.0.6 (16/9/1998) and the following parameters: matching: 1; mismatch: -2; opening of vacant sites: 5; notch extension: 2; x _ dropoff: 50; it is desired that: 10.0; the character size is as follows: 11; a filter: and closing. One skilled in the art will know which modifications can be made to the above parameters to increase or decrease the stringency of the comparison and determine the relatedness of two or more sequences.

The terms "oligonucleotide" and "nucleic acid" refer to an oligomer of deoxyribonucleotides (e.g., DNA) or ribonucleotides (e.g., RNA) and polymers thereof, in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to natural nucleotides. Unless otherwise specifically limited, the term also refers to oligonucleotide analogs including PNA (peptide nucleic acid), analogs of DNA used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by substituting one or more selected (or all) of the three codons with mixed base and/or deoxyinosine residues to generate the sequence (Batzer, M.A., et al, Nucleic Acid Res.,1991,19, 5081-1585; Ohtsuka, E.et al, J.biol.chem.,1985,260, 2605-2608; and Rossolini, G.M., et al, mol.cell.Probes,1994,8, 91-98). Nucleic acids as used herein may be, but are not limited to, DNA, RNA, cDNA, gDNA, rRNA, ssDNA, dsDNA, DNA-RNA hybrids, and the like.

As used herein, the term "or" refers to any one member of a particular list, and also includes any combination of members of that list, unless otherwise indicated herein or otherwise implied by the context in which the term appears.

As used herein, the term "phi 29 DNA polymerase" refers to a wild-type replicating polymerase derived from the bacillus subtilis bacteriophage phi29(Φ 29) or a mutated or truncated form thereof that retains at least polymerase and strand displacement activity. The enzyme can be isolated from the bacteriophage phi29 or synthesized artificially.

As used herein, the term "polymerase chain reaction" or PCR refers to a chain reaction catalyzed by a nucleic acid polymerase in which a nucleic acid strand produced in an earlier few rounds of reaction is used as a template for a subsequent reaction.

As used herein, the term "probe", "primer" or "oligonucleotide" refers to a single-stranded DNA or RNA molecule of defined sequence that can base pair with another DNA or RNA molecule (i.e., "target") comprising a complementary sequence. Hybridization is the joining of two complementary single nucleic acid strands to form a hydrogen-bonded double strand. The stability of the resulting hybrid depends on the length, G/C content, nearest neighbor stacking energy, and the extent of base pairing. The degree of base pairing is influenced by parameters such as the degree of complementarity between the probe and the target molecule and the stringency of the hybridization conditions. Stringency of hybridization is affected by parameters such as temperature, salt concentration, and concentration of organic molecules such as formamide, and is determined by methods known to those skilled in the art. Probes, primers and oligonucleotides can be detectably labeled by methods well known to those skilled in the art, including radioactive, fluorescent or non-radioactive labels. dsDNA binding dyes (dyes that bind to double stranded DNA more strongly than to single stranded DNA or that fluoresce when free in solution) can be used to detect dsDNA. It is understood that "primers" are specifically designed to be extendable by a polymerase, whereas "probes" or "oligonucleotides" may not be so designed.

The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of more than fifty (50) amino acid residues. That is, the description for polypeptides applies equally to the description for proteins and vice versa. The term applies to natural amino acid polymers as well as amino acid polymers in which one or more amino acid residues are unnatural amino acids, e.g., amino acid analogs. As used herein, the term includes amino acid chains that are greater than 50 amino acid residues in length, including full-length proteins (e.g., full-length polymerases), in which the amino acid residues are linked by covalent peptide bonds.

The term "peptide" as used herein refers to a polymer chain comprising two to fifty (2-50) amino acid residues. The term applies to natural amino acid polymers as well as amino acid polymers in which one or more amino acid residues are unnatural amino acids, e.g., amino acid analogs or amino acid polymers of unnatural amino acids.

As used herein, the term "sample" refers to an animal; a tissue or organ of an animal; cells (including cells in a subject; cells taken directly from a subject; cells maintained in culture or taken from a cultured cell line); a cell lysate (or lysed fraction) or cell extract; a solution containing one or more molecules (e.g., polypeptides or nucleic acids) derived from cells, cellular material, or viral material; or a solution containing a natural or unnatural nucleic acid, as determined as described herein. The sample may also be any body fluid or excretion (such as, but not limited to, blood, urine, feces, saliva, tears, bile) containing cells, cellular components, or nucleic acids.

As used herein, the term "specifically hybridizes" or grammatical variations thereof means that a primer recognizes and physically interacts (i.e., base pairs) with a substantially complementary nucleic acid (e.g., a sample nucleic acid) under high stringency conditions and is rarely base paired with other nucleic acids. The phrase "high stringency conditions" refers to similar conditions for producing hybridization to a DNA probe of at least 40 nucleotides in length, such as a buffer containing 0.5M sodium phosphate salt, pH 7.2, 7% SDS, 1mM EDTA and 1% BSA (component V), conditions at a reaction temperature of 65 ℃, or a buffer containing 48% formamide, 4.8 XSSC, 0.2 μ M Tris-Cl, pH 7.6, 1 XDenhardt's solution, 10% dextran sulfate and 0.1% SDS, conditions at a reaction temperature of 42 ℃. Other reaction conditions for high stringency hybridization, such as PCR, Northern, Southern or in situ hybridization, DNA sequencing, and the like, are well known to those skilled in the art of Molecular Biology (Ausubel et al, "Current Protocols in Molecular Biology," John Wiley & Sons, New York, NY, 1998).

As used herein, the term "strand displacement" or grammatical variants thereof is a term of art and refers to the ability of a polymerase to displace a downstream complementary nucleic acid strand it encounters when synthesizing a new complementary strand. The result is a double stranded nucleic acid molecule comprising the original template strand and the newly synthesized complementary strand, while the original complementary strand is removed. Several DNA polymerases have been reported to have strand displacement activities of various degrees. For example, phi29 DNA polymerase has a strong strand displacement ability. Other examples of strand displacing polymerases include DNA polymerase I, large fragment of DNA polymerase I (Klenow),

DNA polymerase, and Bacillus stearothermophilus (Bst) DNA polymerase (Large fragment).

Some strand displacing polymerases are also known to be thermostable. For example, Bst DNA polymerase (Large fragment) is describedGood strand displacement activity is exhibited at high temperatures (e.g., about 65 ℃). Other such examples include, but are not limited to, DNA polymerase I, large fragments of DNA polymerase I (Klenow) exhibit good strand displacement activity at high temperatures (e.g., around 37 ℃),

DNA polymerase exhibits good strand displacement activity at high temperatures (e.g., around 75 ℃).

Several strand displacing polymerases are commercially available. For example, New England

Several engineered Bst DNA polymerases have been commercialized. The manufacturer's specifications and recommendations for these products (available from www.neb.com/faqs/0001/01/01/hen-should-bst-dna-polymerase-be-the-choice-of-choice website) are reproduced from FIG. 9 for illustrative purposes only. Zeng et al describe a large fragment of DNA polymerase I (Klenow) lacking 5 '→ 3' exonuclease activity, but retaining strand displacement activity, one of the mutants of DNA polymerase I (Klenow exo)^-) (Zeng et al, "Strand Displacement Amplification for Multiplex Detection of Nucleic Acids" (2018); DOI 10.5772/interchopen.80687). Although these enzymes may be used in conjunction with the methods and kits of the present invention, the present invention is in no way limited to these exemplary commercial enzymes. It will be understood by those skilled in the art that other enzymes currently known in the art or discovered in the future that satisfy the described activities of the present disclosure are encompassed by and included in the present disclosure.

The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, a subject is a mammal, such as a non-primate (e.g., bovine, porcine, equine, feline, canine, rat, etc.) or a primate (e.g., monkey and human). In particular embodiments, the subject is a human.

The term "thermostable polymerase" as used herein refers to a polymerase that is stable and active at a temperature in the range of 50-80 ℃ and is capable of catalyzing the extension of a primer bound to a template strand by base complementary pairing after annealing to produce a new strand. Synthesis can begin at the 3 'end of the primer and proceed toward the 5' end of the template strand (5'→ 3' polymerase activity) until synthesis terminates, resulting in nucleic acid molecules of varying lengths. Alternatively, synthesis can be initiated at the 5 'end of the primer and then proceed to the 3' end of the template strand (3 '→ 5' polymerase activity). Thermostable polymerases that are inactive at lower temperatures outside the above temperature ranges but can be activated or reactivated upon exposure to temperatures within the above temperature ranges are referred to in this disclosure as thermoactive enzymes. Thermostable polymerases that are inactive at higher temperatures outside the above temperature range but can be activated or reactivated upon exposure to temperatures within the above temperature range are referred to in this disclosure as heat-inactivated enzymes.

4.3 primers

In accordance with the present disclosure, a primer is designed to be capable of acting as a point of initiation of synthesis of a primer extension product (i.e., an amplification product) when placed under suitable conditions (e.g., in the presence of nucleotides and an inducing agent, such as a DNA polymerase, and at a suitable temperature and pH). In some embodiments, the primer is preferably single stranded to achieve maximum amplification efficiency, but may alternatively be provided in double stranded form. In those embodiments where the primer is provided in a double-stranded form, the primer may be treated to separate its strands prior to their isolation. For the production of primer extension products. In some embodiments, the primer is an oligodeoxyribonucleotide. In other embodiments, the primer is an oligoribonucleotide.

In some embodiments, a pair of upstream and downstream primers are designed such that they operatively define an amplification region or sequence in a target nucleic acid molecule, meaning that the primers have sequences designed to specifically hybridize to both ends of the region to be amplified in the target nucleic acid molecule. According to the present disclosure, in some embodiments, a primer is designed to be substantially complementary to a template strand in a target nucleic acid, meaning that base pairing between the primer and the target is sufficient such that hybridization begins for a primer extension reaction. The percentage of base pairing of two sequences that are considered "substantially complementary" also depends on the stringency of the hybridization conditions, and the selection of such percentages and conditions will be common and readily understood to those of skill in the art in view of this disclosure.

In some embodiments, the target sequence is selected prior to performing the present method. In particular, in some embodiments, the selection of the target sequence is based on determining the genus and species of the target organism. In some embodiments, genomic sequences that are present in relatively large numbers in an organism are selected as targets. In some embodiments, the target sequence is selected from a ribosomal rna (rrna) encoding gene or a mitochondrial gene. In some embodiments, genomic sequences unique to the relevant organism are selected. For example, to identify unique sequences of an organism, in some embodiments, candidate sequences of the organism of interest are compared to sequences of other closely related species under evolution (e.g., orthologous genes of different species). Orthologues are one or more genes related by orthologues and are responsible for substantially the same or identical functions in different organisms. For example, for the biological function of epoxide hydrolysis, mouse epoxide hydrolase and human epoxide hydrolase can be considered orthologs. For example, genes are related by vertical homology when they share a sufficient number of sequence similarities to indicate that they are homologous, or are related by the evolution of a common ancestor. In some embodiments, genomic sequences conserved across species are selected as targets. In some embodiments, genomic sequences that are predisposed to have a genetic mutation of interest are selected as targets.

Thus, in some embodiments, the primer sequence is not fully complementary to the template strand of the target nucleic acid molecule, and the sequence of the primer can be optimized even if the target sequence is determined. For example, in some embodiments, a non-complementary fragment can be ligated to the 5' end of a primer, while the remainder of the primer sequence is complementary to the strand. For example, in other embodiments, the primer comprises non-complementary bases or fragments interspersed within a region that is complementary to the target. As will be recognized by those skilled in the art, a variety of different primers can be designed so long as the primer has sufficient base pairing with the template strand to be amplified to hybridize therewith, thereby forming a template for the next round of amplification.

Without being bound by theory, it is expected that accelerating the amplification rate of the SEA method is influenced by at least three factors: (1) probability of forming a denatured vesicle, (2) efficiency of amplification by the polymerase, and (3) efficiency of specific binding of the primer to the target sequence in the denatured vesicle.

Specifically, the formation of the denatured bubble and the amplification efficiency of the polymerase are affected by the reaction temperature. (Chander et al, "A novel thermostable polymerase for RNA and DNA loop-mediated isothermal amplification (LAMP)," front. Microbiol., (2014)5: 395; Sanchez et al, "DNA kinks and bunbles: temperature dependence of the elastic energy of shared bent 10-nm-size DNA molecules," Physical Review E (2013) 87: 22710). Dynamic opening and closing of the denatured bubble in double-stranded DNA molecules will become more frequent with increasing temperature (Adamcik et al, "Quantifying subsequent-induced depletion bubbles in DNA," Soft Matter, (2012)8: 8651-.

In addition, the amplification efficiency of the polymerase is also affected by the reaction temperature. Specifically, the reaction temperature at which the enzyme activity reaches the maximum level is referred to as the optimum temperature for the particular enzyme. For example, the optimal temperature for Bst DNA polymerase has been reported to be 65 ℃ (Kucera et al, "DNA-dependent DNA polymerases," Current protocols in molecular biology, (2008)84: 3-5).

Finally, the efficiency of primer-target binding is influenced by the relationship between the reaction temperature and the melting temperature of the primer (Tm or Tm value), which in turn depends on the sequence of the primer (e.g., G/C content). Typically, a primer will bind its target efficiently when the reaction temperature approaches the Tm value of the primer. However, too high a reaction temperature may prevent binding of the primer to the target, compared to the Tm value of the primer, while too low a reaction temperature may result in excessive non-specific primer binding and amplification (Kwok et al, "Effects of primer-template hybridization on the polymerase chain reaction: human immunodeficience virus type 1 models students," Nucleic Acids Res. (1990)18: 999-;

Fernández in Methods in enzymology,Elsevier,Editon edn.,(2013),vol.529,pp. 1-21)。methods for designing primers with specific Tm values and methods for determining the optimal temperature for a given enzyme are known in the art. In addition, suitable reaction temperatures and Tm values for the primers can be determined using methods known in the art, including, but not limited to, the exemplary procedure described in example 6 of this patent (section 5.7.1)

In some embodiments, the Tm value of the primer is within ± 5 ℃ of the optimal temperature of the polymerase. In some embodiments, the Tm value of the primer is within ± 4 ℃ of the optimal temperature of the polymerase. In some embodiments, the Tm value of the primer is within ± 3 ℃ of the optimal temperature of the polymerase. In some embodiments, the Tm value of the primer is within ± 2 ℃ of the optimal temperature of the polymerase. In some embodiments, the Tm value of the primer is within ± 1 ℃ of the optimal temperature of the polymerase. In some embodiments, the Tm value of the primer is within ± 0.5 ℃ of the optimal temperature of the polymerase.

For example, in a particular embodiment where the polymerase is Bst DNA polymerase, the Tm value of the primers used in the reaction is selected from about 58 ℃ to 68 ℃. In various embodiments where the polymerase is Bst DNA polymerase, the Tm value of the primers used in the reaction is about 58 ℃, about 58.5 ℃, about 59 ℃, about 59.5 ℃, 60 ℃, about 60.5 ℃, about 61 ℃, about 61.5 ℃, about 62 ℃, about 62.5 ℃, about 63 ℃, about 63.5 ℃, about 64 ℃, about 64.5 ℃, about 65 ℃, about 65.5 ℃, about 66 ℃, about 66.5 ℃, about 67 ℃, about 67.5 ℃ or about 68 ℃.

In some embodiments, the Tm values of the two primers in a primer pair are about the same. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 5%. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 4%. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 3%. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 2%. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 1%. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 0.5%.

In some embodiments, the Tm values of the two primers in a primer pair are about the same. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 5 ℃. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 4 ℃. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 3 ℃. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 2 ℃. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 1 ℃. In a particular embodiment, the Tm values of a pair of primers differ from each other by less than about 0.5 ℃.

Without being bound by theory, it is contemplated that the primers used in the methods of the invention hybridize to the target nucleic acid molecule when the target molecule is only partially denatured. Furthermore, it is expected that the denaturing bubble will dynamically open and close in the target nucleic acid molecule, thereby allowing a much shorter time window for specific primer hybridization than in conventional PCR, where the target molecule is completely denatured prior to primer annealing. Furthermore, it is expected that stable hybridization between the primer and the template strand in the target nucleic acid molecule facilitates polymerase-catalyzed primer extension. It is further contemplated that, while G-C base pairing is generally more stable, A-T base pairing can hybridize at a faster rate. (Raymaakers et al, "Checklist for optimization and validation of real-time PCR assays," J.Clin.Lab.anal., (2009) 23:145-151).

Thus, in some embodiments, the primers used in the present methods are designed to have a suitable G/C content. In particular embodiments, the primer has a suitable G/C content at the end of the polymerase primed primer extension. For example, in some embodiments, when a polymerase extends a primer from its 3 'end, the primer can be specifically designed to have a suitable G/C content in the region closer to its 3' end so that the primer can rapidly hybridize stably to the template strand. Alternatively, in those embodiments where the polymerase extends the primer from the 5 'end of the primer, the primer can be specifically designed to have a suitable G/C content in the region closer to its 5' end so that the primer can rapidly form a stable hybridization with the template strand. Suitable G/C content of the primers can be determined using methods known in the art, including but not limited to the exemplary method described in example 6 of this patent (section 5.7.2).

In a particular embodiment where the polymerase initiates primer extension at the 3 'end of the primer, the primer has G or C as the 3' terminal nucleotide. In some embodiments, the G/C content of the primer is about 40% to about 60%. In a particular embodiment, the G/C content of the primer is about 40%. In a specific embodiment, the G/C content of the primer is about 45%. In a particular embodiment, the G/C content of the primer is about 50%. In a particular embodiment, the G/C content of the primer is about 55%. In a specific embodiment, the G/C content of the primer is about 60%.

In a particular embodiment, the primer comprises a G/C content of at least 40% in a contiguous 5-nt region including the 3' terminal nucleotide. In particular embodiments, the primer comprises a G/C content of at least 40% in a contiguous 5-nt region that includes a 3 'terminal nucleotide, wherein the 3' terminal nucleotide is also a G or a C. In a particular embodiment, the primer has a G/C content of at least 60% in the contiguous 5-nt region including the 3' terminal nucleotide. In a particular embodiment, the primer comprises a G/C content of at least 60% in a contiguous 5-nt region comprising the 3 'terminal nucleotide, wherein the 3' terminal nucleotide is also a G or a C. In a particular embodiment, the primer has a G/C content of at least 80% in the contiguous 5-nt region including the 3' terminal nucleotide. In particular embodiments, the primer comprises at least 80% G/C content in a contiguous 5-nt region comprising the 3 'terminal nucleotide, wherein the 3' terminal nucleotide is also G or C. In a specific embodiment, the primer has a G/C content of 100% in a contiguous 5nt region including the 3' terminal nucleotide. In a particular embodiment, the primer comprises 100% G/C content in a contiguous 5-nt region including the 3 'terminal nucleotide, wherein the 3' terminal nucleotide is also either G or C.

In a particular embodiment where the polymerase initiates primer extension at the 5 'end of the primer, the primer has a G or C as the 5' terminal nucleotide. In some embodiments, the G/C content of the primer is about 40% to about 60%. In a particular embodiment, the G/C content of the primer is about 40%. In a specific embodiment, the G/C content of the primer is about 45%. In a particular embodiment, the G/C content of the primer is about 50%. In a particular embodiment, the G/C content of the primer is about 55%. In a specific embodiment, the G/C content of the primer is about 60%.

In a particular embodiment, the primer comprises a G/C content of at least 40% in a contiguous 5-nt region comprising the 5' terminal nucleotide. In particular embodiments, the primer comprises a G/C content of at least 40% in a contiguous 5-nt region comprising the 5 'terminal nucleotide, wherein the 5' terminal nucleotide is also a G or a C. In a particular embodiment, the primer has a G/C content of at least 60% in the contiguous 5-nt region including the 5' terminal nucleotide. In a particular embodiment, the primer comprises at least 60% G/C content in a contiguous 5-nt region comprising the 5 'terminal nucleotide, wherein the 5' terminal nucleotide is also G or C. In a particular embodiment, the primer has a G/C content of at least 80% in the contiguous 5-nt region including the 5' terminal nucleotide. In particular embodiments, the primer comprises at least 80% G/C content in a contiguous 5-nt region comprising the 5 'terminal nucleotide, wherein the 5' terminal nucleotide is also G or C. In a specific embodiment, the primer has a G/C content of 100% in a contiguous 5 nucleotide region comprising the 5' terminal nucleotide. In a particular embodiment, the primer comprises 100% G/C content in a contiguous 5-nt region comprising the 5 'terminal nucleotide, wherein the 5' terminal nucleotide is also G or C.

Without being bound by theory, it is thought that a primer having a sequence capable of forming a self-complementary secondary structure or a pair of primers having sequences complementary to each other would hinder the amplification reaction. (Meagher et al, "Impact of primer polymers and self-amplifying hairpins on reverse amplification detection of viral RNA," analysis, (2018) 143: 1924-. Thus, in some embodiments, after selecting target sequences for primer hybridization, primer sequences can be further optimized to avoid or reduce the likelihood of forming complementary structures within or between these primers. Methods for primer sequence optimization are known in the art, including but not limited to the exemplary method described in example 6 of this patent (section 5.7.3).

The choice of primer length may depend on a variety of factors, including but not limited to amplification reaction temperature and time, in accordance with current findings. Without being limited by theory, it is expected that the higher the reaction temperature, the longer the region of complementarity between the primer and the target, can be used to avoid non-specific amplification.

Without being bound by theory, it is also expected that reducing the primer extension time in each amplification cycle can significantly reduce the total time required to produce detectable amounts of amplification product, thereby reducing the time required for target detection and related diagnostics. Thus, in some embodiments, the primers are designed to specifically hybridize to a large portion of the amplification region, such that the number of nucleotides to be extended (i.e., the difference in length between the amplification product and the primer) in each amplification cycle is relatively small.

For example, in particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 30% to about 60%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 30%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 35%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 40%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 45%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 50%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 55%. In particular embodiments, the ratio between the length of the primer and the total length of the amplification product is in the range of about 60%.

In some embodiments, a pair of primers is designed for a relatively short amplification region, the primers having a unique sequence that is indicative of the identity, status, origin or source of the target nucleic acid. The choice of amplified region in the target nucleic acid depends on the purpose of detection or application scenario, and after reading this patent, one skilled in the art would recognize this option. For example, to detect the presence or absence of a genetic mutation or polymorphism in a sample, an amplified region can be selected that includes the desired site of the mutation or polymorphism. To detect the presence of a pathological microorganism in a sample, an amplified region covering a known signature sequence in the genome of the microorganism can be selected.

In some embodiments, the pair of primers is designed to amplify a region of less than 100bp long in the target nucleic acid molecule. In some embodiments, the amplified fragments produced by the present methods are less than 90bp in length. In some embodiments, the amplified fragments produced by the present methods are less than 80bp in length. In some embodiments, the amplified fragments produced by the present methods are less than 70bp in length. In some embodiments, the amplified fragments produced by the present methods are less than 60bp in length. In some embodiments, the amplified fragments produced by the present methods are less than 50bp in length. In some embodiments, the amplified fragments produced by the present methods are about 20-50bp long. In some embodiments, the amplified fragments produced by the present methods are about 30-50bp in length. In some embodiments, the amplified fragments produced by the present methods are about 35-50bp in length.

In some embodiments, to reduce the time required for primer extension, the pair of primers is configured to produce short amplified fragments of about 20 base pairs (bp) to about 50bp in length. The amplified fragments comprise at least a central portion corresponding to a unique sequence in the target nucleic acid molecule, which central portion may be flanked by primer sequences that are identical to or different from the sequence in the target molecule. For example, in a particular embodiment, the amplified fragment is about 20bp in length. In a specific embodiment, the amplified fragment is about 21bp in length. In a specific embodiment, the amplified fragment is about 22bp in length. In a specific embodiment, the amplified fragment is about 23bp in length. In a specific embodiment, the amplified fragment is about 24bp in length. In a specific embodiment, the amplified fragment is about 25bp in length. In a specific embodiment, the amplified fragment is about 26bp in length. In a specific embodiment, the amplified fragment is about 27bp in length. In a specific embodiment, the amplified fragment is about 28bp in length. In a specific embodiment, the amplified fragment is about 29bp in length. In a specific embodiment, the amplified fragment is about 30bp in length. In a specific embodiment, the amplified fragment is about 31bp in length. In a specific embodiment, the amplified fragment is about 32bp in length. In a specific embodiment, the amplified fragment is about 33bp in length. In a specific embodiment, the amplified fragment is about 34bp in length. In a specific embodiment, the amplified fragment is about 35bp in length. In a specific embodiment, the amplified fragment is about 36bp in length. In a specific embodiment, the amplified fragment is about 37bp in length. In a specific embodiment, the amplified fragment is about 38bp in length. In a specific embodiment, the amplified fragment is about 39bp in length. In a specific embodiment, the amplified fragment is about 40bp in length. In a specific example, the amplified fragment is about 41bp in length. In a specific embodiment, the amplified fragment is about 42bp in length. In a specific embodiment, the amplified fragment is about 43bp in length. In a specific embodiment, the amplified fragment is about 44bp in length. In a specific embodiment, the amplified fragment is about 45bp in length. In a specific embodiment, the amplified fragment is about 46bp in length. In a specific embodiment, the amplified fragment is about 47bp in length. In a specific embodiment, the amplified fragment is about 48bp in length. In a specific embodiment, the amplified fragment is about 49bp in length. In a specific embodiment, the amplified fragment is about 50bp in length.

In some embodiments, to reduce the time required for primer extension, a primer is configured to specifically hybridize to a majority of the amplified region in the target molecule. Specifically, in some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 10 to 25 nucleotides (nt) in length. In some embodiments, wherein the amplification product is about 20 to 50bp in length, both primers in a primer pair are about 10 to 25nt in length.

Specifically, in some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 10nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 11nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 12nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 13nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 14nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 15nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 16nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 17nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 18nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 19nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 20nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 21nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 22nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 23nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 24nt in length. In some embodiments where the amplification product is about 20 to 50bp in length, at least one of the pair of primers is about 25nt in length.

As can be appreciated by one of ordinary skill in the art, in the actual primer design process, primer sequences may be selected based on different considerations (e.g., Tm, G/C content, sequence complementarity) in contradiction to each other. Thus, in some embodiments, different considerations may be compared to each other to determine a priority order between the different considerations. In particular, when the selection of a primer sequence based on a lower priority consideration contradicts the selection of a primer sequence based on a higher priority consideration, the selection based on a higher priority consideration may be employed. Example 6 further provides an example process for determining such priority order in section 5.7.4.

4.4 enzymes

Polymerases that can be used in conjunction with the present methods, according to the present disclosure, include thermostable polymerases having strand displacement activity at a temperature range of about 50-80 ℃. In some embodiments, the thermostable polymerase used in the methods of the invention is selected to have strand displacement activity at a temperature of about 70-80 ℃. In some embodiments, the thermostable polymerase has 5'→ 3' polymerase activity and is capable of extending the primer annealed to the template strand from the 3 'end toward the 5' end of the template strand, thereby displacing the original complementary strand in the 5'→ 3' direction. In other embodiments, the thermostable polymerase has 3'→ 5' polymerase activity and is capable of extending the primer annealed to the template strand from the 5 'end toward the 3' end of the template strand, thereby displacing the original complementary strand in the 3'→ 5' direction.

In contrast to strand displacement, certain polymerases (e.g., Taq DNA polymerase) degrade the downstream complementary strand encountered by exonuclease activity. Although the result is also the formation of a double strand with the original template strand and the newly synthesized complementary strand (the original complementary strand is removed by degradation), exonuclease activity can reduce the total amount of amplified nucleic acid fragments and is therefore less than ideal during some (but not all) applications. Thus, certain polymerases have been engineered to remove the 5 '→ 3' exonuclease activity of the wild-type enzyme while retaining the polymerase activity and strand displacement activity. Thus, in some embodiments, a thermostable polymerase has 5 '→ 3' polymerase activity, and no 5 '→ 3' exonuclease activity. In some embodiments, the thermostable polymerase has 3 '→ 5' polymerase activity and no 3 '→ 5' exonuclease activity.

In some embodiments, the thermostable polymerase is a heat-activated enzyme. In some embodiments, the thermostable polymerase is a heat-inactivated enzyme. In some embodiments, the thermostable polymerase has reverse transcriptase activity. In some embodiments, the thermostable polymerase has an amplification rate of at least 10nt/s at its optimal temperature.

Examples of thermostable polymerases that can be used in conjunction with the present patent include, but are not limited to, phi29 DNA polymerase or truncated or mutated forms thereof, DNA polymerase I or truncated or mutated forms thereof, DNA polymerase or truncated or mutated forms thereof, and Bacillus stearothermophilus (Bst) DNA polymerase or truncated or mutated forms thereof, and Thermus aquaticus (Taq) DNA polymerase or truncated or mutated forms thereof.

In some embodiments, the polymerase is Bst DNA polymerase. In some casesIn the examples, the polymerase is full length Bst DNA polymerase. In some embodiments, the polymerase is Bst DNA polymerization (large fragment). In some embodiments, the polymerase is a mutant form of Bst DNA polymerase. In a particular embodiment, the mutated Bst DNA polymerase lacks 5 '→ 3' exonuclease activity. In some embodiments, Bst DNA polymerase is commercially available. In particular embodiments, Bst DNA polymerase is selected from New England

Commercial Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase and Bst 3.0 DNA polymerase.

In some embodiments, the polymerase is DNA polymerase I or a mutant or truncated form thereof. In some embodiments, the polymerase is a wild-type DNA polymerase I large fragment (Klenow). In some embodiments, the polymerase is Klenow exo ^-. In some embodiments, the polymerase is phi29 DNA polymerase or a mutant or truncated form thereof. In some embodiments, the polymerase is

DNA polymerase, Deep

(exo^-) DNA polymerase, Deep

A DNA polymerase, or

(exo^-) A DNA polymerase.

In some embodiments, the polymerase is Taq DNA polymerase. In some embodiments, the polymerase is a mutant form of Taq DNA polymerase. In some embodiments, the Taq DNA polymerase is a heat-activated enzyme. In some embodiments, Taq DNA polymerase is commercially available. In particular embodiments, the Taq DNA polymerase is selected from New England

Hot-start Taq DNA polymerase was purchased,

hot Start Taq DNA polymerase, OneTaq DNA polymerase, Hot Start

DNA polymerase and

taq DNA polymerase. In some embodiments, the Taq DNA polymerase is LongTaq DNA polymerase.

Although the above exemplary enzymes or corresponding commercial products may be used in conjunction with the methods and kits of the present invention, the selection of enzymes in the present invention is in no way limited to the above-described ones. As can be appreciated by those skilled in the art, other enzymes currently known or discovered in the future that meet the requirements of the present patent are also contemplated and included in the present patent. Other polymerases suitable for use in the present disclosure can be generated and selected using methods known in the art. For example, wild-type polymerase can be mutated by site-directed mutagenesis or random mutagenesis to produce peptide variants, which can then be screened (e.g., individually or by high throughput assays) to identify mutants having the desired polymerase activity. For illustrative purposes, several exemplary methods for enzymatic mutagenesis and evolution are provided below.

Directed evolution is a powerful method which involves introducing mutations to a particular gene or oligonucleotide sequence containing that gene to improve and/or alter an enzyme, protein or peptide (e.g., a polymerase, particularly a DNA polymerase). Improved and/or altered enzymes, proteins or peptides can be identified by developing and performing sensitive, high-throughput detection methods that can automatically screen for multiple enzyme or peptide variants (e.g.,>1.0×10⁴). Iterative mutagenesis and screening is typically performed to provide enzymes or peptides with optimized properties. Computational algorithms have also been developed to help identify regions of a mutagenized gene, and can significantly reduce the need for generation and screeningThe number of enzyme or peptide variants of (Fox, R.J., et al., Trends Biotechnol.,2008,26, 132-344; Fox, R.J., et al., Nature Biotechnol.,2007,25, 338-344). A number of directed evolution techniques have been developed and demonstrated to be effective In creating libraries of various mutants, and these methods have been successfully applied to improve various properties of a number of enzymes and proteins (Hibbert et al, Biomol. Eng.,2005,22, 11-19; Huisman and Landen, In Biocatalysis In the pharmaceutical and biotechnology industries, pgs.717-742 (2007), Patel (ed.), CRC Press; Otten and Quax, Biomol. Eng.,2005,22, 1-9; and Sen et al, applied. biochem. Biotechnology, 2007,143, 212-. Enzymatic and protein properties improved and/or altered by directed evolution techniques include, for example: heat resistance to be suitable for high temperature reactions; pH stability to be suitable for biological treatment at lower or higher pH conditions; tolerance, a substrate or product with higher activity can be realized; binding capacity (Km), including amplification of ligand or substrate binding and including non-natural substrates; inhibition (Ki) of a substrate or key intermediate to eliminate the product; activity (kcat) to increase the rate of enzymatic reaction to obtain the desired change; isoelectric point (pI) to increase the solubility of a protein or peptide; acidity coefficient (pKa) to change the ionization state of a protein or peptide relative to pH.

A number of exemplary methods have been developed for mutagenesis and diversification of genes and oligonucleotides to introduce desired properties into specific enzymes, proteins and peptides. Such methods are well known to those skilled in the art. Any of these methods may be used to alter and/or optimize the activity of an enzyme, protein or peptide, including polymerases, such as DNA polymerases. Such methods include, but are not limited to, error-prone polymerase chain reaction (EpPCR), which introduces random point mutations by reducing DNA polymerase fidelity in the PCR reaction (Pritcard et al, J.Theor.biol.,2005,234: 497-509); error-prone rolling circle amplification (epRCA) is similar to epPCR, except that epRCA uses an intact circular plasmid as a template, and a random hexamer with exonuclease-resistant phosphorothioate linkages on the last 2 nucleotides to amplify the plasmid, which is then converted into cells that recircularize the plasmid in tandem repeats (Fujii et al, Nucleic Acids Res.,2004,32: e 145; and Fujii et al, nat. Protoc.,2006,1, 2493-. DNA, gene or family shuffling, typically involves digestion of two or more variant genes with nucleases (e.g., Dnase I or EndoV) to generate a random pool of fragments that are reassembled by cycles of annealing and extension by DNA polymerase to generate a chimeric gene library (Stemmer, Proc. Natl. Acad. Sci. U.S.A.,1994,91, 10747-10751; and Stemmer, Nature,1994,370, 389-391). Staggered expansion (StEP), requiring template priming, followed by repeated two-StEP PCR cycles with denaturation and very short annealing/extension times (as short as 5 seconds) (Zhao et al, nat. Biotechnol.,1998,16, 258-261); random Primed Recombination (RPR), in which random sequence primers are used to generate many short DNA fragments that are complementary to fragments of the template (Shao et al, Nucleic Acids Res.,1998,26, 681-683).

Other Methods include heteroduplex recombination, in which linearized plasmid DNA is used to form mismatch-repaired heteroduplexes (See: Volkov et al, Nucleic Acids Res.,1999,27: e 18; Volkov et al, Methods enzymol.,2000,328, 456-463); random chimerism (RACHITT) on transient templates using DNase I fragmentation and size fractionation of single stranded DNA (ssDNA) (See: Coco et al, Nat. Biotechnol.,2001,19, 354-359). Recombinant Extension of Truncated Templates (RETT), which requires template switching of the unidirectionally growing strands from the primers in the presence of unidirectional ssDNA fragments serving as a template pool (See: Lee et al, J.Mol.Cat.,2003,26, 119-); degenerate Oligonucleotide Gene Shuffling (DOGS), wherein degenerate primers are used to control recombination between molecules; (Bergquist and Gibbs, Methods mol. biol.,2007,352, 191-204; Bergquist et al, biomol. eng.,2005,22, 63-72; Gibbs et al, Gene,2001,271, 13-20); incremental Truncation (ITCHY) for creating hybrid enzymes that create a combinatorial library comprising a 1 base pair deletion of the gene or gene fragment of interest (See: Ostermeier et al, Proc. Natl. Acad. Sci. U.S.A.,1999,96, 3562-; thiolase truncation to produce hybrid enzymes (THIO-ITCHY), similar to ITCHY, except that truncation is produced using phosphorothioate dNTPs (See: Lutz et al, Nucleic Acids Res.,2001,29, E16); SCRATCHY, which combines two methods of recombination genes: ITCHY and DNA shuffling (See: Lutz et al, Proc. Natl. Acad. Sci. U.S.A.,2001,98, 11248-11253); random drift mutagenesis (RNDM), in which mutations generated by epPCR are followed by screening/selection for mutations that retain useful activity (See: Bergquist et al, biomol. Eng.,2005,22, 63-72); sequence saturation mutagenesis (SeSaM), a method of random mutagenesis that uses random incorporation and cleavage of phosphorothioate nucleotides to generate a pool of random length fragments that serve as a template for expansion in the presence of "universal" bases (e.g., inosine), replication of inosine-containing complements resulting in random base incorporation and mutagenesis (See: Wong et al, Biotechnol. J.,2008,3, 74-82; Wong et al, Nucleic Acids Res.,2004,32, e 26; Wong et al, anal. biochem.,2005,341, 187-189.). Synthetic shuffling using overlapping oligonucleotides designed to encode "all genetic diversity in the target" and allowing very high diversity in the shuffled progeny (See: New et al, Nat. Biotechnol.,2002, 20, 1251-1255); the nucleotide exchange and excision technique, NexT, utilizes dUTPs incorporation followed by end-point DNA fragmentation with uracil-DNA glycosylase in combination with piperidine treatment (See: Muller et al, Nucleic Acids Res.,33: e 117).

Further mutagenesis methods include sequence homology independent protein recombination (SHIPCRC), in which a linker is used to facilitate fusion between two remotely related or unrelated genes and a series of chimeras are generated between the two genes, resulting in a single cross hybrid (See: Sieber et al, Nat. Biotechnol., 2001,19, 456-460); gene site saturation mutagenesis^TM(GSSM^TM) Wherein the starting material comprises a supercoiled double-stranded DNA (dsDNA) plasmid comprising an insert and two primers which are denatured at the desired mutation sites, thereby enabling the introduction of all amino acid variations at each position of the protein or peptide individually (See: Kretz et al, Methods enzymol.,2004,388, 3-11); combinatorial Cassette Mutagenesis (CCM), which involves the replacement of a specific region containing a large number of possible amino acid sequence changes with short oligonucleotide cassettes (See: Reidhaar-Olson et al methods enzymol.,1991,208, 564-586; Reidhaar-Olson et al science,1988,241, 53-57). Combining multi-box mutagenesis (CMCM) withCCM is substantially similar and uses epPCR to identify hot spots and hot spot regions at high mutation rates, and then expanded by CMCM to cover defined regions of the protein sequence space (See: Reetz et al, Angew. chem. int. Ed Engl.,2001,40, 3589-3591); mutant technology, in which the conditional ts mutant plasmid utilizes the mutD5 gene, which encodes a mutant subunit of DNA polymerase III, allowing a 20 to 4000 fold increase in the frequency of random and natural mutations during selection and preventing the accumulation of deleterious mutations when selection is not required (See: Selifofova et al, appl.environ.Microbiol., 2001,67, 3645-); low et al, J.mol.biol.,1996,260, 3659-.

Other exemplary methods include direct-view Mutagenesis (LTM), a multidimensional Mutagenesis method for assessing and optimizing mutations in selected amino acid combinations (See: Rajpal et al, Proc. Natl. Acad. Sci. U.S.A.,2005,102, 8466-; gene recombination, a homology-independent DNA rearrangement method, can be applied to multiple genes at a time, or can create large chimera (multiple mutation) libraries of individual genes (See: Short, J.M., U.S. Pat. No. 5,965,408, Tunable GeneReassembly)^TM) (ii) a An optimization algorithm in Silico Protein Design Automation (PDA) that anchors a structurally defined protein backbone with a specific folding structure and searches in sequence space for amino acid substitutions that stabilize protein folding and overall protein energy, and is generally most efficient for the calculation of proteins of known three-dimensional structure (See: Hayes et al, proc.natl.acad.sci.u.s.a.,2002,99, 15926-; iterative Saturation Mutagenesis (ISM), which involves the use of structural/functional knowledge to select possible sites for enzymatic modification, the use of mutagenesis methods (e.g., Stratagene QuikChange (Stratagene; San Diego CA), saturation mutagenesis at a selected site, screening/selection to obtain a desired property, and the use of improved clones, starting at another site and repeating until the desired activity is obtained (See: Reetz et al, Nat. Protoc.,2007, 2, 891-fold 903; Reetz et al, Angew. chem. int. ed Engl.,2006,45, 7745-fold 7751).

In addition to the above-described biological methods, evolution of enzymes (e.g., polymerases) can also be performed using chemical synthesis methods. For example, it can be obtained by usingKnown solution phase or solid phase peptide synthesis techniques to synthesize large combinatorial peptide libraries comprising mutants (e.g.,>1.0×10⁶seed) (See review: Shin, D. -S., et al., J.biochem. mol. Bio.,2005,38, 517-525.). Chemical peptide synthesis methods are useful for producing polymerase variants comprising a variety of alpha-amino acids, including natural proteinogenic amino acids, as well as non-natural and/or non-proteinogenic amino acids, such as amino acids with non-proteinogenic side chains, or D-amino acids, or beta-amino acids.

Any of the above methods for enzymatic mutagenesis may be used alone or in any combination to improve the performance of enzymes, proteins and peptides. Similarly, any of the above-described mutagenesis methods and/or displayed content may be used alone or in any combination to enable the production of polymerase variants that may be selected to improve properties.

In some embodiments, the mutant polymerase has at least 80% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 85% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 90% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 95% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 96% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 97% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 98% nucleic acid sequence identity to the corresponding wild-type polymerase. In some embodiments, the mutant polymerase has at least 99% nucleic acid sequence identity to the corresponding wild-type polymerase.

Methods for determining sequence identity are known in the art. For example, examining the nucleic acid or amino acid sequences of two polypeptides will reveal identity and similarity between the compared sequences. Algorithms well known to those skilled in the art, such as Align, BLAST, Clustal W and others, can be used to compare and determine the similarity or identity of the original sequences, and can also determine the presence or importance of gaps in the sequences that can be assigned weights or scored. Such algorithms are also known in the art and are similarly applicable to determining similarity or identity of nucleotide sequences. Parameters sufficient for similarity determination are calculated based on well known statistical similarity calculation methods, or the chance of finding a similar match in a random polypeptide and determining the significance of the match. Two or more sequences can be compared using a computer for visualization optimization by one skilled in the art, if desired.

Exemplary parameters for determining the relatedness of two or more sequences using the BLAST algorithm are shown below, for example. Briefly, amino acid sequence alignments can be performed using BLASTP 2.0.8 version (Jan-05-1999) and the following parameters: matrix: 0BLOSUM 62; opening of vacant sites: 11; notch extension: 1; x _ dropoff: 50; it is desired that: 10.0; word number: 3; a filter: and (4) opening. Nucleic acid sequence alignments can be performed using BLASTN version 2.0.6 (16/9/1998) and the following parameters: matching: 1; mismatch: -2; opening of vacant sites: 5; notch extension: 2; x _ dropoff: 50; it is desired that: 10.0; word number: 11; a filter: and closing. One skilled in the art will appreciate how the above parameters can be modified, for example, to increase or decrease the stringency of the comparison, and to determine the relatedness of two or more sequences.

In some embodiments, a functional variant of a protein comprises one or more conservative substitutions as compared to the wild-type counterpart. In some embodiments, a functional variant of a protein comprises one or more amino acid residues substituted with a non-natural amino acid residue, as compared to the wild-type counterpart.

Both wild-type and mutant enzymes (e.g., polymerases) can be screened to select for enzymes having desirable properties for use in connection with the methods of the invention. In some embodiments, screening is performed for those enzymes and/or mutant variants that retain at least DNA polymerase activity and strand displacement activity. In some embodiments, the screening is performed for variants of the enzyme and/or mutation that have thermostability and activity in a temperature range of about 50-80 ℃. In some embodiments, the screening is performed for variants of the enzyme and/or mutation that have thermostability and activity in a temperature range of about 70-80 ℃. In some embodiments, the screening is performed for variants of the enzyme and/or mutation having an optimal temperature in the temperature range of 50-80 ℃. In some embodiments, the screening is performed for variants of the enzyme and/or mutation having an optimal temperature in the temperature range of 70-80 ℃. In some embodiments, screening is performed for variants of the enzyme and/or mutation that have an extension rate of at least 10nt/s at an optimal temperature of 50-80 ℃. In some embodiments, the enzyme having reverse transcriptase activity and/or mutated variants are screened. In some embodiments, the screening is performed for variants of the enzyme and/or mutation that lack exonuclease activity. In some embodiments, heat-activated and/or heat-inactivated enzymes are screened for enzymes and/or mutated variants.

Screening can be performed using methods and assays known in the art. For example, whether a given polymerase has strand displacement activity can be determined using the Strand Displacement Amplification (SDA) assays described or used by Walker et al (Nucleic Acids Res.1992Apr 11; 20(7): 1691-1696) and Gao et al (Nucleic Acids Res.,2009Feb 1; 37, e 20). Thermodynamic properties of a given enzyme, including its optimal temperature and extension rate, can be determined using assays such as those described by Rychlik et al (Nucleic Acids Res.,1990Nov 21; 18(21), 6409-6412). Whether a polymerase has reverse transcriptase activity can be determined using the assay methods described or used by Shi et al (J.Am.chem.Soc.,2015Oct 16; 137(43), 13804-. Whether a polymerase has exonuclease activity can be determined using the assay methods described or used by Holland et al (P.Natl.Acad.Sci.USA, 1991Aug 15; 88(16),7276-7280) and Beese et al (Beese et al, EMBO J.,1991Jan 1; 10(1), 25-33.).

A method For rapid screening of a large number of different mutant enzyme, protein or peptide variants involves the use of display technology (For a review, see: Ullman, C.G., et al., Briefings Functional Genomics, 2011,10, 125-. The peptide display technology has the following advantages: specific peptide-encoding information (e.g., RNA or DNA sequence information) can be linked to or otherwise associated with each corresponding peptide in the library, and this information is accessible and readable (e.g., by amplification and sequencing) after a screening event, thereby enabling identification of individual peptides in a large library that exhibit desirable properties (e.g., high binding affinity). Mutants of the enzyme peptides exhibiting the desired improved properties (hits) can be subjected to additional mutagenesis to produce highly optimized enzyme variants.

4.5 methods

One aspect of the present disclosure provides methods for amplifying and detecting a target nucleic acid in a sample. The current method greatly improves the existing denatured bubble-mediated strand displacement amplification (SEA) -based technology, which was first reported by Shi et al in 2016 (Shi et al, "trigged isothermal PCR by condensation-mediated strand and exchange amplification" Chem Commun (Camb) (2016) 4; 52(77): 11551-4).

Shi et al reported SEA assays using Bst DNA polymerase and a pair of specific primers for exponential DNA amplification under isothermal conditions. Isothermal SEA methods are based on the spontaneous formation of denatured areas ("denatured bubbles") in double-stranded dna (dsdna) due to environmental thermal fluctuations. Then, a pair of oligonucleotide primers invades the variable vesicle, binds to the single-stranded DNA not entangled in the variable vesicle, extends and replaces the original complementary strand under the action of a polymerase to generate an amplified fragment. Thus, it is believed that this method takes advantage of the small variable bubbles that form spontaneously without heating the sample, thereby advantageously eliminating the need for a thermal cycler and performing the PCR reaction at a temperature at which the polymerase is typically selected to have optimal activity (Shi et al, 2016, supra).

Since its establishment, isothermal SEA methods have been demonstrated and used for Rapid detection and diagnosis of various pathogens, such as Listeria monocytogenes (Zhang et al, "Rapid detection of pathogen pathogens by strain and exchange amplification," Analytical Biochemistry (2018)545: 38-42); mycoplasma pneumoniae (Shi et al, "Rapid diagnosis of Mycoplasma pneumoniae infection by differentiation of microbial amplification: Complex with LAMP and real-time PCR," Scientific Reports, vol.9; and particle number:896 (2019)); staphylococcus aureus (Liu et al, "Rapid and Simple Detection of Via)ble food Pathogen Staphylococcus aureus, "Front Chem. (2019) Mar 12; 7: 124); escherichia coli (Chinese patent application publication No. CN 105176971A); pine wood nematodes (Liu et al, "The Rapid detection of The Bursaphelenchus Xylophilus by detection of The branched-mediated Strand Exchange Amplification," anal. Sci.2019,18P-461P. "); and adulterated meat (Liu et al, "A simple isopropyl nucleic acid amplification method for the infection on-site identification for evaluation of surface source in mutton," Food Control,2019, 98297 charge 302). Isothermal SEA methods have also been demonstrated to detect trace amounts of target nucleic acids (concentrations as low as 1.0X 10) in samples ^-14M) (chinese patent application publication No.: CN 109136337 a). In addition, Bst DNA polymerase has been found to have intrinsic reverse transcriptase activity (Shi et al, "Natate reverse transcriptase activity of DNA polymerase for antisense RNA direct detection." J.Am.chem.Soc. (2015)137, 13804-. It has been demonstrated that isothermal SEA reaction using Bst DNA polymerase can efficiently amplify and detect a target RNA molecule in a sample without using another reverse transcriptase (Chinese patent application publication No.: CN 105176971A).

The present disclosure surprisingly found that even within a small range of a few degrees celsius, changing the isothermal SEA method by rapidly changing the reaction temperature significantly improved thousands of fold amplification efficiency and rate. Thus, in certain paragraphs of the present application, the method is referred to as "accelerated SEA". Without being bound by theory, the present disclosure contemplates that the formation of a denatured bubble can be promoted by causing temperature fluctuations over a small temperature range, which makes it more efficient for primer entry and hybridization. Furthermore, since the temperature fluctuations are near the optimal temperature for the polymerase to catalyze primer extension, there is no increased frequency of denaturing bubbles occurring at the expense of increased extension rate. The amplified fragments of this reaction are very short (typically 20-50bp) except for small temperature fluctuations. Thus, even though the activity of the polymerase may be slightly reduced, the polymerase may still achieve amplification of such short fragments. Thus, in various examples, the sensed temperature fluctuations are within 1 ℃ to 15 ℃ of the optimal extension temperature of the polymerase. In various embodiments, the temperature used in the present method fluctuates in a range of less than about 30 ℃. In various embodiments, the temperature fluctuation range used in the present method is less than about 25 ℃. In various embodiments, the temperature used in the present method fluctuates in a range of less than about 20 ℃.

In some embodiments, the method comprises contacting a polymerase and a pair of specific oligonucleotide primers with a sample containing or suspected of containing a target nucleic acid, thereby forming an amplification mixture. The method further includes subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature in order to amplify the sequence of the target nucleic acid via Polymerase Chain Reaction (PCR). The production of amplified fragments can then be detected, which can be used as a basis for various assays and diagnostics.

According to the present disclosure, at least one of the first and second temperatures is suitable for (a) forming a variable bubble in the double-stranded target molecule; (b) the primer can be specifically hybridized with the target nucleic acid; (c) polymerase catalyzed extension of a primer in an amplification mixture; or any combination of (a) to (c). In some embodiments, the temperature range between the first temperature and the second temperature is suitable for (a) forming a variable bubble in the double-stranded target molecule; (b) the primer can be specifically hybridized with the target nucleic acid; (c) polymerase catalyzed extension of a primer in an amplification mixture; or any combination of (a) to (c).

In some embodiments, the selection of the first or second temperature is based on the type of polymerase used for amplification. In some embodiments, the second temperature is selected near the optimal temperature for the polymerase used. Methods for determining the optimal temperature for an enzyme are known in the art. For example, to determine the optimal temperature at which a given polymerase catalyzes primer extension under given conditions, an amplification mixture can be prepared in multiple aliquots, each containing the polymerase of interest, the same primers, the target, and the same concentrations of other reactants. Aliquots can be subjected to PCR under different temperature conditions, and the optimal temperature can be determined by comparing the amplification rates (e.g., using real-time PCR monitoring). In addition, the optimal extension temperature of the polymerase can be determined based on reports in the art or recommendations of commercial polymerase manufacturers.

In some embodiments, the second temperature is selected from the polymerase optimum temperature ± 6 ℃. For purposes of illustration and example only, if the optimal extension temperature of the polymerase is 65 ℃, in some embodiments, the second temperature may be selected from about 59-71 ℃. Specifically, in this example, the second temperature may be about 59 ℃, about 59.5 ℃, about 60 ℃, about 60.5 ℃, about 61 ℃, about 61.5 ℃, about 62 ℃, about 62.5 ℃, about 63 ℃, about 63.5 ℃, about 64 ℃, about 64.5 ℃, about 65 ℃, about 65.5 ℃. About 66 ℃, about 66.5 ℃, about 67 ℃, about 67.5 ℃, about 68 ℃, about 68.5 ℃, about 69 ℃, about 69.5 ℃, about 70 ℃, about 70.5 ℃ or about 71 ℃. In other embodiments, the second temperature is selected from the group consisting of a polymerase optimal extension temperature ± 5 ℃, + -4 ℃, + -3 ℃, + -2 ℃ or ± 1 ℃.

In various embodiments, the first temperature is about 1 ℃ to about 30 ℃ higher or lower than the second temperature. In various embodiments, the first temperature is about 1 ℃ to about 25 ℃ higher or lower than the second temperature. In various embodiments, the first temperature is about 1 ℃ to about 20 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 1 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 1.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 2 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 2.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 3 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 3.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 4 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 4.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 5.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 6 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 6.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 7 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 7.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 8 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 8.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 9 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 9.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 10 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 10.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 11 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 11.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 12 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 12.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 13 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 13.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 14 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 14.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 15 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 15.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 16 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 16.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 17 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 17.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 18 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 18.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 19 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 19.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 20 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 20.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 21 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 21.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 22 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 22.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 23 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 23.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 24 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 24.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 25 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 25.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 26 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 26.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 27 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 27.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 28 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 28.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 29 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 29.5 ℃ higher or lower than the second temperature. In some embodiments, the first temperature is about 30 ℃ higher or lower than the second temperature.

In some embodiments, the first temperature is no more than about 25C higher than the second temperature, and the first temperature is equal to or less than about 90C. In some embodiments, the first temperature is no more than about 25 ℃ higher than the second temperature, and the first temperature is equal to or less than about 89 ℃. In some embodiments, the first temperature is no more than about 25 ℃ higher than the second temperature, and the first temperature is equal to or less than about 88 ℃. In some embodiments, the first temperature is no more than about 25 ℃ higher than the second temperature, and the first temperature is equal to or less than about 87 ℃. In some embodiments, the first temperature is no more than about 25 ℃ higher than the second temperature, and the first temperature is equal to or less than about 86 ℃. In some embodiments, the first temperature is no more than about 25 ℃ higher than the second temperature, and the first temperature is equal to or less than about 85 ℃. In any of the embodiments described in this paragraph, the polymerase can be Bst DNA polymerase, Taq DNA polymerase, DNA polymerase I,

DNA polymerase, phi29 DNA polymerase or truncated or mutated forms of any of these polymerases.

In some embodiments, the polymerase is Bst DNA polymerase and the first temperature is selected from the range of about 68-78 ℃ and the second temperature is selected from the range of about 55-69 ℃. Specifically, in a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 68 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 68.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 69 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 69.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 70 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 70.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 71 deg.C and the second temperature is selected from the range of about 55-69 deg.C. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 71.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 72 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 72.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 73 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 73.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 74 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 74.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 75 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 75.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 76 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 76.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 77 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 77.5 ℃ and the second temperature is selected from the range of about 55-69 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 78 ℃ and the second temperature is selected from the range of about 55-69 ℃. In particular, in any of the embodiments described in this paragraph, the second temperature selected from the range of about 55-69 ℃ may be about 55 ℃, 55.5 ℃, 56 ℃, 56.5 ℃, 57 ℃, 57.5 ℃, 58 ℃, 58.5 ℃. 59 deg.C, 59.5 deg.C, 60 deg.C, 60.5 deg.C, 61 deg.C, 61.5 deg.C, 62 deg.C, 62.5 deg.C, 63 deg.C, 63.5 deg.C, 64 deg.C, 64.5 deg.C, 65 deg.C, 65.5 deg.C, 66 deg.C, 66.5 deg.C, 67 deg.C, 67.5 deg.C, 68 deg.C, 68.5 deg.C or 69 deg.C. In particular, in any of the embodiments described in this paragraph, the Bst DNA polymerase can be a wild-type Bst DNA polymerase, or a Bst DNA polymerase consisting of a large fragment of Bst DNA polymerase, Bst 2.0 WarmStart DNA polymerase, and Bst 3.0 DNA mutation or truncation.

In some embodiments, the polymerase is Bst DNA polymerase and the first temperature is selected from the range of about 68-78 ℃ and the second temperature is selected from the range of about 55-69 ℃. Specifically, in a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 55 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 55.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 56 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 56.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 57 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 57.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 58 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 58.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 59 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 59.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 60 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 60.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 61 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 61.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 62 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 62.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 63 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 63.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 64 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 64.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 65 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 65.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 66 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 66.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 67 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 67.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 68 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 68.5 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 68-78 ℃ and the second temperature is about 69 ℃. In particular, in any of the embodiments described in this paragraph, the first temperature selected from the range of about 68-78 ℃ may be about 68 ℃, 68.5 ℃, 69 ℃, 69.5 ℃, 70 ℃, 70.5 ℃, 71.5 ℃. 72 ℃, 72.5 ℃, 73 ℃, 73.5 ℃, 74 ℃, 74.5 ℃, 75 ℃, 75.5 ℃, 76 ℃, 76.5 ℃, 77 ℃, 77.5 ℃ or 78 ℃. In particular, in any of the embodiments described in this paragraph, the Bst DNA polymerase can be a wild-type Bst DNA polymerase, or a Bst DNA polymerase consisting of Bst DNA polymerase, large fragments, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase, and Bst 3.0 DNA mutations or truncations.

In some embodiments, the polymerase is Bst DNA polymerase, the first temperature is selected from the range of about 72-76 ℃ and the second temperature is selected from the range of about 61-65 ℃. Specifically, in particular embodiments where the polymerase is Bst DNA polymerase, the first temperature is about 72 ℃, the second temperature is about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, or about 65 ℃. In particular embodiments where the polymerase is Bst DNA polymerase, the first temperature is about 73 ℃, the second temperature is about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, or about 65 ℃. In particular embodiments where the polymerase is Bst DNA polymerase, the first temperature is about 74 ℃, the second temperature is about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, or about 65 ℃. In particular embodiments where the polymerase is Bst DNA polymerase, the first temperature is about 75 ℃, the second temperature is about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, or about 65 ℃. In particular embodiments where the polymerase is a Bst DNA polymerase, the first temperature is about 76 ℃, the second temperature is about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃, or about 65 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 76 ℃ and the second temperature is about 62 ℃. In a particular embodiment where the polymerase is Bst DNA polymerase, the first temperature is about 76 ℃ and the second temperature is about 61 ℃. In particular, in any of the embodiments described in this paragraph, the Bst DNA polymerase can be a wild-type Bst DNA polymerase, or a mutated or truncated Bst DNA polymerase, such as Bst DNA polymerase large fragment, Bst 2.0 DNA polymerase, Bst 2.0 WarmStart DNA polymerase, and Bst 3.0 DNA polymerase.

In some embodiments, the polymerase is Taq DNA polymerase or a truncated or mutant form thereof, and the first temperature is selected from the range of about 70-88 ℃ and the second temperature is selected from the range of about 58-70 ℃. Specifically, in a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 70 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 70.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 71 ℃, and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 71.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 72 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 72.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 73 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 73.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 74 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 74.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 75 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 75.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 76 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 76.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 77 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 77.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 78 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 78.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 79 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 79.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 80 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 80.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 81 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 81.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 82 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 82.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 83 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 83.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 84 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 84.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 85 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 85.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 86 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 86.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 87 ℃, and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is about 87.5 ℃ and the second temperature is selected from the range of about 58-70 ℃. In a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is about 88 ℃ and the second temperature is selected from the range of about 58-70 ℃. In particular, in any of the embodiments described in this paragraph, the first temperature selected from the range of about 58-70 ℃ may be about 58 ℃, 58.5 ℃, 59 ℃, 59.5 ℃, 60 ℃, 60.5 ℃, 61 ℃, 61.5. 62 ℃, 62.5 ℃, 63 ℃, 63.5 ℃, 64 ℃, 64.5 ℃, 65 ℃, 65.5 ℃, 66 ℃, 66.5 ℃, 67 ℃, 67.5 ℃, 68 ℃, 68.5 ℃, 69 ℃, 69.5 ℃ or 70 ℃. In particular, in any of the embodiments described in this paragraph, the Taq DNA polymerase can be wild-type Taq DNA polymerase, or a mutant or truncated Taq DNA polymerase selected from Hot Start Taq DNA polymerase, EpiMark Hot Start Taq DNA polymerase. OneTaq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase.

In some embodiments, the polymerase is Taq DNA polymerase or a truncated or mutant form thereof, and the first temperature is selected from the range of about 70-88 ℃ and the second temperature is selected from the range of about 70-88 ℃. 58-70 ℃. Specifically, in a particular embodiment where the polymerase is Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 58 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 58.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 59 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 59.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 60 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 60.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 61 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 61.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 62 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 62.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 63 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 63.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 64 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 64.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 65 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 65.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 66 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 66.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 67 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 67.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 68 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 68.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 69 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 69.5 ℃. In a particular embodiment where the polymerase is a Taq DNA polymerase, the first temperature is selected from the range of about 70-88 ℃ and the second temperature is about 70 ℃. In particular, in any of the embodiments described in this paragraph, the Taq DNA polymerase can be wild-type Taq DNA polymerase, or a mutant or truncated Taq DNA polymerase selected from Hot Start Taq DNA polymerase, EpiMark Hot Start Taq DNA polymerase. OneTaq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase.

In some embodiments, the polymerase is DNA polymerase I or a truncation or mutant thereof, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is selected from the range of about 30-40 ℃. Specifically, in particular embodiments where the polymerase is DNA polymerase I, the first temperature is about 50 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 50.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 51 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 51.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 52 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 52.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 53 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 53.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 54 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 54.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 55 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment, where the polymerase is DNA polymerase I, the first temperature is about 55.5 ℃, And the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 56 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 56.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 57 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 57.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 58 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 58.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 59 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 59.5 ℃ and the second temperature is selected from the range of about 30-40 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is about 60 ℃ and the second temperature is selected from the range of about 30-40 ℃. In particular, in any of the embodiments described in this paragraph, the second temperature is selected from the range of about 30-40 ℃, and can be about 30 ℃, 30.5 ℃, 31.5 ℃, 32 ℃, 32.5 ℃, 33 ℃, 33.5 ℃, 34 ℃, 34.5 ℃, 35 ℃, 35.5 ℃, 36 ℃, 36.5 ℃, 37 ℃, 37.5 ℃, 38 ℃, 38.5 ℃, 39 ℃, 39.5 ℃ or 40 ℃. In particular, in any of the embodiments described in this paragraph, the polymerase may be selected from wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow), or Klenow exo ^-。

In some embodiments, the polymerase is DNA polymerase I or a truncated or mutant form thereof, and the first temperature is selected from the range of about 50-60 ℃ and the second temperature is selected from the range of about 30-40 ℃. Specifically, in a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 30 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 30.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 31 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 31.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 32 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 32.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 33 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 33.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 34 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 34.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 35 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 35.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 36 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 36.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 37 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 37.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 38 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 38.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 39 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 39.5 ℃. In a particular embodiment where the polymerase is DNA polymerase I, the first temperature is selected from the range of about 50-60 ℃ and the second temperature is about 40 ℃. In particular, in any of the embodiments described in this paragraph, the second temperature is selected from the range of about 50-60 ℃, and can be about 50 ℃, 50.5 ℃, 51.5 ℃, 52 ℃, 52.5 ℃, 53 ℃, 53.5 ℃, 54 ℃, 54.5 ℃, 55 ℃, 55.5 ℃, 56 ℃, 56.5 ℃, 57, 57.5 ℃, 58 ℃, 58.5 ℃, 59 ℃, 59.5 ℃ or 60 ℃. In particular, in any of the embodiments described in this paragraph, the polymerase may be selected from wild-type DNA polymerase I, large fragment (Klenow), or Klenow exo-.

In some embodiments, the polymerase is

A DNA polymerase or truncation or mutant thereof, the first temperature being selected from the range of about 70-80 ℃ and the second temperature being selected from the range of about 55-70 ℃. In particular, when the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 70 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 70.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 71 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 71.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 72 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 72.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 73 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 73.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 74 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 74.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 75 ℃ andthe second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 75.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 76 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 76.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 77 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 77.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 78 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 78.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

Of DNA polymerasesIn particular embodiments, the first temperature is about 79 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 79.5 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 80 ℃ and the second temperature is selected from the range of about 55-70 ℃. In particular, in any of the embodiments described in this paragraph, the second temperature selected from the range of about 55-70 ℃ may be about 55 ℃, 55.5 ℃, 56 ℃, 56.5 ℃, 57 ℃, 57.5 ℃, 58 ℃, 58.5 ℃. 59 deg.C, 59.5 deg.C, 60 deg.C, 60.5 deg.C, 61 deg.C, 61.5 deg.C, 62 deg.C, 62.5 deg.C, 63 deg.C, 63.5 deg.C, 64 deg.C, 64.5 deg.C, 65 deg.C, 65.5 deg.C, 66 deg.C, 66.5 deg.C, 67 deg.C, 67.5 deg.C, 68 deg.C, 68.5 deg.C, 69 deg.C, 69.5 deg.C or 70 deg.C. In particular, in any of the embodiments described in this paragraph, the polymerase can be Vent DNA polymerase, Vent (exo-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo-) DNA polymerase.

In some embodiments, the polymerase is a DNA polymerase or truncated or mutant form thereof, and the first temperature is selected from the range of about 70-80 ℃ and the second temperature is selected from the range of about 55-70 ℃. In particular, when the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 75 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 78.5 ℃ and the second temperature is selected from aboutThe temperature of the mixture is 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 79 ℃ and the second temperature is selected from the range of about 55-70 ℃. In the case that the polymerase is

In a particular embodiment of the DNA polymerase, the first temperature is about 80 ℃ and the second temperature is selected from the range of about 55-70 ℃. In particular, in any of the embodiments described in this paragraph, the second temperature selected from the range of about 55-70 ℃ may be about 70 ℃, 70.5 ℃, 71 ℃, 71.5 ℃, 72 ℃, 72.5 ℃, 73 ℃, 73.5 ℃, 74 ℃, 74.5 ℃, 75 ℃, 75.5 ℃, 76 ℃, 76.5 ℃, 77 ℃, 77.5 ℃, 78 ℃, 78.5 ℃, 79 ℃, 79.5 ℃ or 80 ℃. In particular, in any of the embodiments described in this paragraph, the polymerase can be Vent DNA polymerase, Vent (exo-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo-) DNA polymerase.

In some embodiments, the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃, and the second temperature is selected from the range of about 20-37 ℃. Specifically, in a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 40 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 40.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 41 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 41.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 42 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 42.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 43 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 43.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 44 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 44.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 45 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 45.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 46 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 46.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 47 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 47.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 48 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 48.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 49 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 49.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 50 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 50.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 51 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 51.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 52 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 52.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 53 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 53.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 54 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 54.5 ℃ and the second temperature is selected from the range of about 20-37 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is about 55 ℃ and the second temperature is selected from the range of about 20-37 ℃.

In some embodiments, the polymerase is phi29 DNA polymerase and the first temperature is selected from the range of about 40-55 ℃ and the second temperature is selected from the range of about 20-37 ℃. Specifically, in a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 20 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 20.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 21 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 21.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 22 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 22.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 23 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 23.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 24 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 24.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 25 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 25.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 26 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 26.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 27 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 27.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 28 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 28.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 29 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 29.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 30 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 30.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 31 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 31.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 32 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 32.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 33 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 33.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 34 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 34.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 35 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 35.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 36 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 36.5 ℃. In a particular embodiment where the polymerase is phi29 DNA polymerase, the first temperature is selected from the range of about 40-55 ℃ and the second temperature is about 37 ℃. In particular, in any of the embodiments described in this paragraph, the first temperature selected from the range of about 40-55 ℃ may be about 40 ℃, 40.5 ℃, 41 ℃, 41.5 ℃, 42 ℃, 42.5 ℃, 43 ℃, 43.5 ℃, 44 ℃, 44.5 ℃, 45 ℃, 45.5 ℃, 46 ℃, 46.5 ℃, 47 ℃, 47.5 ℃, 48 ℃, 48.5 ℃, 49 ℃, 49.5 ℃, 50 ℃, 50.5 ℃, 51.5 ℃, 52 ℃, 52.5 ℃, 53 ℃, 53.5 ℃, 54 ℃, 54.5 ℃ or 55 ℃.

In some embodiments, the primer pair is designed to amplify a region of the target nucleic acid molecule that is less than 100bp in length. In some embodiments, the amplification product produced by the present methods is less than 90bp in length. In some embodiments, the amplification product produced by the present methods is less than 80bp in length. In some embodiments, the amplification product produced by the present methods is less than 70bp in length. In some embodiments, the amplification product produced by the present methods is less than 60bp in length. In some embodiments, the amplification product produced by the present methods is less than 50bp in length. In some embodiments, the amplification product produced by the present methods is about 20-50bp in length. In some embodiments, the amplification product produced by the present methods is about 30-50bp in length. In some embodiments, the amplification product produced by the present methods is about 35-50bp in length.

In some embodiments, to reduce the time required for primer extension, primer pairs are designed to amplify short amplified fragments of about 20bp to about 50bp in length. The amplified fragments comprise at least a central portion corresponding to a unique sequence in the target nucleic acid molecule, which central portion may be flanked by primer sequences that are identical or different from the sequence in the target molecule. For example, in a particular embodiment, the amplified fragment is about 20bp in length. In a specific embodiment, the amplified fragment is about 21bp in length. In a specific embodiment, the amplified fragment is about 22bp in length. In a specific embodiment, the amplified fragment is about 23bp in length. In a specific embodiment, the amplified fragment is about 24bp in length. In a specific embodiment, the amplified fragment is about 25bp in length. In a specific embodiment, the amplified fragment is about 26bp in length. In a specific embodiment, the amplified fragment is about 27bp in length. In a specific embodiment, the amplified fragment is about 28bp in length. In a specific embodiment, the amplified fragment is about 29bp in length. In a specific embodiment, the amplified fragment is about 30bp in length. In a specific embodiment, the amplified fragment is about 31bp in length. In a specific embodiment, the amplified fragment is about 32bp in length. In a specific embodiment, the amplified fragment is about 33bp in length. In a specific embodiment, the amplified fragment is about 34bp in length. In a specific embodiment, the amplified fragment is about 35bp in length. In a specific embodiment, the amplified fragment is about 36bp in length. In a specific embodiment, the amplified fragment is about 37bp in length. In a specific embodiment, the amplified fragment is about 38bp in length. In a specific embodiment, the amplified fragment is about 39bp in length. In a specific embodiment, the amplified fragment is about 40bp in length. In a specific example, the amplified fragment is about 41bp in length. In a specific embodiment, the amplified fragment is about 42bp in length. In a specific embodiment, the amplified fragment is about 43bp in length. In a specific embodiment, the amplified fragment is about 44bp in length. In a specific embodiment, the amplified fragment is about 45bp in length. In a specific embodiment, the amplified fragment is about 46bp in length. In a specific embodiment, the amplified fragment is about 47bp in length. In a specific embodiment, the amplified fragment is about 48bp in length. In a specific embodiment, the amplified fragment is about 49bp in length. In a specific embodiment, the amplified fragment is about 50bp in length.

In some embodiments, the amplification product has a melting temperature (Tm or Tm value) equal to or less than about 90 ℃. In some embodiments, the amplification product has a Tm value equal to or less than about 89 ℃. In some embodiments, the amplification products have a Tm value at or below about 88 ℃. In some embodiments, the amplification products have a Tm value at or below about 87 ℃. In some embodiments of the present invention, the,the amplification product has a Tm value of about 86 ℃ or less. In some embodiments, the amplification products have a Tm value at or below about 85 ℃. In some embodiments, the Tm value of the amplification product is determined using a computer algorithm based on the sequence of the amplification product. In some embodiments, the computer-based algorithm is based on the sequence of the amplification product and one or more other conditions of the amplification mixture, such as, but not limited to, Na⁺Concentration of (1), Mg²⁺Or the concentration of nucleic acid molecules in the amplification mixture. In some embodiments, the computer algorithm is selected from the group consisting of NUPACK network tool (www.nupack.org), DNAMelt network (http:// unaflow. rna. albany. edu/.

In some embodiments, the relatively short amplified fragments allow the amplification reaction to be performed by rapidly changing the reaction temperature between the first temperature and the second temperature, thereby producing a detectable amount of amplified fragments in less than 15 minutes.

In particular, in some embodiments, the method comprises subjecting the amplification mixture to rapid thermal cycling between a first temperature and a second temperature, wherein each thermal cycling time is less than about 20s, or less than about 15s, or less than about 10s, or less than about 8s, or less than about 6s, or less than about 5s, or less than about 4s, or less than about 3s, or less than about 2s, or less than about 1s, or less than about 0.5s, or less than about 0.1 s.

In some embodiments, during each thermal cycle, the amplification mixture is incubated at the first temperature for no more than 5 seconds and at the second temperature for no more than 5 seconds. In some embodiments, during each thermal cycle, the amplification mixture is incubated at the first temperature for no more than 2 seconds and at the second temperature for no more than 2 seconds. In some embodiments, during each thermal cycle, the amplification mixture is incubated at the first temperature for less than about 1 second and at the second temperature for less than about 1 second. In some embodiments, during each thermal cycle, the amplification mixture is incubated at the first temperature for about 0.5 seconds and at the second temperature for about 0.5 seconds. In some embodiments, during each thermal cycle, the amplification mixture is incubated at the first temperature for about 0.1 seconds and at the second temperature for about 0.1 seconds.

In some embodiments, the time to complete each thermal cycle is longer than the sum of the time of incubation at the first temperature and the time of incubation at the second temperature, as time is required to change the reaction temperature between the two temperatures, such time interval being referred to herein as a "ramp time" (i.e., a temperature-change time). According to the present invention, the total ramp-up time in the thermal cycle also includes the time required to decrease the reaction temperature from the first temperature to the second temperature and the time required to increase the reaction temperature from the second temperature to the first temperature. In some embodiments, the total ramp time in the thermal cycle is less than about 10 seconds. In some embodiments, the total ramp time in the thermal cycle is less than about 5 seconds. In some embodiments, the total ramp time in the thermal cycle is less than about 2 seconds. In some embodiments, the total ramp time in the thermal cycle is less than about 1 s. In some embodiments, the total ramp time in the thermal cycle is less than about 0.5 s. In exemplary embodiments, such asExample 9Running the method using a microfluidic platform with a temperature ramp rate of 8 ℃/s is shown to produce detectable specific amplification in less than 8 seconds (40 thermal cycles). Other exemplary methods and apparatus that may be used in conjunction with the present methods and systems are provided below.

Early work in the early 1990 s established the feasibility of using capillary tubes and hot air for temperature control to achieve rapid cycling. In the last 20 years, much work has been done in the field to improve the ability of PCR instruments, particularly thermal cyclers, to rapidly and accurately control and monitor the reaction temperature, according to the PCR methodology paradigm. Researchers have tried various methods and techniques to avoid or reduce the delay in temperature change due to the heat transfer efficiency of the conical tube wall, low specific surface area or heating of large volume samples. Researchers have further reduced the warm-up time by improving the thermal conductivity and designing new reaction chambers and heating elements.

In some embodiments, the number of thermal cycles of the method is about 20 to 50 cycles. In some embodiments, the number of thermal cycles of the method is at least 20 cycles. In some embodiments, the number of thermal cycles of the method is at least 25 cycles. In some embodiments, the number of thermal cycles of the method is at least 30 cycles. In some embodiments, the number of thermal cycles of the method is at least 35 cycles. In some embodiments, the number of thermal cycles of the method is at least 40 cycles. In some embodiments, the number of thermal cycles of the method is at least 45 cycles. In some embodiments, the number of thermal cycles of the method is at least 50 cycles.

In some embodiments, the total reaction time of the process is about 2 to 20 minutes. In some embodiments, the total reaction time of the method is less than 20 minutes. In some embodiments, the total reaction time of the method is less than 15 minutes. In some embodiments, the total reaction time of the method is less than 10 minutes. In some embodiments, the total reaction time of the method is less than 7 minutes. In some embodiments, the total reaction time of the method is less than 5 minutes. In some embodiments, the total reaction time of the method is less than 2 minutes.

In some embodiments, the volume of the amplification mixture ranges from 1 to 30 μ L. In some embodiments, the amplification mixture is 1 μ L. In some embodiments, the amplification mixture is 2 μ L. In some embodiments, the amplification mixture is 3 μ L. In some embodiments, the amplification mixture is 4 μ L. In some embodiments, the amplification mixture is 5 μ L. In some embodiments, the amplification mixture is 6 μ L. In some embodiments, the amplification mixture is 7 μ L. In some embodiments, the amplification mixture is 8 μ L. In some embodiments, the amplification mixture is 9 μ L. In some embodiments, the amplification mixture is 10 μ L. In some embodiments, the amplification mixture is 15 μ L. In some embodiments, the amplification mixture is 20 μ L. In some embodiments, the amplification mixture is 25 μ L. In some embodiments, the amplification mixture is 30 μ L. In certain embodiments, the methods employ microfluidic devices. In some embodiments, the method employs enlarging the droplets of the mixture.

Various samples for use in the present disclosure include, but are not limited to, a biological sample isolated from a subject (e.g., a blood sample, a saliva sample, an oronasal swab), a sample containing nucleic acid molecules isolated from a biological sample, or a sample containing synthetic nucleic acid molecules. In some embodiments, the target nucleic acid is DNA. In some embodiments, the target nucleic acid is RNA. The present invention predicts and demonstrates that the present methods and kits can be used to amplify and detect trace amounts of target nucleic acid molecules present in a sample. In particular embodiments, the amplification mixture contains a concentration of less than 1.0X 10^-12A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of less than 1.0X 10^-13A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of less than 1.0X 10^-14A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of no more than 1.0X 10^-15A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of no more than 1.0X 10^-16A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of no more than 1.0X 10^-17A target nucleic acid for M. In particular embodiments, the amplification mixture contains a concentration of no more than 1.0X 10 ^-18A target nucleic acid for M.

In particular embodiments, the amplification mixture contains less than 1.0X 10⁷Copied target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 1.0X 10⁶Copied target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 1.0X 10⁵Copied target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 1.0X 10⁴Copied target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 1.0X 10³Copied target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 100 copies of the target nucleic acid molecule. In particular embodiments, the amplification mixture contains less than 10 copies of the target nucleic acid molecule.

As will be recognized by those of ordinary skill in the art, the methods and systems of the present invention can detect trace amounts of target nucleic acids present in a sample. To prevent possible contamination of the reaction by nucleic acid molecules floating in the ambient air, in some embodiments, the method further comprises steps to prevent or reduce the effects of possible contamination.

uracil-DNA glycosylase (UDG) is an enzyme that catalyzes the hydrolysis of the N-glycosyl bond between uracil and a sugar residue, releasing free uracil, and leaving a pyrimidinedione site in uracil-containing single-or double-stranded DNA, susceptible to hydrolytic breakdown. UDG is active on DNA containing both single and double stranded uracils (dU), but dUTPs are not substrates for UDG. UDG can be used to specifically degrade nucleic acids (a common source of residual contaminants) produced by previous amplification reactions. In some embodiments, UDG is capable of degrading non-specific products resulting from previous amplification products or erroneous primer extension, while retaining native nucleic acid templates that were intended for amplification. Thus, in some embodiments, the amplification mixture comprises dUTPs for performing the amplification reaction. In a particular example, uracil-DNA glycosylase (UDG) is included in the amplification mixture to carry out the reaction. In a particular embodiment, both dUTPs and UDG are included in the amplification mixture to carry out the reaction. In some embodiments where dUTPs are used for amplification, the amplification mixture does not comprise dTTPs.

The primers herein can be used in conjunction with the present methods, e.g.Section 4.3Primers and primers as describedExample 7Exemplary protocols are described for designing primers. In particular, in some embodiments, the amplification reaction comprises a pair of primers for identifying an amplified region of about 20-50 bp of the target nucleic acid molecule. In particular, in some embodiments, at least one primer is present in the amplification mixture at a concentration of no less than 1.0X 10^-6And M. In some embodiments, at least one primer is present in the amplification mixture at a concentration of no less than 1.5X 10^-6And M. In some embodiments, at least one primer is present in the amplification mixture at a concentration of no less than 2.0X 10^-6And M. In some embodiments, at least one primer is present in the amplification mixture at a concentration of no less than 2.5X 10^-6And M. In some embodiments, the concentration of the at least one primer present in the amplification mixture is notLess than 3.0X 10^-6And M. In some embodiments, all primers are present in the amplification mixture at a concentration of no less than 1.0X 10^-6And M. In some embodiments, all primers are present in the amplification mixture at a concentration of no less than 1.5X 10^-6And M. In some embodiments, all primers are present in the amplification mixture at a concentration of no less than 2.0X 10 ^-6And M. In some embodiments, all primers are present in the amplification mixture at a concentration of no less than 2.5X 10^-6And M. In some embodiments, all primers are present in the amplification mixture at a concentration of no less than 3.0X 10^-6M。

In particular, in some embodiments, the melting temperature (Tm or Tm value) of one primer is within ± 6 ℃ of the second temperature used in the method. The Tm of one primer is within. + -. 5 ℃ of the second temperature used in the method. In some embodiments, the Tm value of one primer is within ± 4 ℃ of the second temperature used in the method. In some embodiments, the Tm value of one primer is within ± 3 ℃ of the second temperature used in the method. In some embodiments, the Tm value of one primer is within ± 2 ℃ of the second temperature used in the method. In some embodiments, the Tm value of one primer is within ± 1 ℃ of the second temperature used in the method. In some embodiments, the Tm value of one primer is within ± 0.5 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 6 ℃ of the second temperature used in the method. The Tm values for all primers are within. + -. 5 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 4 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 4 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 3 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 1 ℃ of the second temperature used in the method. In some embodiments, the Tm values for all primers are within ± 0.5 ℃ of the second temperature used in the method.

In some embodiments, the first temperature employed in the method is within ± 6 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 5 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 4 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 3 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 2 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 1 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is within ± 0.5 ℃ of the Tm value of the amplification product. In some embodiments, the first temperature employed in the method is about the same as the Tm value of the amplification product. In a particular embodiment described in this paragraph, the second temperature employed in the method is within ± 6 ℃ of the Tm value of the at least one primer. In particular embodiments described in this paragraph, the second temperature employed in the method is at least within ± 6 ℃, within ± 5 ℃, within ± 4 ℃, within ± 3 ℃, within ± 2 ℃, within ± 1 ℃ or within ± 0.5 ℃ of the Tm value of one primer. In a particular embodiment described in this paragraph, the second temperature used in the method is about the same as the Tm value of at least one primer used in the method. In the particular embodiment described in this paragraph, the Tm values for a pair of primers are about the same. In particular embodiments described in this paragraph, the Tm values of a pair of primers differ from each other by less than about 3 ℃, about 2 ℃, about 1 ℃, or about 0.5 ℃.

In some embodiments, a pair of primers used in the method each have a melting temperature. The average of the two Tm values of a pair of primers is referred to as the average melting temperature of the pair of primers. In particular, in some embodiments, the second temperature used in the method is within ± 6 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 5 ℃ of the mean melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 4 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 3 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 2 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 1 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is within ± 0.5 ℃ of the average melting temperature of a pair of primers used in the method. In some embodiments, the second temperature used in the method is about the same as the average melting temperature of a pair of primers used in the method. In the particular embodiment described in this paragraph, the Tm values for a pair of primers are about the same. In particular embodiments described in this paragraph, the Tm values of a pair of primers differ from each other by less than about 3 ℃, about 2 ℃, about 1 ℃, or about 0.5 ℃. In a particular embodiment described in this paragraph, the first temperature employed in the method is within ± 6 ℃, within ± 5 ℃, within ± 4 ℃, within ± 3 ℃, within ± 2 ℃, within ± 1 ℃ or within ± 0.5 ℃ of the Tm value of the amplification product. In the particular example described in this paragraph, the first temperature employed in the method is about the same as the Tm value of the amplification product.

Methods for determining the Tm value of a nucleic acid (e.g., an oligonucleotide primer or amplification product) are known in the art. For example, various computer algorithms are known in the art that are capable of determining a Tm value based on a nucleic acid sequence and/or environmental conditions (e.g., salt concentration). Exemplary computer algorithms or software that may be used to determine the Tm value of a nucleic acid include, but are not limited to, NUPACK network tool (www.nupack.org), DNAMelt network (http:// unaflow. rna. albany. edu/. In some embodiments, the computer algorithms or software that may be used to determine the Tm value of a nucleic acid are selected from the group consisting of NUPACK web tools (www.nupack.org), DNAMelt networks (http:// unaffold. rna. albany. edu/.

In some embodiments, the method further comprises determining the Tm value of an amplification product to be produced by the method. In some embodiments, the method further comprises determining the Tm value of at least one primer used in the method. In some embodiments, the method further comprises determining the Tm values of two primers to be used in the method. In some embodiments, the method further comprises determining the Tm values of two primers to be used in the method, and further comprises determining the average melting temperature of a pair of primers to be used in the method. In some embodiments, the Tm value of a primer or amplification product is determined using a computer algorithm based on the sequence of the primer or amplification product. In some embodiments, one or more other conditions based on the sequence of the primer or amplification product and the amplification mixture, such as, but not limited to, Na⁺Concentration of (1), Mg²⁺Or the concentration of nucleic acid molecules in the amplification mixture, and determining the Tm value of the primer or amplification product using a computer algorithm.

The polymerases mentioned here may be used in conjunction with the present methods, for exampleSection 4.4The polymerase is described. Specifically, in some embodiments, the polymerase is a thermostable polymerase described herein. In some embodiments, the amplification mixture contains the polymerase at a concentration of no less than 0.1U/. mu.L. In some embodiments, the amplification mixture contains the polymerase at a concentration of no less than 0.2U/. mu.L. In some embodiments, the amplification mixture contains a polymerase at a concentration of no less than 0.3U/. mu.L. In some embodiments, the amplification mixture contains the polymerase at a concentration of no less than 0.4U/. mu.L. In some embodiments, the amplification mixture contains the polymerase at a concentration of no less than 0.5U/. mu.L. In some embodiments, the amplification mixture contains the polymerase at a concentration of no less than 1U/. mu.L.

In some embodiments, the optimal temperature for the polymerase is between the first temperature and the second temperature used in the method. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 6 ℃. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 5 ℃. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 4 ℃. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 3 ℃. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 2 ℃. In certain embodiments, the optimal temperature for the polymerase is ± 1 ℃ of the second temperature used in the method. In certain embodiments, the optimal temperature for the polymerase is the second temperature used in the method ± 0.5 ℃.

In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 5 ℃. In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 4 ℃. In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 3 ℃. In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 2 ℃. In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 1 ℃. In certain embodiments, the optimal temperature for the polymerase is the first temperature used in the method ± 0.5 ℃.

In a specific embodiment, the present invention discloses a method of amplifying a target nucleic acid molecule in a sample: contacting a Bst DNA polymerase and a pair of oligonucleotide primers with a sample to form an amplification mixture, a first temperature selected from about 76 ℃, about 75 ℃, about 74 ℃, about 73 ℃, about 72 ℃, a second temperature selected from about 61 ℃, about 62 ℃, about 63 ℃, about 64 ℃ and about 65 ℃ being subjected to a plurality of thermal cycles, wherein each thermal cycle comprises incubating the amplification mixture at the first temperature for no more than 1s and incubating the amplification at the second temperature for no more than 1s, for a total incubation time of no more than 2s, thereby producing amplified fragments of about 20-50 base pairs (bp) in length in 10 minutes. Specifically, in this example, the concentration of the target nucleic acid in the sample is less than 1.0X 10^-14And M. More specifically, in this example, the concentration of target nucleic acid in the sample is less than 1.0X 10^-15M, less than 1.0X 10^-16M, less than 1.0X 10^-17M or less than 1.0X 10^-18And M. Specifically, in this example, the concentration of the target nucleic acid in the sample is less than 1.0X 10⁵And (6) copying. More specifically, in this example, the concentration of the target nucleic acid in the sample is less than 1.0X 10 ⁴Copies, less than 1.0X 10³Copies, less than 100 copies or less than 10 copies.

The amplified fragments produced by the present method can be detected using methods known in the art, such as fluorescence detection, colorimetric detection, and electrophoretic detection. Conventional methods for real-time monitoring of PCR amplification can also be used for real-time monitoring of amplification by the present method. Specifically, in some embodiments, the amount of amplification can be detected during each thermal cycle. In other embodiments, the amount of amplification is detected every 2, 5, or 10 thermal cycles. The amplification products can be purified from the amplification mixture and subjected to sequence analysis, such as next generation sequencing, to determine the sequence, source, and molecular properties of the target nucleic acid.

Such detection and analysis of the amplification products may further serve as a basis for various analyses and diagnostics relating to the target nucleic acids and their sources (e.g., biological samples containing the target nucleic acids and subjects providing the biological samples). As a non-limiting example, the methods and kits disclosed herein can be used to detect the presence of a pathogen in a biological sample. For example, the methods and kits can design primers for amplified regions of unique sequences in the genome of a pathogen to detect the presence of the unique sequences in a biological sample. For example, these methods can be used to diagnose infectious diseases caused by pathogens, detect adulteration or pathogen contamination in biological samples, quality control of food and beverages, and the like. As another non-limiting example disclosed herein, the methods and kits disclosed herein can be used to detect a genetic alteration in a subject. In particular, for the detection of single nucleotide polymorphisms and genetic diseases due to point mutations in subjects, including but not limited to. For example, the methods and kits can design primers for amplified regions in genomic sequences known or susceptible to such mutations, and detect the presence of the mutation by sequencing analysis of the amplified product. Other possible uses of the methods and kits disclosed herein will be readily apparent to those of ordinary skill in the art upon reading this disclosure, and other possible uses and applications are contemplated and included in the present disclosure.

Accordingly, in another aspect, provided herein is a method of detecting a target nucleic acid in a sample, the method comprising mixing a polymerase and a pair of oligonucleotide primers with the sample, thereby forming an amplification mixture, thermocycling the amplification mixture a plurality of times between a first temperature and a second temperature, thereby amplifying at least a portion of the target nucleic acid by polymerase chain reaction, and detecting the presence or absence of an amplification product in the amplification mixture. In some embodiments, the first temperature is selected from the range of about 68 ℃ to 78 ℃. In some embodiments, the second temperature is selected from the range of about 55 ℃ to 69 ℃. In some embodiments, a pair of oligonucleotide primers is designed to produce an amplification product that is about 20-50bp long. In some embodiments, the polymerase is selected from Bst DNA polymerase, DNA polymerase I large fragment (Klenow), and

a DNA polymerase, or a mutant or truncated form thereof. In some embodiments, the amplification mixture further comprises dNTPs and polyethylene glycol. In some embodiments, detection of the amplification product is by fluorescence detection, colorimetric detection, or other methods known in the art. For example, in some embodiments, the method also provides real-time monitoring of amplification. In particular, in some embodiments, the amount of amplification produced is measured every 1 thermal cycle. In other embodiments, the amount of amplification is detected every 2, 5, or 10 thermal cycles. The detection and measurement of the amount of the amplification product can be realized by using the traditional real-time monitoring PCR amplification method.

In another aspect, the invention provides a method for diagnosing a pathogen infection in a subject, the method comprising contacting a sample with a polymerase and a pair of oligonucleotide primers designed to amplify a unique sequence in the genome of the pathogen, thereby forming an amplification mixture; thermally cycling the amplification mixture between a first temperature and a second temperature a plurality of times to produce amplification products by polymerase chain reaction; and detecting the presence or absence of amplification product in the amplification mixture. In some embodiments, the first temperature is selected from the range of about 68 ℃ to 78 ℃. In some embodiments, the second temperature is selected from the range of about 55 ℃ to 69 ℃. In some embodiments, the amplification product is about 20-50bp in length. In some embodiments, the polymerase is selected from Bst DNA polymerase, DNA polymerase I large fragment (Klenow), and VentDNA polymerase, or mutated or truncated forms thereof. In some embodiments, the amplification mixture further comprises dntps and polyethylene glycol. In some embodiments, the sample is genomic nucleic acid of the subject. In some embodiments, the sample is an isolated nucleic acid molecule of the subject. In some embodiments, the sample is a bodily fluid sample. In some embodiments, the pathogen is a microorganism, such as a virus, a bacterium, or a fungus. In some embodiments, the pathogen is a parasite, such as a protozoan, a helminth, or an ectoparasite.

In another aspect, provided herein is a method for detecting a genetic alteration in a subject, the method comprising contacting a sample with a polymerase and a pair of oligonucleotide primers designed to be capable of amplifying a target sequence having or suspected of having the genetic alteration, thereby forming an amplification mixture; thermally cycling the amplification mixture between a first temperature and a second temperature a plurality of times to produce amplification products by polymerase chain reaction; and sequencing the amplification product to determine the presence or absence of the genetic alteration. In some embodiments, the first temperature is selected from the range of about 68 ℃ to 78 ℃. In some embodiments, the second temperature is selected from the range of about 55 ℃ to 69 ℃. In some embodiments, the amplicon is about 20-50 bp in length. In some embodiments, the polymerase is selected from Bst DNA polymerase, DNA polymerase I large fragment (Klenow), and

a DNA polymerase, or a mutant or truncated form thereof. In some embodiments, the amplification mixture further comprises dNTPs and polyethylene glycol. In some embodiments, the genetic alteration is a genetic mutation, such as an insertion, deletion, substitution, or copy number variation. In some embodiments, the genetic alteration is a single nucleotide polymorphism And (5) attitude. In some embodiments, the method further comprises diagnosis or prognosis of a genetic condition associated with the genetic alteration.

4.6 kits

In another aspect, the disclosure also provides kits for carrying out the methods. The kit comprises a plurality of components, which are mixed together in an amplification mixture or contained in at least two separate containers. In some embodiments, the kit comprises a polymerase and a pair of nucleotide primers. Primers provided herein (e.g., as inSection 4.3The primers and the primers according toExamples 7Exemplary programmed primers described) and polymerases provided herein (e.g., as described in4.4 sectionThe polymerase described in (1) can be used in conjunction with the present kit.

In some embodiments, the kit comprises dNTPs and a buffer solution suitable for a polymerase. The buffer solution may provide an ionic concentration, pH and/or coenzyme that promotes polymerase activity. Methods for selecting and preparing buffer solutions appropriate for a particular polymerase are known in the art. For example, commercially available polymerases are typically sold in recommended formulations with appropriate buffers. In some embodiments, the kit further comprises polyethylene glycol (PEG). In some embodiments, the polyethylene glycol is PEG 200, PEG 400, PEG 2000, or PEG 4000. In some embodiments, the kit further comprises glycerol.

In some embodiments, the kit further comprises an agent capable of promoting melting of the double strand near the position in the target nucleic acid at which the primer anneals, such as a single-stranded binding protein (SSB). In some embodiments, the SSB is stable and active over the temperature range in which the present method is performed. In particular embodiments, the SSB is derived from a microorganism, such as a bacterium or a bacteriophage. In specific embodiments, the kit comprises a peptide selected from the group consisting of T4 phage 32SSB, T7 phage 2.5SSB, phage 29SSB, and E.coli SSB.

In some embodiments, the kit further comprises reagents for detecting and quantifying the amplification product, such as a fluorescent dye or a pH indicator. Reagents suitable for this purpose are known in the art, for example, certain fluorescent dyes (e.g., Evagreen) emit stronger fluorescent signals when bound to double-stranded amplification products, and the intensity of the fluorescent signal emitted by the amplification reaction is capable of reacting the amount of amplification product produced.

In some embodiments, the kit further comprises instructions for using the kit. For example, in some embodiments, the various components of the kit are provided in a mixture, and the kit includes instructions for adding a suitable amount of sample to form an amplification mixture. Alternatively, in some embodiments, the various components of the kit are provided in at least two separate containers, and the kit includes instructions for mixing the components in separate containers with an appropriate amount of sample to form an amplification mixture.

In specific embodiments, the specification indicates that the amplification mixture comprises the polymerase at a concentration of not less than 0.1U/. mu.L. In specific embodiments, the specification indicates that the amplification mixture comprises the polymerase at a concentration of not less than 0.2U/. mu.L. In specific embodiments, the specification specifies that the amplification mixture comprises a polymerase at a concentration of no less than 0.3U/. mu.L. In specific embodiments, the specification specifies that the amplification mixture comprises a polymerase at a concentration of no less than 0.4U/. mu.L. In specific embodiments, the specification specifies that the amplification mixture comprises a polymerase at a concentration of no less than 0.5U/. mu.L. In specific embodiments, the specification indicates that the amplification mixture comprises the polymerase at a concentration of not less than 1U/. mu.L.

In specific embodiments, the specification indicates that the amplification mixture comprises a concentration of not less than 1.0X 10^-6At least one primer of M. In specific embodiments, the specification indicates that the amplification mixture comprises a concentration of not less than 1.5X 10^-6At least one primer of M. In specific embodiments, the specification indicates that the amplification mixture comprises a concentration of not less than 2.0X 10^-6At least one primer of M. In specific embodiments, the specification indicates that the amplification mixture comprises a concentration of not less than 2.5X 10 ^-6At least one primer of M. In specific embodiments, the specification indicates that the amplification mixture comprises a concentration of not less than 3.0X 10^-6At least one primer of M.

In specific examples, the specification indicates that the amplification mixture comprises two primers, each at a concentration that is not less thanAt 1.0X 10^-6And M. In specific embodiments, the instructions specify that the amplification mixture comprises two primers, each at a concentration of no less than 1.5X 10^-6And M. In specific embodiments, the instructions specify that the amplification mixture comprises two primers, each at a concentration of no less than 2.0X 10^-6And M. In specific examples, the specification indicates that the amplification mixture comprises two primers, each at a concentration of 2.5X 10^-6And M. In specific embodiments, the instructions specify that the amplification mixture comprises two primers, each at a concentration of no less than 3.0X 10^-6M。

In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10^-13A target nucleic acid for M. In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10^-14A target nucleic acid for M. In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10 ^-15A target nucleic acid for M. In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10^-16A target nucleic acid for M. In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10^-17A target nucleic acid for M. In specific embodiments, the instructions specify that the amplification mixture should comprise at least 1.0X 10^-18A target nucleic acid for M. In particular embodiments, the instructions specify that the amplification mixture comprises no more than 10 copies of the target nucleic acid molecule.

In specific embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least 0.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises about 0.5% to 10% PEG by volume fraction. In specific embodiments, the instructions specify that the amplification mixture comprises a volume fraction of at least about 0.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 1% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 1.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 2% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 2.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 3% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 3.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 4% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 4.5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 5% PEG. In particular embodiments, the specification indicates that the amplification mixture comprises a volume fraction of at least about 10% PEG.

In specific embodiments, the specification indicates that the amplification mixture comprises about 1-50. mu.g/mL of SSB. In specific embodiments, the specification indicates that the amplification mixture comprises about 1 μ g/mL of SSB. In specific embodiments, the specification indicates that the amplification mixture comprises about 5 μ g/mL of SSB. In a specific embodiment, the specification indicates that the amplification mixture comprises about 12.5. mu.g/mL of SSB. In specific embodiments, the specification indicates that the amplification mixture comprises about 25 μ g/mL of SSB. In specific embodiments, the specification indicates that the amplification mixture comprises about 50. mu.g/mL of SSB.

In particular embodiments, the specification indicates that the volume of the amplification mixture is about 1-30 μ L. In particular embodiments, the instructions further specify that the amplification mixture can be loaded onto a microfluidic device to perform a PCR reaction.

In some embodiments, the kit further comprises instructions for subjecting the amplification mixture to PCR under a thermal cycling protocol. In particular embodiments, the thermal cycling protocol comprises a plurality of thermal cycles, wherein each thermal cycle comprises an incubation at a first temperature and an incubation at a second temperature. In a specific embodiment, the first temperature range is 68-78 deg.C and the second temperature range is 55-69 deg.C. In some embodiments, each thermal cycle further comprises a ramp time of less than 10 seconds. In a specific embodiment, the thermocycling protocol comprises an incubation at a first temperature in the range of about 72-76 ℃ for about 1s, an incubation at a second temperature in the range of about 61-65 ℃ for about 1s, and a warming time of less than 2s, for a total reaction time of less than 8 minutes.

5. Examples of the embodiments

The embodiments described below in relation to the present invention may in most cases be replaced with other techniques. The examples are intended to illustrate, but not to limit, the scope of the invention. For example, in preparing a PCR reaction system according to the protocol, conditions may vary, e.g., any solvent, reaction time, reagents, temperature, supplements, reaction conditions, or other reaction parameters may vary. For example, different methods can be used to detect the PCR amplification process of the target sequence, and without the need to monitor the PCR amplification in real time, the amplification mixture need not contain a fluorescent dye. Furthermore, although in the following examples the nucleic acid targets to be detected are of microbial origin, the application of the present methods and systems is not limited thereto but may be applied to the detection of other types of genetic samples, such as genetic material of mammalian origin. Furthermore, although the components of the kit are used in the following cases, these specific designs are not unique or optimal. Reagent type, volume, concentration, packaging may also vary. It is believed that the present disclosure is not limited to the particular methodology, protocols, and reagents described, as these may vary according to the context of use by those skilled in the art.

The general method comprises the following steps:unless otherwise indicated, the methods and apparatus in the following examples are conventional methods and apparatus used in the relevant art for similar studies. Unless otherwise noted, the test materials used in the examples below were purchased from biochemical stores or other commercial suppliers. All molecular biology and PCR reactions involving biomolecules such as DNA, RNA and proteins use standardized plates, vials and EP tubes. Commercial reagents were used as required.

In the following examples, genomic DNA or RNA samples were extracted using DNA/RNA extraction kits purchased from tiangen biochemical technology (beijing) ltd (beijing, china, catalog No. DP 422). The solvent of the isothermal reaction buffer is purified water, and the solutes and concentrations thereof are as follows: 20mM Tris-HCl，10 mM KCl，10mM(NH₄)₂SO₄，2mM MgSO₄0.1% Triton X-100; the pH at 25 ℃ was 8.8. The results of the quantitative study are based on at least three replicates.

5.2 example 1: primer concentration optimization for a rapid strand displacement amplification (SEA) reaction system.

The following study was conducted to test the effect of primer concentration on the amplification rate of rapid SEA reactions.

Based on the target nucleic acid sequence of the hypervariable region of the 16S rRNA coding gene of Listeria monocytogenes, a pair of specific primers was designed by NUPACK software (www.nupack.org /). The target sequence is a 50bp synthetic fragment with the following sequence:

5'- GGGTCATTGGAAACTGGAAGACTGGAGTGCAGAAGAGGAGAGTGGAATTC-3' (SEQ ID NO:1),

The primer sequences are respectively:

Primer 1:5'-GTCATTGGAAACTGGAAGACTG-3'(M58822.1 b)(SEQ ID NO:2)；

Primer 2:5'-CCACTCTCCTCTTCTGCAC-3'(M58822.1 b)(SEQ ID NO:3).

the primers and target fragments were chemically synthesized (Biotechnology engineering GmbH, Shanghai, China). DNA polymerase, dNTPs solution, other buffer solution, fluorescent dye (such as Evagreen) and strand displacement amplification (SEA) detection kit are purchased from the German biotechnology limited (Qingdao, China).

The synthesized primers and listeria monocytogenes genomic material were then mixed with other PCR reactions to form 10 μ Ι _ amplification mixture, as shown in table 1. To increase the amplification rate, four amplification systems with different concentrations of primers were prepared for primer concentration optimization, each mixture containing a final concentration of 0.24U/. mu.L of polymerase and a final concentration of 1.5X 10, respectively^-6M、2.0×10^-6M、 2.5×10^-6M and 3.0X 10^-6M is a primer. Negative control (NTC) refers to an amplification system in which the Listeria monocytogenes genomic material is replaced with an equal amount of water and the other components are identical.

TABLE 1 amplification mixture Components used to optimize primer concentrations

For the fast SEA reaction, CFX Connect was used^TMThe real-time PCR system (Bio-Rad, CA) enables rapid thermal cycling of the amplification mixture between 76 ℃ and 62 ℃. Each thermal cycle consists of the following steps: first, the amplification mixture was incubated at 76 ℃ for 1s, then immediately the amplification mixture was incubated down to 62 ℃ for 1s, and the temperature was raised back to 76 ℃. To monitor the amplification in real time and reduce the fluorescence read time, the fluorescence signal of the amplification mixture was scanned every 2 thermal cycles and the fluorescence was plotted as a function of time (FIG. 2).

As shown, for each primer concentration tested, the rapid SEA reaction achieved detection of the target sequence within 20 minutes. In particular, the primer concentration was increased to 3.0X 10^-6M, the amplification efficiency and rate can be remarkably improved, so that the time required for detecting the target nucleic acid in the sample is shortened to be within 15 minutes.

5.3 example 2: polymerase concentration optimization for rapid strand displacement amplification (SEA) reaction systems.

The following study was conducted to test the effect of polymerase concentration on the rate of rapid SEA reactions.

As described in example 1 above, identical primers (SEQ ID NOS: 1 and 2) were designed for the same target sequence in the above Listeria monocytogenes genome (SEQ ID NO: 1). Primers and listeria monocytogenes genomes were prepared as described above and mixed with other PCR reactions to form 10 μ L of amplification mix, as shown in table 2 below. In order to optimize the amplification rate with the polymerase concentration, four amplification mixtures were prepared containing different enzyme concentrations, each mixture containing a final concentration of 3.0X 10^-6M primers and polymerases at final concentrations of 0.16U/. mu.L, 0.20U/. mu.L, 0.24U/. mu.L and 0.28U/. mu.L (8U/. mu.L enzyme stock corresponding to 0.20. mu.L, 0.25. mu.L, 0.30. mu.L and 0.35. mu.L, respectively). An equal amount of water is also provided to replace listeria monocytogenes genomic material, and an amplification mixture with the same composition is used as a negative control group (NTC).

TABLE 2 ingredient Table of Rapid SEA amplification System for optimizing polymerase concentration

For the fast SEA reaction, CFX Connect was used^TMThe real-time PCR system (Bio-Rad, CA) allows rapid thermal cycling of the amplification mixture between 76 ℃ and 62 ℃. Each thermal cycle consists of the following steps: first, the amplification mixture was incubated at 76 ℃ for 1s, followed by a drop to 62 ℃ and incubation for 1s, and then increased back to 76 ℃. To monitor amplification in real time and shorten the time to scan fluorescence, the fluorescence signal of the amplification mixture was scanned every 2 thermal cycles and the fluorescence was plotted as a function of time (FIG. 3).

As shown, for reactions containing polymerase at concentrations of 0.24U/. mu.L or 0.28U/. mu.L, the rapid SEA reaction produced detectable amplification of the target sequence in less than 20 minutes. When the concentration of the polymerase is increased from 0.24U/muL to 0.28U/muL, the amplification efficiency and the amplification rate are further remarkably improved, and the time required for detecting the target nucleic acid in the sample is shortened from 15 minutes to 10 minutes.

5.4 example 3: thermal cycling optimization of a rapid strand displacement amplification (SEA) reaction system.

The following study was conducted to test the effect of denaturation temperature on the amplification efficiency and amplification rate of rapid SEA reactions.

An amplification system was prepared as described in example 1 above, with the primer concentration being maintained at 3.0X 10^-6M, polymerase concentration was maintained at 0.24U/. mu.L. The amplification system was then subjected to different thermal cycles to perform the PCR reaction and the effect of different temperatures on amplification efficiency and rate was evaluated.

In each thermal cycle, the amplification system was incubated at the higher denaturation temperature for 1s, followed immediately by a further incubation at the lower extension temperature for 1 s. The lower extension temperature may be selected based on the DNA polymerase selected. In these studies, the extension temperature was set to 62 ℃ at which Bst DNA polymerase activity was optimal. Without being bound by theory, it is expected that slight temperature differences may significantly affect the rate and duration of bubble opening in double stranded nucleic acid samples, which in turn may affect the efficiency and rate of amplification. In these studies, five denaturation temperatures of 74 ℃, 75 ℃, 76 ℃, 77 ℃ and 78 ℃ were tested and compared. The negative control group (NTC) had the same composition and content except that the Listeria monocytogenes genomic material was replaced with water.

For example, each thermal cycle between 76 ℃ and 62 ℃ is performed by incubating the amplification system at 76 ℃ for 1s, then immediately decreasing the temperature to 62 ℃ for 1s, and then immediately increasing the temperature back to 76 ℃. The thermal cycle is repeated for at least 35 cycles for each rapid SEA reaction. To monitor the amplification in real time, the fluorescence signal from the amplification system was scanned every 2 thermal cycles and plotted against time (FIG. 4).

As shown, the amplification signal of the target sequence was detectable in 20 minutes with a rapid SEA reaction when the denaturation temperature was between 74 ℃ and 76 ℃. The denaturation temperature of 76 ℃ is the optimum temperature among all temperatures tested, thereby minimizing the detection time required for the target nucleic acid in the sample.

5.5 example 4: amplification and detection of DNA molecules in a sample.

The following study was conducted to test the ability of the rapid SEA method to detect DNA molecules in biological samples.

Based on the target nucleic acid sequence, a pair of specific primers was designed by NUPACK software (www.nupack.org /). Wherein the target sequence is:

5'- GGGTCATTGGAAACTGGAAGACTGGAGTGCAGAAGAGGAGAGTGGAATTC-3' (SEQ ID NO:1),

the primer sequences are respectively:

Primer 1:5'-GTCATTGGAAACTGGAAGACTG-3'(M58822.1 b)(SEQ ID NO:2)；

Primer 2:5'-CCACTCTCCTCTTCTGCAC-3'(M58822.1 b)(SEQ ID NO:3).

the DNA molecules of the primers and target fragments are chemically synthesized (engineering biotechnology)Gmbh, shanghai, china) and mixed with other PCR reactants to form a 10 μ L amplification system, as shown in table 3 below. Specifically, two partial amplification mixtures, each comprising 1.0X 10, were prepared^-12M or 0.8 ng/. mu.L Listeria monocytogenes genomic material. The primer concentration was 3.0X 10^-6M, polymerase concentration of 0.24U/. mu.L, and equal amount of water instead of Listeria monocytogenes genomic material, and amplification mixture with the same composition as negative control (NTC) were also set.

TABLE 3 DNA amplification System Components Table

Name (R)	Final concentration
		Primer
1	3.0×10^-6M
		Primer 2	3.0×10^-6M
Synthesis of target DNA	1.0×10^-12M
		dNTPs	8mM
Isothermal reaction buffer	1×
		Evagreen	20×
ET SSB	5μg/mL
		Bst DNA polymerase	0.24U/μL
Polyethylene glycol
	200	100％
Pure water			Make up to 10 μ L

For the fast SEA reaction, CFX Connect was used^TMThe real-time PCR system (Bio-Rad, CA) allows rapid thermal cycling of the amplification system between 76 ℃ and 62 ℃. Each thermal cycle consists of the following steps: first, the system is amplifiedIncubation was carried out at 76 ℃ for 1s, followed by a reduction to 62 ℃ and incubation for 1s, and then a further increase back to 76 ℃. To monitor amplification in real time and shorten the time to scan fluorescence, the fluorescence signal of the amplification system was scanned every 2 thermal cycles and plotted as a time-varying fluorescence curve (FIG. 5).

As shown, the rapid SEA method is able to efficiently detect listeria monocytogenes-associated synthetic DNA fragments and genomic nucleic acids within 10 minutes at the provided target concentrations, indicating that immediate diagnosis of pathogen infection can be made using the present methods and kits.

5.6 example 5: amplification and detection of RNA molecules in a sample.

The following study was conducted to test the ability of the rapid SEA method to detect RNA molecules in biological samples.

Specifically, the same primers were designed as described above for the target RNA sequence having the following sequences (SEQ ID NOS: 2 and 3)

5’- GGGTCAUUGGAAACUGGAAGACUGGAGUGCAGAAGAGGAGAGUGGAAUUC-3’ (SEQ ID NO:7)

Primers were prepared and RNA target molecules were synthesized as described above and mixed with other PCR reactions to form a 10. mu.L amplification system, and three amplification mixtures were prepared, each containing a concentration of 3.0X 10, as shown in Table 4 below^-6M primer, polymerase at a concentration of 0.24U/. mu.L and 1.0X 10^-12M, in a single molecule. An equal amount of water is also provided to replace listeria monocytogenes genomic material, and an amplification mixture with the same composition is used as a negative control group (NTC).

TABLE 4 ingredient Table of RNA amplification System

Name (R)	Final concentration
		Primer
1	3.0×10^-6M
		Primer 2	3.0×10^-6M
Synthetic target RNA	1.0×10^-12M
		dNTPs	8mM
Isothermal reaction buffer	1×
		Evagreen	20×
ET SSB	5μg/mL
		Bst DNA polymerase	0.24U/μL
Polyethylene glycol
	200	100％
Pure water			Make up to 10 μ L

For the rapid SEA reaction, the amplification system was subjected to rapid thermal cycling between 76 ℃ and 62 ℃ using the CFX Connect TM real-time PCR system (Bio-Rad, CA). Each thermal cycle consists of the following steps: first, the amplification system was incubated at 76 ℃ for 1s, and immediately the amplification system was incubated at 62 ℃ for another 1s, then the temperature was raised back to 76 ℃. To monitor the amplification in real time, the fluorescence signal of the amplification system was scanned every 2 thermal cycles and plotted against time (FIG. 6A).

As shown, the rapid SEA method is able to effectively detect the concentration of target RNA molecules within about 10 minutes using Bst DNA polymerase having reverse transcriptase activity. In the three replicate control reactions, the amplification products reached exponential phase at about the same time and no amplification was detected in the negative control group, indicating that the method and reaction system are highly reproducible and stable.

Finally, to verify that the increase in fluorescence signal observed corresponds to a specific amplification of the target RNA molecule, the amplification products were checked electrophoretically on a 12.5% polyacrylamide gel after the reaction was completed. The results of electrophoresis are shown in FIG. 6B, which shows that the rapid SEA reaction produced the expected amplified fragment (43 bp in length) and that no target band was observed as a result of the negative reaction (NTC). Lane M is a gradient molecular weight DNA marker (DNA ladder) with corresponding bands of 20bp and 40bp DNA fragments.

5.7 example 6: comparison of isothermal SEA reaction at constant temperature with Rapid SEA reaction under Rapid thermal cycling

The following study was conducted to compare isothermal SEA reactions conducted under isothermal conditions (procedure as described in CN 109136337 a) with rapid SEA reactions under current rapid thermal cycling conditions.

Specifically, identical primers (SEQ ID NOS: 1 and 2) were designed for the same Listeria monocytogenes genomic (SEQ ID NO: 1) target sequence according to the methods described above. Primers and listeria monocytogenes genomic material were obtained according to the above-mentioned method and mixed with other PCR reactions to form 10 μ L of amplification mixture, the composition of which is shown in table 5 below. In addition, the study set up a series of samples containing different initial concentrations (1.0X 10) ^-11M，1.0×10^-12M，1.0×10^-13M，1.0×10^-14M，1.0×10^-15M，1.0×10^-16M，1.0×10^-17M or 1.0X 10^-18M) to compare the rate and sensitivity of the two methods in amplifying and detecting trace amounts of target nucleic acids present in a sample. The reaction was also set up with equal amounts of water in place of listeria monocytogenes genomic material and an amplification mixture of otherwise identical composition as a negative control (NTC).

TABLE 5 amplification reaction mixture composition for sensitive detection

As hereinbefore describedExample 1As described in (1), the amplification reaction system was subjected to rapid thermal cycling between 76 ℃ and 62 ℃ using a CFX Connect TM real-time PCR system (Bio-Rad, CA) to perform a rapid SEA reaction. The method comprises the following specific steps, wherein each thermal cycle comprises the following steps: subjecting the amplification mixture to a temperature of 76 ℃Incubate for 1s, then immediately reduce the temperature to 62 ℃, and after incubation for 1s at 62 ℃ immediately raise the temperature to 76 ℃. To enable real-time monitoring of the amplification process, the fluorescence signal of the amplification reaction mixture was scanned every 2 thermal cycles and plotted against time (FIG. 7A). (1.0X 10)^-11M，1.0×10^- ¹²M，1.0×10^-13M and 1.0X 10^-14Data for the M samples are not listed).

In addition, in order to verify that the increase in the observed fluorescent signal corresponds to specific amplification, after the reaction was completed, the amplification mixture was applied to 12.5% polyacrylamide gel for electrophoresis to examine the amplification product. FIG. 7B is a photograph of a PAGE gel showing the concentration of the components at 1.0X 10 ^-15M， 1.0×10^-16M，1.0×10^-17M and 1.0X 10^-18Accelerated SEA reaction mixture of M original target produced the expected amplified fragment (43 bp in length) and no target band was present as a result of negative reaction (NTC). Lane M is a gradient molecular weight DNA marker (DNA ladder) with corresponding bands of 20bp and 40bp DNA fragments.

The amplification mixture was incubated at 62 ℃ using a CFX Connect TM real-time PCR system (Bio-Rad, CA) for isothermal SEA reactions at constant temperature. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplified product was scanned every minute and plotted against time (FIG. 7C, 1.0X 10)^-16M，1.0×10^-17M and 1.0X 10^-18Data for the M samples are not listed).

As shown in FIGS. 7A and 7C, the fluorescence signals of both methods showed a good linear relationship with the initial target concentration in the amplification reaction system. I.e., the greater the amount of target present in the initial sample, the less time it takes for the method to produce an amplification product of the detectable target molecule. Notably, the performance of the rapid SEA method (under rapid thermal cycling conditions) is significantly better than the isothermal SEA method (under constant temperature conditions) in terms of detection rate and sensitivity.

Specifically, as shown in FIG. 7C, the target concentration was 1.0X 10^-15M hours, isothermal SEA process approximatelyIt takes 1 hour to produce detectable amplification product, whereas as shown in fig. 7A, the rapid SEA method produces detectable amplification product of the test target at all concentrations within 15 minutes. Thus, the rapid SEA method reduces the detection time by about 75% compared to the isothermal SEA method, thereby shortening the detection time to 15 minutes.

Furthermore, as shown in FIG. 7C, the isothermal SEA method is capable of detecting 1.0X 10 in a sample within a reaction time of 20 minutes^-12M or higher, whereas the rapid SEA method is capable of detecting target molecules at concentrations as low as 1.0X 10, as shown in FIG. 7A^-18M (only a few copies of the target nucleic acid in the sample at this concentration). Thus, the rapid SEA method increases the detection sensitivity by at least 10 for a reaction time of 15 to 20 minutes⁶And (4) doubling.

5.8 example 7: primer design

Primer design and evaluation were performed using the NUPACK Web tool (www.nupack.org), DNAMelt Web (http:// unaffold. rna. albany. edu/.

The DNA primers were synthesized by Personal Biotechnology Ltd (Shanghai, China). SEA detection kits were purchased from Navid biotechnology limited (china, Qingdao). The DNA extraction kit was purchased from Tiangen Biotechnology Ltd (Beijing, China). Other reagents and buffers were of analytical grade.

Conventional PCR reaction: genomic DNA of Mycoplasma pneumoniae, Chlamydia trachomatis, pork, Bacillus cereus and Staphylococcus aureus was extracted using a TIANAmp DNA extraction kit (Beijing Tiangen Biotechnology Co., Ltd., Beijing) according to the instructions provided by the manufacturer. Using CFX Connect^TMA real-time PCR system (Bio-Rad, Calif.) performs real-time quantitative PCR. The reaction system is as follows: the total volume was 50. mu.L, containing 20ng of genomic DNA template, 1. mu.L of forward and reverse primers (10. mu.M), 1.5. mu.L of dNTPs (2.5mM), 0.25. mu.L of Taq polymerase and 5. mu.L of standard Taq reaction buffer. The reaction step included denaturation at 94 ℃ for 5 min, 35 thermal cycles (incubation at 94 ℃ for 30s, 60 ℃ C.)Incubation for 30s, 72 ℃ for 90s) and finally extension at 72 ℃ for 10 min.

SEA reaction: the SEA reaction was carried out in a 10. mu.L system containing 1. mu.L of template, 1.5. mu.L (10. mu.M) of each of the two primers, 5. mu.L of 2 × reaction buffer and 0.25 × Evav Green. To exclude the effect of the purity of the extracted genomic DNA, experiments were performed using the PCR product of the target sequence (1pM) as template, unless otherwise stated. The reaction mixture was incubated at constant temperature of 57 deg.C, 59 deg.C, 61 deg.C, 63 deg.C and 65 deg.C for 60 minutes, and the fluorescence signal of the amplified product was detected once per minute by CFX ConnectTM real-time PCR system (Bio-Rad, Calif., USA). In addition, a reaction mixture (NTC) containing no target was used as a negative control.

5.7.1 optimization of reaction temperature and Tm value of primer

The following example provides an exemplary method for selecting the optimal reaction temperature and primers suitable for the reaction conditions for a given polymerase.

The method comprises the following specific steps: a variety of gene-specific primers (Mp1-Mp5) encoding Mycoplasma pneumoniae 16S rRNA having different Tm values (65 ℃, 63 ℃, 61 ℃, 59 ℃ or 57 ℃) were designed and synthesized (Table 6). Bst 2.0 WarmStart DNA polymerase was used to carry out a series of SEA reactions at constant temperature of 57 deg.C, 59 deg.C, 61 deg.C, 63 deg.C or 65 deg.C. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification mixture is scanned every second and plotted against time (FIG. 10).

TABLE 6 Mycoplasma pneumoniae (M. pneumoconiae)^*)16S rRNA coding gene specific primer

^*GenBank accession number: CP017343.1

As shown in FIG. 10, the shortest time (threshold time Tt) for the reaction in which the primer pair Mp1-Mp5 participated in to produce a detectable amplification product was 22 minutes, 15 minutes, 11 minutes, 23 minutes and 20 minutes, respectively. In addition, the reaction temperatures at which the primer pair Mp1-Mp5 reached the minimum Tt value among the five reaction temperatures tested were 61 ℃, 61 ℃, 61 ℃, 61 ℃ and 57 ℃, respectively, and the observed results are summarized in Table 6 above.

These results indicate that when SEA or rapid SEA reactions are carried out using Bst DNA polymerase, primers with a reaction temperature of about 61 ℃ and a Tm value of about 61 ℃ can be preferentially selected and used.

Subsequently, in order to prove that the optimal conditions (including reaction temperature and primer characteristics) determined by the above method are suitable for a practical application scenario, the above optimal conditions are applied to an SEA reaction (as opposed to a synthetic and/or purified DNA fragment in a research laboratory) targeting mycoplasma pneumoniae genomic DNA. The specific procedure was as follows, using 40ng of Mycoplasma pneumoniae genomic DNA as template for the SEA reaction with primer pair Mp3 at the same reaction temperature (i.e.65 ℃, 63 ℃, 61 ℃, 59 ℃ or 57 ℃). Similar results were observed: the reaction involving the primer pair Mp3 at 61 ℃ showed the shortest Tt value. Although the shortest Tt value in this reaction (about 20 minutes) was longer than that of the reaction using the amplified target DNA fragment as a target described above, this difference was attributable to the lower probability of the occurrence of a denatured bubble at the target position in the longer genomic nucleic acid than the shorter target DNA fragment (FIG. 10F). These results further demonstrate that the steps and methods of this example can be used to determine optimal reaction temperatures and primer Tm values for SEA methods and current accelerated SEA methods.

In the above studies for optimizing the Tm values of the primers and the reaction temperature, it was observed that the Tt value also relates to the difference between the Tm values of the two primers in the primer pair. The following examples provide further exemplary methods for selecting primers characterized by favorable Tm values.

Specifically, a primer pair specific to Chlamydia trachomatis (Ct1-Ct3) or domestic pig (Sd1-Sd3) having a different difference in Tm value was designed and subjected to SEA reaction at 61 ℃ (Table 7). The average Tm values of the primer pairs were close to 61 ℃ to exclude possible influence of the factors. As shown in FIG. 11, the primer pair having the smallest difference in Tm value has the shortest Tt value, and the primer pair having the largest difference in Tm value has the highest Tt value, regardless of whether it is a primer specific to Chlamydia trachomatis or a primer specific to a pig. Primer pairs with similar Tm values usually have similar annealing temperatures, and thus the amplification reaction rates of the primers are similar, in which case the efficiency of the SEA reaction is higher (Thornton et al, "Real-time PCR (qPCR) primer design using free uplink software," biochem. mol. biol. Edu., (2011)39: 145-. These results indicate that primer pairs with similar Tm values can be preferentially selected for the SEA reaction and the accelerated SEA reaction.

TABLE 7 Chlamydia trachomatis (C^*)16S rRNA coding gene and domestic pig (S.domestica)^**)18S rRNA coding gene specific SEA primer

^*GenBank accession number: NR _025888.1

^**GenBank accession number: JN601073.1

5.7.23' end G/C content optimization

The following examples provide exemplary methods for optimizing the G/C content of primers in conjunction with the present methods.

Specifically, the SEA reaction was performed using a primer pair specific to a target sequence of a gene encoding mycoplasma pneumoniae 16S rRNA (Mp3, Mp6, and Mp7) or a gene encoding chlamydia trachomatis 16S rRNA (Ct1, Ct4, and Ct 5). The polymerase selected in this example was Bst DNA polymerase. Specifically, the Mycoplasma pneumoniae-specific primers were designed such that the total number of G and C in the 5nt region at the 3' end was 1 to 4. The Chlamydia trachomatis-specific primers were designed so that the total number of G and C in the 5nt region at the 3' end was 2 or 3. In addition, the Tm mean value of all the primer pairs was around 61 ℃ and the reaction was carried out at a constant temperature of 61 ℃. To monitor the amplification in real time, the fluorescence signal of the amplification mixture was scanned every second and plotted against time (FIG. 12). The number of G/C in the 3 '-end of the primer, the number of G/C in the 5nt region of the 3' -end of each primer pair, and Tt value of the reaction are shown in Table 8.

Table 8 mycoplasma pneumoniae (m^*) And chlamydia trachomatis (c^**)16S rRNA coding gene specific SEA primer

^*GenBank accession number: CP017343.1

^**GenBank accession number: NR _025888.1

As shown in FIG. 11A and Table 8 above, the results relating to the Mycoplasma pneumoniae-specific primers show that the primer having a higher G/C content near the 3 'end exhibits a lower Tt value, indicating that the primer having a higher G/C content at the 3' end can be preferentially selected. This observation is contrary to the design rules of conventional PCR primers, which are generally designed to avoid primers with high G/C content at the 3' end (Simonsson et al, "DNA quadruplex format in the control region of C-myc," Nucleic Acids Res., (1998)26: 1167-.

In addition, it was observed that although the G/C content was similar in the 3 '-terminal regions of the three Chlamydia trachomatis-specific primer pairs, the primer pair (Ct1) in which the 3' -terminal nucleotides were all G or C had the lowest Tt value. The same phenomenon was observed in the results for the mycoplasma pneumoniae specific primers. These results indicate that the G/C base pairing between the tail end of the primer and its target site is relatively more stable for more favorable hybridization, since this will avoid easy replacement of the primer by the original complementary strand. In addition, a stable structure formed by the terminal base pairs will help initiate primer extension by polymerase and prevent non-specific amplification (Rodri i guez-L zaro et al, "Real-time PCR in food science: introduction," curr.

Thus, this study demonstrates that the primers used in the present invention should have at least 2G's and/or C's in the terminal 5-nt region to be extended by the polymerase. In addition, primers with G or C at the end of the primer are more conducive to polymerase-initiated extension.

5.7.3 primer sequence optimization based on complementarity

The following examples provide exemplary procedures for optimizing primer sequences to avoid or reduce the formation of self-complementary secondary structures within a primer molecule.

The SEA method was used to assess the effect of self-complementarity in the primer sequences or 3' complementarity between each primer in a primer pair. Specifically, the number of potential self-complementary or 3' complementary sites was analyzed for different primer pairs specific for Chlamydia trachomatis (Ct1, Ct6 and Ct2) or Bacillus cereus (Bc1-Bc 3). The BLAST algorithm on the NCBI website (www.ncbi.nlm.nih.gov/tools/primer-BLAST) was used. The number of predicted complementary sites for each primer is summarized in Table 9. The primers were then subjected to the SEA reaction under the conditions described above. To monitor the amplification in real time, the fluorescence signal of the amplification mixture was scanned every second and plotted against time (FIG. 13).

TABLE 9 Chlamydia trachomatis (C^*) And bacillus cereus (b ^**)16S rRNA coding gene specific SEA primer

^*GenBank accession number: NR _025888.1

^**GenBank accession number: NR _152692.1

As shown in fig. 13, the number of complementary sites in a primer pair is positively correlated with the Tt value of the corresponding reaction, with the lowest Tt value for the primer pair with the least number of potential complementary sites. In addition, the Tm value of the primer pair having the lowest Tt value (Bc1) among the Bacillus cereus-specific primers was observed to be the highest (65 ℃ C.). In addition, the 3' terminal nucleotide of the Bc 1P 2 primer is neither G nor C. This finding indicates that the negative impact of primer intra-and inter-sequence complementarity on the overall efficiency and rate of the SEA method or rapid SEA method exceeds the positive impact of the appropriate primer G/C content or Tm.

Thus, this study shows that avoiding or reducing potential self-complementarity and/or 3' complementarity in the primer sequences is beneficial for the efficiency of the present method.

5.7.4 priority of primer design considerations (Tm value and 3' end C/G content)

In the actual process of primer design, the selection of primers may be contradictory when different primer optimization considerations are taken into account. For example, as shown in FIG. 13 and Table 9, the negative impact of intra-and inter-primer sequence complementarity outweighs the positive impact of appropriate primer G/C content or Tm on overall efficiency and amplification rate. The following study further provides exemplary procedures and procedures for determining the priority between primer Tm and 3' end G/C content.

Specifically, an SEA reaction was carried out using 4ng of genomic DNA as a template and two primer pairs specific to Staphylococcus aureus (Sa1 and Sa 2). For the Sa1 primer pair, the Tm value and Tm value difference between the two primers were about 65 ℃ and 2.2 ℃ respectively. For the Sa2 primer pair, the Tm value and Tm value difference between the two primers are about 61 ℃ and 1.1 ℃, respectively, and the 3' terminal nucleotide of both primers is A or T. The sequences and characteristics of the primers are summarized in table 10 below. The primers were used to perform the SEA reaction under the conditions described above. To monitor the amplification in real time, the fluorescence signal of the amplification mixture was scanned every second and plotted against time (FIG. 14).

TABLE 10 Staphylococcus aureus (S.aureus)^*)16S rRNA coding gene specific primer

^*GenBank accession number: D83356.1.

as shown in fig. 14 and table 10, the amplification efficiency of the primer pair Sa1 (Tt was 37 minutes) was significantly lower than that of the primer pair Sa2(Tt was 32 minutes). Based on these measurements, it can be concluded that there is a higher priority to consider selecting favorable Tm values and Tm value differences than selecting favorable 3 'terminal residues or 3' terminal G/C content. These observations can be explained by the fact that the formation of a stable primer-target double-stranded structure is promoted more efficiently between the primer and the reaction temperature at an appropriate Tm value than the stability provided by G-C base pairing.

In summary, these studies show that based on different considerations, the primer design has a priority (from high priority to low priority): (1) avoiding/reducing self-complementarity and/or 3 'complementarity in the primer sequences, (2) selecting appropriate Tm values and/or Tm value differences, and (3) selecting appropriate C/G content and/or G/C for the 5nt region at the 3' end as terminal residues. In other words, when the selection of a primer sequence considered based on a lower priority contradicts the selection of a primer sequence considered based on a higher priority, the selection considered based on a higher priority may be employed.

5.9 example 8: reagent kit

The following provides examples of detection of target nucleic acids by the rapid SEA method of the present invention using a kit prepared in advance.

A kit comprising buffer a and buffer B having the following composition was prepared.

And (3) buffer solution A:

isothermal reaction buffer (10 ×): 1.75 mu L;

dNTPs(10mM)：2μL；

primer 1: 7.5. mu.L (final concentration: 3.0X 10)^-6M)；

Primer 2: 7.5. mu.L (final concentration: 3.0X 10)^-6M)；

Polyethylene glycol (PEG)200 (100%): 0.625 mu L;

Evagreen(20×)：0.625μL；

and (3) buffer solution B:

isothermal reaction buffer (10 ×): 0.75 μ L;

ET Single chain binding protein (SSB) (500. mu.g/mL): 0.25 μ L;

DNA polymerase (8U/. mu.L): 0.75. mu.L.

In this example, primer pairs were designed to detect S.aureus in a sample. Specifically, primers were designed to amplify a fragment of the s.aureus 16s rRNA encoding gene, the sequence of which is as follows: 5'-GGTTCAAAAGTGAAAGACGGTCTTGCTGTCACTTATAGATGGATCCGCGC-3' (SEQ ID NO: 4).

The primer sequence is as follows:

primer 1: 5'-GGTTCAAAAGTGAAAGACGGTCTTG-3' (SEQ ID NO: 5);

primer 2: 5'-GCGCGGATCCATCTATAAGTGAC-3' (SEQ ID NO:6).

The staphylococcus aureus genome was extracted using a DNA/RNA isolation kit purchased from tiangen biochemical technology (beijing, china, catalog No. DP422) according to the manufacturer's instructions. Three replicate samples were prepared in parallel according to the following procedure: buffer A and buffer B were mixed, and 2.5. mu.L of the extracted Staphylococcus aureus genome material was added to the mixture, and water was added to a total volume of 25. mu.L. Amplification mixtures were formulated as negative controls (NTC) using the same content of water instead of staphylococcus aureus genomic material.

Using CFX Connect^TMReal-time PCR System (Bio-Rad, CA) for rapid SEA reaction by subjecting the amplification reaction system to rapid thermal cycling at 76 ℃ to 61 ℃. Specifically, each thermal cycle consists of the following steps: the amplification reaction system was incubated at 76 ℃ for 1s, then immediately lowered to 62 ℃ and immediately raised to the previous 76 ℃ after incubation at 62 ℃ for 1 s. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification product is scanned every two thermal cycles and plotted against time (FIG. 8). As shown, the amplification results were consistent for the three replicates, while the negative control produced no detectable fluorescence signal. These results show that reproducible and stable results can be obtained using this kit, and that reagents stored in the form of buffer a and buffer B, respectively, are stable in nature and can induce reactions upon mixing.

5.10 microfluidic devices

Examples of the detection of target nucleic acids using the rapid SEA methods of the present invention in a microfluidic chip are provided below.

A 10 μ L reaction mixture was prepared comprising the following contents:

purified water: 0.35 μ L

Isothermal reaction buffer (10 ×): 1 μ L

Primer 1: 3 μ L (final concentration: 3.0X 10)^-6M)；

Primer 2: 3 μ L (final concentration: 3.0X 10)^-6M)；

PEG 200(100％)：0.25μL；

Evagreen(20×)：0.25μL；

dUTP(10mM)：0.8μL；

Uracil DNA glycosylase (1U/. mu.L): 0.1 mu L;

DNA polymerase (8U/. mu.L): 0.25 μ L;

target nucleic acid: 1 μ L.

In this example, the primer pair is designed to detect staphylococcus aureus in a sample. Specifically, primers were designed to amplify a fragment of the staphylococcus aureus 16S rRNA-encoding gene, the sequence of which is as follows:

5'- GGTTCAAAAGTGAAAGACGGTCTTGCTGTCACTTATAGATGGATCCG CGC-3'(SEQ ID NO：4)

the primer sequence is as follows:

primer 1: 5'-GGTTCAAAAGTGAAAGACGGTCTTG-3' (SEQ ID NO: 5); and

primer 2: 5'-GCGCGGATCCATCTATAAGTGAC-3' (SEQ ID NO: 6).

The staphylococcus aureus genome was extracted into stock solutions using a DNA/RNA isolation kit purchased from tiangen biochemical technology (beijing) ltd (beijing, china, catalog No. DP422) according to the manufacturer's instructions. All reagents were mixed and 1.0. mu.L of different concentrations of Staphylococcus aureus target was added to the mixture to give a total volume of 10. mu.L, with the target concentrations being 1.0X 10 ^-9M，1.0×10^-10M，1.0×10^-11M，1.0×10^-12M，1.0×10^-13M，1.0×10^-14M and 1.0X 10^-15And M. The reaction was also set up with an equal amount of water instead of staphylococcus aureus genomic material and an amplification mixture of otherwise identical composition as a negative control (NTC).

The reaction mixture was mixed well and then all the mixture was pipetted from the microfluidic Rapi: a sample inlet of chipTM (korea, Genesystem) injects into each reaction chamber, and each reaction chamber has a sample inlet and an exhaust outlet. After all the sample mixture and NTC mixture were injected into the reaction chamber, a sealing film was attached to the microfluidic chip to seal the sample inlet and the gas outlet. Then, the microfluidic chip is placed in UF-150 GENECHECKER^TMOn the ultra-fast real-time PCR system (Korea, GeneSystem), an amplification reaction was prepared.

After 5 minutes of incubation at 37 ℃, the microfluidic chip undergoes rapid thermal cycling between 76 ℃ and 60 ℃. Each thermal cycle consists of the following steps: the amplification mixture was incubated at 76 ℃ for 1 second, then immediately the temperature was reduced to 60 ℃ and incubated at 60 ℃ for a further 1 second, then immediately the temperature was raised back to 76 ℃. The rate of rise and fall of the temperature was 8 ℃/s and each cycle was completed in 12 s. To monitor the amplification in real time, the fluorescence signal of the amplification product was scanned once per thermal cycle and plotted against time (FIG. 15). As shown, the time of occurrence of the fluorescence signal is positively correlated with the concentration. While the negative control produced no detectable fluorescence signal.

The studies in this example show that the rapid SEA method of the invention can amplify and detect target molecules (at concentrations as low as 1.0X 10) present in a sample within 8 minutes (less than 40 cycles)^-14M or about 6.0X 10 in a 10. mu.L reaction system⁴One copy).

5.11 example 10: pollution reduction by uracil-DNA glycosylase (UDG)

The following studies demonstrate that the addition of uracil-DNA glycosylase to the amplification mixture can reduce residual contamination during amplification.

First, the following study was conducted to demonstrate that rapid SEA can synthesize new amplification products using dUTPs. In the first reaction (dTTPs; filled circles) the amplification mix comprises dNTPs (dATPs, dGTPs, dTTPs, dCTPs) and in the second reaction (dUTPs; filled triangles) the amplification mix comprises dNTPs (dATPs, dGTPs, dUTPs, dCTPs). Control reactions without target molecule (NTC; filled squares) were also included. The reaction mixture was subjected to a rapid SEA reaction and the fluorescence was plotted as a function of time (FIG. 16). As shown, replacing dTTPs with dUTPs did not significantly affect reaction efficiency, indicating that dUTPs can be used for rapid SEA reactions.

In addition, the following study was conducted to demonstrate the digestion of uracil containing nucleic acids by UDG. The uracil-containing amplification products from the second reaction described above (dUTPs were used instead of dTTPs) were subjected to UDG digestion. Specifically, the amplification product was digested by adding UDG (0.01U/. mu.L) to 10. mu.L of the amplification mixture, and incubated at 37 ℃ for 2 minutes. The digestion products were then loaded onto SDS gels for electrophoresis (lane 2). mu.L of amplification mixture without UDG treatment was loaded onto the other lane of the SDS gel (lane 1) for comparison. As shown in FIG. 17, the fluorescence of the amplification product after UDG treatment was significantly weaker than that of the untreated amplification product, indicating that UDG degraded uracil-containing amplification products by cleaving the U base incorporated into the product.

Finally, the following studies were carried out to demonstrate that the addition of UDG to the amplification mixture when carrying out rapid SEA can effectively prevent contamination by residual amplification products (e.g. aerosols) present in the surrounding environment.

In this study, dATPs, dGTPs, dUTPs and dCTPs were used for the first round of rapid SEA reactions. The amplification product is then used as a target for another round of rapid SEA reaction. Specifically, the rapid SEA reaction was performed as described above, and the fluorescence signal of the second round of reaction was plotted as a function of time (FIG. 18). As can be seen from the figure, the threshold time (Tt) of the amplification reaction with 0.01U/. mu.L of UDG was delayed by 3.78 minutes compared to the amplification reaction without UDG (filled squares), indicating that UDG can effectively prevent nucleic acid molecule contamination by current rapid SEA methods.

5.12 example 11: the use of heat stable Taq DNA polymerase to rapidly amplify and detect DNA molecules in a sample.

The following study was conducted to examine the ability of the rapid SEA method to detect DNA molecules in biological samples.

Based on the target nucleic acid sequence, a pair of specific primers was designed by NUPACK software (www.nupack.org /). In particular, the target sequence is

5'- AGATGTTGAAGGATTCAACCAAATCTCCAGAGTTTGTTAAAACCGTT CCAA-3'(SEQ ID NO:58),

The primer sequence is as follows:

Primer 1:5'-ATGTTGAAGGATTCAACCAAATC-3' (SEQ ID NO: 59);

primer 2:5'-GGAACGGTTTTAACAAACTCTG-3' (SEQ ID NO:60).

The primers and target DNA molecules were synthesized commercially (Sangon Biotech, shanghai, china) and mixed with other PCR reactions to form 10 μ Ι _ of amplification mixture, as shown in table 11 below. In particular, amplification mixtures are prepared, each mixture comprising 1.0X 10 of the total^-12M，1.0×10^-13M， 1.0×10-¹⁴M，1.0×10^-15M or 1.0X 10^-16M Vibrio parahaemolyticus genomic material. The primer concentration was 5.0X 10^-7M, polymerase concentration 0.05U/. mu.L, and including an equivalent amount of waterThe amplification mixture of the replacement target DNA served as a negative control group (NTC).

TABLE 11 amplification mixture content for DNA amplification

For rapid SEA reactions, the amplification mixture was subjected to rapid thermal cycling between 76 ℃ and 61 ℃ using the CFX Connect TM real-time PCR system (Bio-Rad, CA). In particular, each thermal cycle consists of: the amplification reaction system was incubated at 76 ℃ for 1s, then immediately lowered to 61 ℃ and immediately raised to the previous 76 ℃ after incubation at 61 ℃ for 1 s. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification product is scanned every two thermal cycles and plotted against time (FIG. 19).

As shown in the figure, the rapid SEA method can efficiently detect genomic nucleic acid of Vibrio parahaemolyticus at a target concentration provided, which enables immediate diagnosis of pathogen infection using the methods and kits of the present invention.

5.13 example 12: the DNA molecules in the sample are amplified and detected using a nucleic acid probe.

The following study was conducted to examine the ability of the rapid SEA method using nucleic acid probes to detect DNA molecules in biological samples.

In particular, a pair of specific primers and probes were designed based on the following target sequences in the human β -actin gene:

5’-CAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTC TTGACAAAACCTAACTTGCG-3’(SEQ ID NO:61)

the primer and probe sequences were:

primer 1:5'-CCTGTGTTATCTTGGAGGTC-3' (SEQ ID NO: 62);

primer 2:5'-FAM-CCCTGAAGGGCTCTCTGG-BHQ-3' (SEQ ID NO:63).

And (3) probe: 5'-ACCAAAAGAGCTAGAACCAC-3' (SEQ ID NO:64).

Primers, probes and target DNA molecules were synthesized commercially (Sangon Biotech, Shanghai, China) and reacted with other PCRThe reactions were mixed to form 10. mu.L of amplification mixture, as shown in Table 12 below. In particular, an amplification mixture is prepared comprising genomic material isolated from human oral epithelial cells as target DNA. The primer concentration was 5.0X 10^-7M, probe concentration 6.0X 10 ^-7M, polymerase concentration 0.05U/. mu.L, and an amplification mixture comprising an equivalent amount of water to displace target DNA was included as a negative control group (NTC).

TABLE 12 amplification mixture content for DNA amplification

Composition (I)	Final concentration
		Primer
1	5.0×10^-7M
		Primer 2	5.0×10^-7M
Probe needle	6.0×10^-7M
		dNTPs	8mM
Target RNA	1.0×10^-14M Synthesis of DNA fragment
		Taq reaction buffer	1×
Taq DNA polymerase	0.05U/μL
		100% polyethylene glycol 200	0.625μL
Pure water	Make up to 10 μ L

For rapid SEA reactions, the amplification mixture was subjected to rapid thermal cycling between 76 ℃ and 61 ℃ using the CFX Connect TM real-time PCR system (Bio-Rad, CA). In particular, each thermal cycle consists of: the amplification reaction system was incubated at 76 ℃ for 1s, then immediately lowered to 61 ℃ and immediately raised to the previous 76 ℃ after incubation at 61 ℃ for 1 s. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification product was scanned every two thermal cycles and plotted against time (FIG. 20).

As shown, the rapid SEA method is able to efficiently detect the human β -actin gene from oral epithelial cells within about 10 minutes at the provided target concentration. In three repeated reactions, amplification reached exponential phase at approximately the same time, while no amplification product was detected in the negative control group, indicating a high reproducibility and stability of the method and reaction system.

5.14 example 13: amplification and detection of DNA molecules in a sample

5'- AGATGTTGAAGGATTCAACCAAATCTCCAGAGTTTGTTAAAACCGTT CCAA-3'(SEQ ID NO:58),

The primer sequence is as follows:

primer 1:5'-ATGTTGAAGGATTCAACCA-3' (M58822.1 b) (SEQ ID NO: 65);

primer 2:5'-GGAACGGTTTTAACAAACT-3' (M58822.1 b) (SEQ ID NO:66).

Primers and target DNA molecules were synthesized commercially (Sangon Biotech, shanghai, china) and mixed with other PCR reactions to form 10 μ Ι _ of amplification mixture, as shown in table 13 below. In particular, an amplification mixture comprising 1.0 x 10 of Listeria monocytogenes is prepared^-12M synthesizes a target DNA fragment. The primer concentration was 3.0X 10^-6M, polymerase concentration 0.24U/. mu.L, and an amplification mixture comprising an equivalent amount of water to displace target DNA was included as a negative control group (NTC).

TABLE 13 amplification mixture content for DNA amplification

Composition (I)	Final concentration
		Primer
1	3.0×10^-6M
		Primer 2	3.0×10^-6M
Target DNA	1.0×10^-12M Synthesis of DNA fragment
		dNTPs	8mM
Isothermal reaction buffer	1×
		20×Evagreen	0.625μL
ET SSB	5μg/mL
		Bst DNA polymerase	0.24U/μL
100% polyethylene glycol 200	0.625μL
		Pure water	Make up to 10 μ L

For rapid SEA reactions, the amplification mixture was subjected to rapid thermal cycling between 76 ℃ and 55 ℃ using the CFX Connect TM real-time PCR system (Bio-Rad, CA). In particular, each thermal cycle consists of: the amplification reaction system was incubated at 76 ℃ for 1s, then immediately reduced to 55 ℃ and immediately increased to the previous 76 ℃ after incubation at 55 ℃ for 3 s. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification product is scanned every two thermal cycles and plotted against time (FIG. 21).

As shown, the rapid SEA method is capable of efficiently detecting synthetic DNA fragments of listeria monocytogenes in less than 10 minutes at a provided target concentration, which enables on-site point-of-care detection of pathogen infection using the methods and kits of the present invention.

5.15 example 14: amplification and detection of small RNA molecules in a sample

The following study was conducted to examine the ability of the rapid SEA method to detect small RNA molecules in biological samples. A pair of specific primers was designed based on the target nucleic acid sequence by NUPACK software (www.nupack.org /). In particular, the target sequence is

5'-GCUUAUCAGACUGAUGUUGA-3'(SEQ ID NO:67),

The primer sequence is as follows:

primer 1:5'-GCTTATCAGA-3' (M58822.1 b) (SEQ ID NO: 68);

primer 2:5'-TCAACATCAG-3' (M58822.1 b) (SEQ ID NO:69).

Primers and target DNA molecules were synthesized commercially (Sangon Biotech, shanghai, china) and mixed with other PCR reactions to form 10 μ Ι _ of amplification mixture, as shown in table 14 below. In particular, an amplification mixture is prepared which contains 1.0X 10^- ¹¹M synthetic target small RNA fragments. The primer concentration was 3.0X 10^-6M, polymerase concentration 0.25U/. mu.L. And includes an amplification mixture with equal water displacement of the target small RNA fragment as a negative control group (NTC).

TABLE 14 amplification mixture content for amplification of Small RNAs

Composition (I)	Final concentration
		Primer
1	3.0×10^-6M
		Primer 2	3.0×10^-6M
Target small RNA	1.0×10^-11M
		dNTPs	8mM
Isothermal reaction buffer	1×
		20×Evagreen	1.25μL
Klenow fragment exo-	0.25U/μL
		uracil-DNA glycosylase	0.05U/μL
100% polyethylene glycol 200	1.25μL
		Pure water	Make up to 20 μ L

For rapid SEA reactions, the amplification mixture was subjected to rapid thermal cycling between 60 ℃ and 34 ℃ using the CFX Connect TM real-time PCR system (Bio-Rad, CA). In particular, each thermal cycle consists of: the amplification reaction system was incubated at 60 ℃ for 1s, followed by immediately decreasing the temperature to 34 ℃ and immediately increasing the temperature to the previous 60 ℃ after incubation at 34 ℃ for 1 s. To achieve real-time monitoring of the amplification process, the fluorescence signal of the amplification product is scanned every two thermal cycles and plotted against time (FIG. 22).

As shown, the rapid SEA method is able to efficiently detect synthetic small RNA fragments in less than 10 minutes at a provided target concentration, which enables the detection of small RNAs from a sample using the present method and kit.

6. Sequence listing

This application was filed with a Computer Readable Form (CRF) copy of the sequence Listing, named 14624-; the entire contents of which are incorporated herein by reference.

Sequence listing

<110> Qingdao university

<120> method and kit for amplifying and detecting nucleic acid

<130> 14624-002-888

<140> TBA

<141>

<160> 69

<170> PatentIn version 3.5

<210> 1

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 1

gggtcattgg aaactggaag actggagtgc agaagaggag agtggaattc 50

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 2

gtcattggaa actggaagac tg 22

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 3

ccactctcct cttctgcac 19

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 4

ggttcaaaag tgaaagacgg tcttgctgtc acttatagat ggatccgcgc 50

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 5

ggttcaaaag tgaaagacgg tcttg 25

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 6

gcgcggatcc atctataagt gac 23

<210> 7

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primers (SEQ ID Nos.2 and 3), which were re-designed to test the Rapid SEA method

Ability to detect RNA molecules in biological samples

<400> 7

gggtcauugg aaacuggaag acuggagugc agaagaggag aguggaauuc 50

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 8

tcgcggtaat acataggtcg c 21

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 9

gcccaataaa tccggataac gc 22

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 10

gtctggtgtt aaaggcagc 19

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 11

tccaatgcat acaactgtta agc 23

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 12

gcaagggttc gttatttgat g 21

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 13

ctagctgata tggcgcac 18

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 14

gctatgctga gaagtagaat ag 22

<210> 15

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 15

gtgtctcagt cccattgt 18

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 16

aatgacttta gcaggtaatg 20

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 17

tggtacagtc aaactcta 18

<210> 18

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 18

gtctaggcgg attgagagat tgg 23

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 19

gtgtctcagt cccagtgttg g 21

<210> 20

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 20

tagtaatgca tagataattt gtcctt 26

<210> 21

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 21

gtttccaacc gttattccca ag 22

<210> 22

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 22

atcttaggac ctttcggtta agg 23

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 23

actagctgat atcacataga ctc 23

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 24

ccaccaaaca catgcatac 19

<210> 25

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 25

catgggcttg ggtttactat g 21

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 26

agcactatcc atcaccattg 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 27

agggtgaagt atacgcctag 20

<210> 28

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 28

gacccaccaa acacatgca 19

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 29

gggcttgggt ttactatgtg g 21

<210> 30

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 30

gcaagggttc gttatttgat g 21

<210> 31

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 31

ctagctgata tggcgcac 18

<210> 32

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 32

gacatccttg gcaaagtt 18

<210> 33

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 33

cggttaacct ccattatgtt tc 22

<210> 34

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 34

cgcataagaa ctttggttcg 20

<210> 35

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 35

gcaggtcctt tcaactttga ttca 24

<210> 36

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 36

gtctaggcgg attgagagat tgg 23

<210> 37

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 37

gtgtctcagt cccagtgttg g 21

<210> 38

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 38

gtaaaggcct accaaggct 19

<210> 39

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 39

ctctcaatcc gcctagacg 19

<210> 40

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 40

cgttaaagaa ggggatctta gg 22

<210> 41

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 41

atagactctc ccttaaccga aa 22

<210> 42

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 42

gtctaggcgg attgagagat tgg 23

<210> 43

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 43

gtgtctcagt cccagtgttg g 21

<210> 44

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 44

ctttcggtta agggagagtc 20

<210> 45

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 45

ccaccaacta gctgatatca c 21

<210> 46

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 46

tagtaatgca tagataattt gtcctt 26

<210> 47

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 47

gtttccaacc gttattccca ag 22

<210> 48

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 48

gactgccggt gacaaacc 18

<210> 49

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 49

cgtcatcccc accttcct 18

<210> 50

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 50

gttgcgacag ctctaggac 19

<210> 51

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 51

ctgcaccacc gataattgc 19

<210> 52

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 52

cgctagtaat cgcggatcag c 21

<210> 53

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 53

cgggaacgta ttcaccgc 18

<210> 54

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 54

ggttcaaaag tgaaagacgg tcttg 25

<210> 55

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 55

gcgcggatcc atctataagt gac 23

<210> 56

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 56

cgcatggttc aaaagtgaa 19

<210> 57

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> synthetic nucleic acid (synthetic nucleic acid)

<400> 57

agtgacagca agaccgt 17

<210> 58

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 58

agatgttgaa ggattcaacc aaatctccag agtttgttaa aaccgttcca a 51

<210> 59

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 59

atgttgaagg attcaaccaa atc 23

<210> 60

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 60

ggaacggttt taacaaactc tg 22

<210> 61

<211> 66

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 61

caaatgcttc taggcggact atgacttagt tgcgttacac cctttcttga caaaacctaa 60

cttgcg 66

<210> 62

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 62

cctgtgttat cttggaggtc 20

<210> 63

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 63

ccctgaaggg ctctctgg 18

<210> 64

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 64

accaaaagag ctagaaccac 20

<210> 65

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 65

atgttgaagg attcaacca 19

<210> 66

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 66

ggaacggttt taacaaact 19

<210> 67

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 67

gcuuaucaga cugauguuga 20

<210> 68

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 68

gcttatcaga 10

<210> 69

<211> 10

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Synthetic Oligonucleotide (Synthetic Oligonucleotide)

<400> 69

tcaacatcag 10

Claims

1. A method of amplifying a target nucleic acid molecule in a sample, the method comprising contacting a polymerase and a pair of oligonucleotide primers with the sample, wherein the primers are designed to specifically hybridize to the target nucleic acid molecule, thereby forming an amplification mixture; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature, thereby amplifying the target nucleic acid sequence by Polymerase Chain Reaction (PCR); wherein the difference between the first and second temperatures is less than about 30 ℃.

2. The method of claim 1, wherein the difference between the first temperature and the second temperature is less than about 25 ℃ or less than about 20 ℃.

3. The method of claim 1 or 2, wherein the difference between the first temperature and the second temperature is about 10-15 ℃.

4. The method of any one of claims 1 to 3, wherein the difference between the first temperature and the second temperature is about 10 ℃, about 11 ℃, about 12 ℃, about 13 ℃, about 14 ℃ or about 15 ℃.

5. The method of any one of claims 1-4, wherein the polymerase has an optimal temperature to catalyze primer extension during PCR.

6. The method of claim 5, wherein the optimal temperature is within ± 5 ℃ of the first temperature.

7. The method of claim 5, wherein the optimal temperature is within ± 6 ℃ of the second temperature.

8. The method of claim 6 or 7, wherein the optimal temperature is between the first temperature and the second temperature.

9. The method of any one of claims 1 to 8, wherein the sequence of the target nucleic acid molecule has a first melting temperature, and wherein the first temperature is within ± 5 ℃ of the first melting temperature.

10. The method of any one of claims 1 to 9, wherein the pair of oligonucleotide primers has an average melting temperature and the second temperature is within ± 5 ℃ of the average melting temperature.

11. The method of claim 10, wherein the mean melting temperature is within ± 5 ℃ of the optimal temperature for the polymerase.

12. The method of any one of claims 1 to 11, wherein one of the pair of oligonucleotide primers has a second melting temperature and the other of the pair of oligonucleotide primers has a third melting temperature, and wherein the difference between the second melting temperature and the third melting temperature is less than 3 ℃.

13. The method of any one of claims 9 to 12, wherein the first melting temperature is determined using a computer algorithm based on the sequence of the target nucleic acid molecule.

14. The method of claim 12 or 13, wherein the second or third melting temperature is determined using a computer algorithm based on the sequence of the oligonucleotide primer.

15. The method of claim 13 or 14, wherein the computer algorithm is selected from NUPACK, DNAMelt, novro, BLAST, Primer Premier, alignnminer, Oligo, PerlPrimer, Primer3Web, and DNAstar.

16. The method of any one of claims 9 to 15, wherein the method further comprises determining the first, second, third and/or average melting temperature.

17. The method of any one of claims 1 to 16, wherein the polymerase is a thermostable polymerase.

18. The method of any one of claims 1 to 17, wherein the polymerase has strand displacement activity.

19. The method of any one of claims 1 to 18, wherein the polymerase has reverse transcriptase activity.

20. The method of any one of claims 1 to 19, wherein the polymerase is Bst DNA polymerase or an isomerase thereof, or a functional derivative with at least 80% sequence identity.

21. The method of any one of claims 1-19, wherein the polymerase is Bst DNA polymerase (large fragment) or an isomerase thereof, or a functional mutant with at least 80% sequence identity.

22. The method of any one of claims 1-19, wherein the polymerase is full length Bst DNA polymerase, Bst DNA polymerase (large fragment), Bst 2.0DNA polymerase, Bst 2.0WarmStart DNA polymerase, or Bst 3.0DNA polymerase.

23. The method of any one of claims 20 to 22, wherein the first temperature is in the range of about 68-78 ℃ and the second temperature is in the range of about 55-69 ℃.

24. The method of any one of claims 1 to 19, wherein the polymerase is DNA polymerase I or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

25. The method of any one of claims 1 to 19, wherein the polymerase is DNA polymerase I large fragment (Klenow) or isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

26. The method of any one of claims 1-19, wherein the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow), or Klenow exo^-。

27. The method of any one of claims 24 to 26, wherein the first temperature is in the range of about 50-60 ℃ and the second temperature is in the range of about 30-40 ℃.

28. The method of any one of claims 1 to 19, wherein the polymerase is Vent DNA polymerase or isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

29. The method of any one of claims 1 to 19, wherein the polymerase is Vent DNA polymerase, Vent (exo)^-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo)^-) A DNA polymerase.

30. The method of claim 28 or 29, wherein the first temperature is in the range of about 70-80 ℃ and the second temperature is in the range of about 55-70 ℃.

31. The method of any one of claims 1 to 19, wherein the polymerase is phi29DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

32. The method of claim 31, wherein the first temperature is selected from the range of about 40-55 ℃ and the second temperature is selected from the range of about 20-37 ℃.

33. The method of any one of claims 1 to 19, wherein the polymerase is Taq DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

34. The method of claim 33, wherein the polymerase is Taq DNA polymerase, hot start Taq DNA polymerase, EpiMark hot start Taq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase.

35. The method of claim 33 or 34, wherein the first temperature is in the range of about 70-88 ℃ and the second temperature is in the range of about 58-70 ℃.

36. The method of any one of claims 1 to 35, wherein the sequence length ratio of at least one of the primers to the amplification product is about 30-60%.

37. The method of claim 36, wherein the amplification product is about 20-50 base pairs (bp) in length.

38. The method of claim 35 or 36, wherein the primer is about 10 to about 25 nucleotides (nt) in length.

39. The method of any one of claims 1 to 38, wherein at least one of said primers has a G/C content of about 40% to about 60% and the difference in percentage of G/C content of said primers is less than 20%.

40. The method of any one of claims 1 to 39, wherein at least one of the primers has an extended end to which nucleotides can be added by the polymerase during PCR, and the primer has a G or C at the extended end.

41. The method of any one of claims 1 to 40, wherein at least one of the primers has an extended end to which nucleotides can be added by the polymerase during PCR, and wherein the primer has a G/C content of at least 40% over a continuous 5-nucleotide region of the extended end.

42. The method of any one of claims 1-41, wherein each thermal cycle comprises incubating the amplification mixture at the first temperature for less than 2s and incubating the amplification mixture at the second temperature for less than 2 s.

43. The method of any of claims 1-42, wherein each thermal cycle further comprises a ramp time of less than 10 s.

44. The method of claim 43, wherein each thermal cycle comprises incubating the amplification mixture at the first temperature for about 1s and incubating the amplification mixture at the second temperature for about 1s, and wherein the temperature change time is less than 2 s.

45. The method of any one of claims 1 to 44, wherein the method completes at least 35 thermal cycles in less than 10 minutes, or completes at least 40 thermal cycles in less than 8 minutes.

46. The method of any one of claims 1 to 45, further comprising detecting the amplified sequence.

47. The method of any one of claims 1 to 46, wherein the amplification mixture further comprises dUTPs.

48. The method of claim 47, wherein the amplification mixture does not comprise dTTPs.

49. The method of claim 47 or 48, wherein the amplification mixture further comprises uracil-DNA glycosylase (UDG).

50. The method of any one of claims 1 to 49, wherein the amplification mixture further comprises a single-chain binding protein (SSB).

51. The method of any one of claims 1 to 50, wherein the amplification mixture further comprises polyethylene glycol.

52. The method of any one of claims 1 to 51, wherein the amplification mixture comprises a concentration of no more than 1.0 x 10^-12M of said target nucleic acid.

53. The method of any one of claims 1 to 52, wherein the amplification mixture comprises less than 10 copies of the target nucleic acid.

54. The method of any one of claims 1 to 53, wherein the amplification mixture comprises the polymerase at a concentration of not less than 0.1U/μ L.

55. The method of any one of claims 1 to 54, wherein the amplification mixture comprises a concentration of not less than 1.0 x 10^-6At least one primer of M.

56. The method of any one of claims 1 to 55, wherein the amplification mixture comprises a volume fraction of at least 0.5% polyethylene glycol.

57. The method of any one of claims 1 to 56, wherein the amplification mixture comprises the SSB at a concentration of at least 1 μ g/mL.

58. The method of any one of claims 1 to 57, wherein the volume of the amplification mixture is about 1-30 μ L.

59. The method of any one of claims 1 to 58, wherein the processing step is performed by loading the amplification mixture onto a microfluidic device capable of cooling and heating the amplification mixture at a rate of at least 10 ℃/s.

60. The method of any one of claims 1 to 59, wherein the target nucleic acid is a double-stranded nucleic acid molecule or a single-stranded nucleic acid molecule.

61. The method of any one of claims 1 to 60, wherein the target nucleic acid is DNA or RNA.

62. The method of claim 61, wherein the target nucleic acid is a small RNA.

63. A method of detecting a target nucleic acid molecule in a sample, the method comprising contacting a polymerase and a pair of oligonucleotide primers with the sample, wherein the primers are designed to specifically hybridize to the target nucleic acid molecule, thereby forming an amplification mixture; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the target nucleic acid sequence by Polymerase Chain Reaction (PCR) to detect the amplified sequence in the amplification mixture, wherein the difference between the first and second temperatures is less than about 30 ℃.

64. The method of claim 63, wherein the detecting is performed every 1, 2, 5, or 10 thermal cycles.

65. The method of claim 63, wherein the assay is performed by detecting a fluorescent signal in the amplification mixture that is reflective of the amount of the amplified sequence.

66. A method of diagnosing infection by detecting a sample containing pathogen nucleic acid collected from a subject; contacting a polymerase and a pair of oligonucleotide primers with a sample, thereby forming an amplification mixture; wherein the primer can amplify a target pathogen nucleic acid sequence to indicate a pathogen infection; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the target pathogen nucleic acid sequence by Polymerase Chain Reaction (PCR) to detect the presence or absence of the amplified sequence in the amplification mixture, wherein the difference between the first and second temperatures is less than about 30 ℃.

67. The method of claim 66, wherein the sample comprises the genomic nucleic acid extracted from the subject or episomal nucleic acid from the subject.

68. The method of claim 66, wherein the sample is a bodily fluid sample.

69. The method of any one of claims 66 to 68, wherein the pathogen is a virus, bacterium, fungus or parasite.

70. A method of detecting a genetic alteration in a subject by detecting collection of a sample containing nucleic acids from the subject; contacting a polymerase and a pair of oligonucleotide primers with a sample, thereby forming an amplification mixture; wherein the primers are designed to amplify a target sequence suspected of containing a genetic alteration in the genome of the subject; subjecting the amplification mixture to a plurality of thermal cycles between a first temperature and a second temperature to amplify the target sequence by Polymerase Chain Reaction (PCR), sequencing the amplified sequence to determine the presence or absence of the genetic alteration, wherein the difference between the first and second temperatures is less than about 30 ℃.

71. The method of claim 70, wherein the genetic alteration is a mutation in a gene such as a nucleotide substitution, deletion, insertion, or copy number variation.

72. The method of any one of claims 70 or 71, wherein the genetic alteration is a single nucleotide polymorphism.

73. The method of any one of claims 70-72, further comprising diagnosing or prognosing a genetic condition associated with the genetic alteration.

74. An apparatus for performing the method of any one of claims 1 to 73.

75. A kit for performing the method of any one of claims 1 to 73.

76. A kit for amplifying a target nucleic acid molecule comprising a thermostable polymerase and multiple components of one or more pairs of oligonucleotide primers, wherein the pair of primers is designed to amplify an amplified region of about 20-50 base pairs (bp) by Polymerase Chain Reaction (PCR), wherein the thermostable polymerase used for amplification has strand displacement activity.

77. The kit of claim 76, wherein at least one primer has a melting temperature within ± 5 ℃ of the optimal temperature for the thermostable polymerase.

78. The kit of claim 76 or 77, wherein the G/C content of at least one primer is about 40% -60%.

79. The kit of any one of claims 76-78, wherein each primer comprises an extended end to which nucleotides can be added by the polymerase during PCR, and wherein at least one primer has a G/C content of at least 40% over a contiguous 5-nucleotide region at the extended end.

80. The kit of any one of claims 76-78, wherein each primer comprises an extended end to which nucleotides can be added by the polymerase during PCR, and wherein at least one primer has a G or a C at the extended end.

81. The kit of any one of claims 76-80, wherein at least one of the primers is about 10-25 nucleotides in length.

82. The kit of any one of claims 76-81, wherein the polymerase is Bst DNA polymerase or isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

83. The kit of any one of claims 76-81, wherein the polymerase is Bst DNA polymerase large fragment or isomerase thereof, or a functional mutant with at least 80% sequence identity.

84. The kit of any one of claims 76-81, wherein the polymerase is full length Bst DNA polymerase, a Bst DNA polymerase large fragment, Bst2.0 DNA polymerase, Bst2.0WarmStart DNA polymerase, or Bst 3.0DNA polymerase.

85. The kit of any one of claims 76-81, wherein the polymerase is DNA polymerase I or an isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

86. The kit of any one of claims 76-81, wherein the polymerase is DNA polymerase I large fragment (Klenow) or isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

87. The kit of any one of claims 76-81, wherein the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow), or Klenow exo^-。

88. The kit of any one of claims 76-81, wherein the polymerase is Vent DNA polymerase or an isomerase thereof, or a functional mutant thereof having at least 80% sequence identity.

89. The kit of any one of claims 76-81, wherein the polymerase is Vent DNA polymerase, Vent (exo)^-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo)^-) A DNA polymerase.

90. The kit of any one of claims 76-81, wherein the polymerase is phi29 DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

91. The kit of any one of claims 76-81, wherein the polymerase is Taq DNA polymerase or an isomerase thereof, or a functional mutant having at least 80% sequence identity.

92. The kit according to any one of claims 76 to 81, wherein the polymerase is Taq DNA polymerase, Hot Start Taq DNA polymerase, EpiMark Hot Start Taq DNA polymerase, OneTaq Hot Start DNA polymerase, LongAmp Taq DNA polymerase or LongTaq DNA polymerase.

93. The kit of any one of claims 76-92, further comprising dUTPs.

94. The kit of any one of claims 76-93, wherein the kit does not comprise dTTPs.

95. The kit of any one of claims 76-94, further comprising uracil-DNA glycosylase (UDG).

96. The kit of any one of claims 76-95, further comprising a buffer solution suitable for the polymerase.

97. The kit of any one of claims 76-96, wherein the kit further comprises a single-chain binding protein (SSB), preferably a thermostable SSB.

98. The kit of claim 84, wherein the SSB protein is derived from a bacterium or a bacteriophage.

99. The kit of any one of claims 84 or 85, wherein the SSB protein is selected from T4 phage 32SSB, T7 phage 2.5SSB, phage 29SSB, E.coli SSB, or a functional derivative thereof.

100. The kit of any one of claims 76-99, further comprising polyethylene glycol.

101. The kit of any one of claims 76-100, wherein the plurality of components is

(a) Contained in a container, and the kit further comprises instructions for adding an amount of sample to form an amplification mixture; or

(b) Contained in at least two separate containers, and wherein the kit further comprises instructions for mixing the components in the separate containers with an appropriate amount of sample to form an amplification mixture.

102. The kit of claim 101, wherein the amplification mixture contains the polymerase at a concentration of no less than 0.1U/μ L.

103. The kit of claim 101 or 102, wherein the amplification mixture comprises a concentration of not less than 1.0 x 10^-6At least one primer of M.

104. The kit of any one of claims 101-103, wherein the amplification mixture comprises about 0.5-10% polyethylene glycol by volume fraction.

105. The kit of any one of claims 101-104, wherein the amplification mixture comprises SSB at a concentration of about 1-50 μ g/mL.

106. The kit of any one of claims 101-105, wherein the volume of the amplification mixture is about 1-30 μ L.

107. The kit of any one of claims 76-106, wherein the kit further comprises instructions for performing PCR using a protocol comprising a plurality of thermal cycles, wherein each thermal cycle comprises no more than 2 seconds of incubation at a first temperature and no more than 2 seconds of incubation at a second temperature, wherein the difference between the first temperature and the second temperature is less than 20 ℃.

108. The kit of claim 107 wherein the polymerase is full length Bst DNA polymerase, Bst DNA polymerase large fragment, Bst 2.0DNA polymerase, Bst 2.0WarmStart DNA polymerase or Bst 3.0DNA polymerase and wherein the first temperature is about 68-78 ℃ and the second temperature is in the range of about 55-69 ℃.

109. The kit of claim 107, wherein the polymerase is wild-type DNA polymerase I, DNA polymerase I large fragment (Klenow), or Klenow exo^-And wherein the first temperature is in the range of about 50-60 ℃ and the second temperature is in the range of about 30-40 ℃.

110. The kit of claim 107, wherein the polymerase is Vent DNA polymerase, Vent (exo)^-) DNA polymerase, Deep Vent DNA polymerase or Deep Vent (exo)^-) A DNA polymerase, and wherein the first temperature is in the range of about 70-80 ℃ and the second temperature is in the range of about 55-70 ℃.

111. The kit of claim 107, wherein the polymerase is phi29 DNA polymerase, and wherein the first temperature is selected from the range of about 40-55 ℃ and the second temperature is selected from the range of about 20-37 ℃.

112. The kit of claim 107, wherein the polymerase is Taq DNA polymerase, hot start Taq DNA polymerase, EpiMark hot start Taq DNA polymerase, OneTaq hot start DNA polymerase, LongAmp Taq DNA polymerase or longTaq DNA polymerase, and wherein the first temperature is selected from the range of about 70-88 ℃ and the second temperature is selected from the range of about 58-70 ℃.

113. The kit of any one of claims 107-112, wherein each thermal cycle further comprises a total temperature change time of less than 10 seconds.

114. The kit of any one of claims 107-112, wherein the number of thermal cycles is less than 40 cycles and the thermal cycling protocol further comprises a total reaction time of less than 10 minutes.

115. The kit of claim 108, wherein each thermal cycle comprises incubation at a first temperature selected from about 72-76 ℃ for about 1s, and from a second temperature selected from about 61-65 ℃ for about 1s, for a total temperature change time of less than 2s, and wherein the total reaction time is less than 8 minutes.

116. The kit of any one of claims 107-115, wherein the amplification region has a first melting temperature, and wherein the first temperature is within ± 5 ℃ of the first melting temperature.

117. The kit of any one of claims 107 to 116, wherein the pair of primers have a mean melting temperature, and wherein the second temperature is within ± 5 ℃ of the mean melting temperature.

118. The method of any one of claims 107 to 117, wherein one of the pair of primers has a second melting temperature and the other of the pair of primers has a third melting temperature, and wherein the difference between the second and third melting temperatures is less than about 3 ℃.