CN113528565B - Molecular chaperone expression vector and strain for improving secretory expression of phytase in pichia pastoris - Google Patents

Abstract

The invention relates to the field of genetic engineering, in particular to a molecular chaperone expression vector and a bacterial strain for improving secretory expression of phytase in pichia pastoris. The expression vector comprises chaperone genes BIP and PDI in series, chaperone genes VHB and PDI in series, or chaperone genes HACI and PDI in series. And (3) carrying out genetic engineering modification and screening on the obtained recombinant pichia pastoris containing the high-temperature resistant phytase high-enzyme activity expression strain V28-VTR-001 with 50L fermentation total enzyme activity reaching 37239U/mL.

Description

Molecular chaperone expression vector and strain for improving secretory expression of phytase in pichia pastoris

Technical Field

The invention relates to the field of genetic engineering, in particular to a molecular chaperone expression vector and a bacterial strain for improving secretory expression of phytase in pichia pastoris.

Background

Crops such as cereals and legumes are main raw materials of foods and animal feeds. 50% -70% of the phosphorus in the raw materials exists in the form of phytic acid phosphorus. Monogastric animals lack enzymes necessary for decomposing phytate phosphorus, and the utilization rate of phosphorus is low, resulting in waste and pollution of a large amount of phosphorus.

The phytase can hydrolyze phytic acid into inositol and phosphoric acid, and the phytase is added into the feed, so that the utilization rate of phosphorus in the feed can be improved, the pollution of phosphorus in feces to the environment can be reduced, the anti-nutrition effect of phytate can be reduced, and the absorption capacity of animals to proteins and trace elements can be increased, so that the phytase is an indispensable feed additive. The high fermentation enzyme activity and the excellent heat resistance are the precondition and the guarantee of the efficient application of the phytase in the feed industry, so that the screening of the high-temperature resistant phytase with the high enzyme activity from the natural world or through molecular transformation and other methods becomes a hot spot of the research of the current feed industry. Co-expression of target protein and molecular chaperone is one of important means for increasing target protein expression quantity and is also a very important way for increasing phytase enzyme activity.

Chaperones, also known as accessory proteins, are a class of protein molecules that play an important role in the translation, transport, folding and modification of proteins in cells. A great deal of researches show that molecular chaperones have important significance for secretory expression of foreign proteins, and the main function of the molecular chaperones is to assist correct folding of proteins and reduce degradation caused by protein misfolding so as to improve secretory expression of the proteins. Chaperones are mainly derived from mammalian, prokaryotic and eukaryotic cells, and a few from plants. The distributed organs are mainly endoplasmic reticulum, cytoplasm, nucleus, cytoplasm, mitochondria and chloroplasts.

Pichia pastoris (P.pastoris) is a relatively simple eukaryotic expression system, and can carry out correct folding processing, glycosylation modification and the like on the exogenous recombinant protein, and the efficient expression of various exogenous proteins is realized by using an AOX1 strong promoter and methanol as a carbon source, so that the recombinant protein is widely utilized in the field of exogenous protein expression. Research shows that different exogenous proteins have different folding protein response effects and mechanisms of posttranslational modification when expressed in pichia pastoris expression systems.

In the current literature reports, commonly used molecular chaperones are BIP, disulfide isomerase PDI (Protein disulfide isomerase), EROI, endoplasmic reticulum response protein HACI, clear vibrio hemoglobin (Vitreoscilla hemoglobin gene VHb), SSAI and the like.

Bip is the most important Hsp70 chaperone protein, one of the main regulators of ER function, essential for maintaining homeostasis of the endoplasmic reticulum, and critical for promoting correct folding of proteins. Bip has ATPase activity and interacts with specific endoplasmic reticulum localization protein ERdjs to stimulate binding of Bip to a substrate.

When the protein is expressed at a high level, unfolded proteins can be prone to misfolding and accumulation in the endoplasmic reticulum, the endoplasmic reticulum is mainly regulated and controlled by UPR, and the UPR activates a regulating factor HACI, so that the high-level expression of UPR related proteins and molecular chaperones can be promoted, correct folding and secretion of the proteins are mediated, and the misfolded proteins in the endoplasmic reticulum are degraded and the like.

EROI modifies the reduced protein disulfide isomerase PDI into oxidation state in endoplasmic reticulum, the oxidation activity of PDI helps the protein form correct folding structure to be secreted outside the cell, and has promotion effect on the formation of protein disulfide bond in endoplasmic reticulum cavity, and both EROI and PDI molecular chaperones are responsible for folding endoplasmic reticulum oxidized protein. Chaperones such as PDI1, which also belong to the protein disulfide isomerase, are multifunctional chaperones in the lumen of the endoplasmic reticulum.

Disulfide isomerase PDI (Protein disulfide isomerase), which is located mainly in the endoplasmic reticulum, is an important folding catalyst, and particularly plays an important role in folding disulfide-containing proteins. PDI has both oxidative and isomerical activity, which can help proteins form disulfide bonds and rearrange incorrectly paired disulfide bonds.

The molecular chaperones have wide application in genetic engineering bacteria. The different proteins have selectivity on molecular chaperones when expressed in pichia pastoris, du Jiliang studies the influence of 10 different positioned molecular chaperones on the expression of exogenous protein glucanase (EXG 1) in pichia pastoris, and the result shows that BIP, EROI, PDI, HACI plays an important role in the expression process of exogenous protein glucanase (EXG 1), wherein the expression quantity of EXG1 is improved by 2 times by the BIP coexpression strain. In the current literature report, the target protein and the independent molecular chaperones are co-expressed, and few target proteins and a plurality of molecular chaperones are co-expressed at the same time, and the expression quantity is not remarkably improved. Min Qi and the like combine HACI with different chaperones respectively in a simple serial manner, and co-express with mannanase, and as a result, the combination of the chaperones does not obviously improve the expression level of the mannanase, and the combination effect of the chaperones is poorer than that of single HACI.

Disclosure of Invention

The invention aims to provide a molecular chaperone expression vector for improving secretory expression of phytase in pichia pastoris.

It is still another object of the present invention to provide a recombinant strain capable of expressing phytase with high efficiency.

It is yet another object of the present invention to provide methods for utilizing increased secretory expression of phytase in pichia pastoris.

The chaperone expression vector for improving the secretory expression of phytase in pichia pastoris according to the present invention comprises chaperone genes BIP and PDI in tandem, or chaperone genes VHB and PDI in tandem, or chaperone genes HACI and PDI in tandem.

According to the molecular chaperone expression vector for improving secretory expression of phytase in pichia pastoris, the nucleotide sequence of a molecular chaperone gene BIP is shown as SEQ ID NO:1, the nucleotide sequence of the gene PDI is shown as SEQ ID NO:2, the nucleotide sequence of the molecular chaperone gene VHB is shown in SEQ ID NO:3, the nucleotide sequence of the molecular chaperone gene HACI is shown in SEQ ID NO: 4.

SEQ ID NO：1

Atgctgtcgttaaaaccatcttggctgactttggcggcattaatgtatgccatgctattggtcgtagtgccatttgctaaacctgttagagctgacgatgtcgaatcttatggaacagtgattggtatcgatttgggtaccacgtactcttgtgtcggtgtgatgaagtcgggtcgtgtagaaattcttgctaatgaccaaggtaacagaatcactccttcctacgttagtttcactgaagacgagagactggttggtgatgctgctaagaacttagctgcttctaacccaaaaaacaccatctttgatattaagagattgatcggtatgaagtatgatgccccagaggtccaaagagacttgaagcgtcttccttacactgtcaagagcaagaacggccaacctgtcgtttctgtcgagtacaagggtgaggagaagtctttcactcctgaggagatttccgccatggtcttgggtaagatgaagttgatcgctgaggactacttaggaaagaaagtcactcatgctgtcgttaccgttccagcctacttcaacgacgctcaacgtcaagccactaaggatgccggtctcatcgccggtttgactgttctgagaattgtgaacgagcctaccgccgctgcccttgcttacggtttggacaagactggtgaggaaagacagatcatcgtctacgacttgggtggaggaaccttcgatgtttctctgctttctattgagggtggtgctttcgaggttcttgctaccgccggtgacacccacttgggtggtgaggactttgactacagagttgttcgccacttcgttaagattttcaagaagaagcataacattgacatcagcaacaatgataaggctttaggtaagctgaagagagaggtcgaaaaggccaagcgtactttgtcttcccagatgactaccagaattgagattgactctttcgtcgacggtatcgacttctctgagcaactgtctagagctaagtttgaggagatcaacattgaattattcaagaagacactgaaaccagttgaacaagtcctcaaagacgctggtgtcaagaaatctgaaattgatgacattgtcttggttggtggttctaccagaattccaaaggttcaacaattattggaggattactttgacggaaagaaggcttctaagggaattaacccagatgaagctgtcgcatacggtgctgctgttcaggctggtgttttgtctggtgaggaaggtgtcgatgacatcgtcttgcttgatgtgaaccccctaactctgggtatcgagactactggtggcgttatgactaccttaatcaacagaaacactgctatcccaactaagaaatctcaaattttctccactgctgctgacaaccagccaactgtgttgattcaagtttatgagggtgagagagccttggctaaggacaacaacttgcttggtaaattcgagctgactggtattccaccagctccaagaggtactcctcaagttgaggttacttttgttttagacgctaacggaattttgaaggtctctgccaccgataagggaactggaaaatccgagtccatcaccatcaacaatgatcgtggtagattgtccaaggaggaggttgaccgtatggttgaagaggccgagaagtacgccgctgaggatgctgcactaagagaaaagattgaggctagaaacgctctggagaactacgctcattcccttaggaaccaagttactgatgactctgaaaccgggcttggttctaaattggacgaggacgacaaagagacattgacagatgccatcaaagataccctagagttcttggaagacaacttcgacaccgcaaccaaggaagaattagacgaacaaagagaaaagctttccaagattgcttacccaatcacttctaagctatacggtgctccagagggtggtactccacctggtggtcaaggttttgacgatgatgatggagactttgactacgactatgactatgatcatgatgagttgtag

SEQ ID NO：2

Atgcaattcaactggaatattaaaactgtggcaagtattttgtccgctctcacactagcacaagcaagtgatcaggaggctattgctccagaggactctcatgtcgtcaaattgactgaagccacttttgagtctttcatcaccagtaatcctcacgttttggcagagttttttgccccttggtgtggtcactgtaagaagttgggccctgaacttgtttctgctgccgagatcttaaaggacaatgagcaggttaagattgctcaaattgattgtacggaggagaaggaattatgtcaaggctacgaaattaaagggtatcctactttgaaggtgttccatggtgaggttgaggtcccaagtgactatcaaggtcaaagacagagccaaagcattgtcagctatatgctaaagcagagtttaccccctgtcagtgaaatcaatgcaaccaaagatttagacgacacaatcgccgaggcaaaagagcccgtgattgtgcaagtactaccggaagatgcatccaacttggaatctaacaccacattttacggagttgccggtactctcagagagaaattcacttttgtctccactaagtctactgattatgccaaaaaatacactagcgactcgactcctgcctatttgcttgtcagacctggcgaggaacctagtgtttactctggtgaggagttagatgagactcatttggtgcactggattgatattgagtccaaacctctatttggagacattgacggatccaccttcaaatcatatgctgaagctaacatccctttagcctactatttctatgagaacgaagaacaacgtgctgctgctgccgatattattaaaccttttgctaaagagcaacgtggcaaaattaactttgttggcttagatgccgttaaattcggtaagcatgccaagaacttaaacatggatgaagagaaactccctctatttgtcattcatgatttggtgagcaacaagaagtttggagttcctcaagaccaagaattgacgaacaaagatgtgaccgagctgattgagaaattcatcgcaggagaggcagaaccaattgtgaaatcagagccaattccagaaattcaagaagagaaagtcttcaagctagtcggaaaggcccacgatgaagttgtcttcgatgaatctaaagatgttctagtcaagtactacgccccttggtgtggtcactgtaagagaatggctcctgcttatgaggaattggctactctttacgccaatgatgaggatgcctcttcaaaggttgtgattgcaaaacttgatcacactttgaacgatgtcgacaacgttgatattcaaggttatcctactttgatcctttatccagctggtgataaatccaatcctcaactgtatgatggatctcgtgacctagaatcattggctgagtttgtaaaggagagaggaacccacaaagtggatgccctagcactcagaccagtcgaggaagaaaaggaagctgaagaagaagctgaaagtgaggcagacgctcacgacgagctttaa

SEQ ID NO：3

Atgttggatcaacagactatcaacatcatcaaggctactgttccagtcttgaaggaacatggtgttactatcactactactttctacaagaacttgtttgctaagcatccagaagttagaccattgtttgatatgggtagacaagaatctttggaacaaccaaaggctttggctatgactgtcttggctgctgctcagaacattgagaacttgccagctatcttgccagctgttaagaagattgctgttaagcattgtcaagctggtgttgctgctgctcattacccaattgttggtcaagaattgttgggtgctatcaaggaagtcttgggtgatgctgctactgatgatatcttggatgcttggggtaaggcttacggtgttattgctgatgtcttcattcaagttgaagctgatttgtacgctcaagctgttgaataa

SEQ ID NO：4

atgcccgtagattcttctcataagacagctagcccacttccacctcgtaaaagagcaaagacggaagaagaaaaggagcagcgtcgagtggaacgtatcctacgtaataggagagcggcccatgcttccagagagaagaaacgaagacacgttgaatttctggaaaaccacgtcgtcgacctggaatctgcacttcaagaatcagccaaagccactaacaagttgaaagaaatacaagatatcattgtttcaaggttggaagccttaggtggtaccgtctcagatttggatttaacagttccggaagtcgattttcccaaatcttctgatttggaacccatgtctgatctctcaacttcttcgaaatcggagaaagcatctacatccactcgcagatctttgactgaggatctggacgaagatgacgtcgctgaatatgacgacgaagaagaggacgaagagttacccaggaaaatgaaagtcttaaacgacaaaaacaagagcacatctatcaagcaggagaagttgaatgaacttccatctcctttgtcatccgatttttcagacgtagatgaagaaaagtcaactctcacacatttaaagttgcaacagcaacaacaacaaccagtagacaattatgtttctactcctttgagtcttccggaggattcagttgattttattaacccaggtaacttaaaaatagagtccgatgagaacttcttgttgagttcaaatactttacaaataaaacacgaaaatgacaccgactacattactacagctccatcaggttccatcaatgatttttttaattcttatgacattagcgagtcgaatcggttgcatcatccagcagtgatgacggattcatctttacacattacagcaggctccatcggctttttctctttgattggggggggggaaagttctgtagcagggaggcgcagttcagttggcacatatcagttgacatgcatagcgatcaggtga

The recombinant strain for efficiently expressing the phytase comprises the molecular chaperone expression vector for improving the secretory expression of the phytase in pichia pastoris.

According to the specific embodiment of the invention, the high-temperature resistant phytase high-enzyme activity expression strain V28-VTR-001, namely 50L of recombinant pichia pastoris with the total enzyme activity reaching 37239U/mL, is obtained through genetic engineering screening and is preserved in the Guangdong microorganism strain collection in 2021, and the preservation number is GDMCC NO.61456.

The invention breaks through the expression mode of co-expression of the existing target protein and the independent molecular chaperones, and overcomes the defects that the expression quantity of the target protein is not remarkably improved or the effect is worse than that of the single molecular chaperone by the conventional tandem molecular chaperones.

Drawings

FIG. 1 is a schematic diagram of vector B plasmid;

FIG. 2 is a schematic diagram of vector P plasmid;

FIG. 3 is a schematic diagram of a vector BP plasmid;

FIG. 4 is a graph showing the fermentation enzyme activities of V28-VTR-001 and V1 phytase;

FIG. 5 is a graph showing the thermostability of V28-VTR-001 phytase;

FIG. 6 is a graph showing the pH profile of the optimum reaction for V28-VTR-001 phytase;

FIG. 7 is a graph showing the pH stability of V28-VTR-001 phytase.

The high temperature resistant phytase high enzyme activity expression strain V28-VTR-001 (Pichia sp.) was deposited at the Guangdong province microorganism strain collection (address, hirudo 100. Segregation, guangdong province, building 5, hirudo 100. No. 59, postal code 510070) at 20 days of 2021, with accession number GDMCC NO:61456 (taxonomic designation: pichia).

Detailed Description

The following examples are given for better illustration of the invention and should not be construed as limiting the invention. The reagents and biological materials, unless otherwise specified, are commercially available.

Experimental materials and reagents:

1. strain and vector

Coli Topl0, pichia X33, plasmid pPIC9k, amp and G418 antibiotics were all purchased from Invitrogen.

2. Enzymes and reagents

Q5 high-fidelity PCR amplification enzyme, restriction endonuclease were purchased from NEB (Beijing) Inc.; plasmid extraction and DNA gel recovery and purification kit was purchased from Tiangen Biochemical technology (Beijing) Co.

3. Culture medium

The E.coli medium was LB medium (1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0). LB+Amp Medium ampicillin was added to LB medium at a final concentration of 100 ug/mL. LB+G418 medium A final concentration of 300ug/mL of G418 antibiotic was added to LB medium.

The yeast medium was YPD medium (1% yeast extract, 2% peptone, 2% glucose). The yeast selection medium was YPD+G418 medium (YPD+G418 medium was YPD medium supplemented with G418 at a final concentration of 300 ug/mL).

Yeast induction medium BMGY (1% yeast extract, 2% peptone, 1.34% ynb, 0.00004% biotin, 1% glycerol (V/V)) and BMMY (0.5% methanol instead of glycerol, the remainder of the ingredients were identical to BMGY).

Recombinant yeast fermentation culture basic salt culture medium: 5% of diammonium phosphate, 0.5% of monopotassium phosphate, 1.5% of magnesium sulfate heptahydrate, 1.95% of potassium sulfate, 0.1% of calcium sulfate, 0.1% of potassium hydroxide and 0.03% of defoamer. 4.35 ml of PTM1 per liter were added after the high pressure.

PTM1 (trace salt solution): copper sulfate 0.6%, potassium iodide 0.018%, manganese sulfate monohydrate 0.3%, sodium molybdate dihydrate 0.02%, boric acid 0.002%, cobalt chloride hexahydrate 0.05%, zinc chloride 2%, ferric sulfate heptahydrate 6.5%, concentrated sulfuric acid 0.5%, biotin 0.02%.

The invention will be described in detail by way of examples below:

example 1 construction of VectorB, vectorV, vectorH vector

1. Construction of vector B vector

Respectively taking Pichia pastoris X genome and pPIC9k plasmid as templates, designing 2 pairs of primers, amplifying 2 fragments of BIP gene and pPIC9k vector by PCR, introducing a fusion region into the primers, fusing the two fragments of BIP gene and pPIC9k vector by adopting a fusion PCR method, constructing a vector B circular plasmid as shown in figure 1, transforming the fused circular plasmid into escherichia coli Topl0 competent cells, screening recombinant transformants in a flat plate containing Amp (100 mug/mL) antibiotics, picking part of the transformants into LB+amp liquid medium, culturing for 3 hours at 37 ℃, carrying out bacterial liquid PCR verification by using verification primers BIP-F11 and BIP-R11, carrying out sequencing on the transformants by adopting a construction method of VectorV, vectorH, referring to the vector B, wherein the sequences of the primers are as follows:

BIP-F1：caactaattattcgaaggatccaaacgatgctgtcgttaaaaccatcttggc

BIP-R1：caaatggcattctgacatcctcttgactacaactcatcatgatcatagtcat

pPIC9k-F1：tatgactatgatcatgatgagttgtagtcaagaggatgtcagaatgccatttg

pPIC9k-R1：gccaagatggttttaacgacagcatcgtttggatccttcgaataattagttg

BIP-F11：atgctgtcgttaaaaccatcttggc

BIP-R11：ctacaactcatcatgatcatagtcat

VectorV, vectorH the construction method is described with reference to vector b, the primer sequences are as follows:

VGB-F1：caactaattattcgaaggatccaaacgatgttggatcaacagactatcaacatc

VGB-R1：caaatggcattctgacatcctcttgattattcaacagcttgagcgtacaaatc

pPIC9k-VF1：gatttgtacgctcaagctgttgaataatcaagaggatgtcagaatgccatttg

pPIC9k-VR1：gatgttgatagtctgttgatccaacatcgtttggatccttcgaataattagttg

VGB-F11：atgttggatcaacagactatcaacatc

VGB-R11：gatttgtacgctcaagctgttgaataa

HACI-F1：caactaattattcgaaggatccaaacgatgcccgtagattcttctcataagac

HACI-R1：caaatggcattctgacatcctcttgatcacctgatcgctatgcatgtcaac

pPIC9k-HF1：gttgacatgcatagcgatcaggtgatcaagaggatgtcagaatgccatttg

pPIC9k-HR1：gtcttatgagaagaatctacgggcatcgtttggatccttcgaataattagttg

HACI-F11：atgcccgtagattcttctcataagac

HACI-R11：tcacctgatcgctatgcatgtcaac

2. construction of vector P vector

2 pairs of primers are designed by taking Pichia pastoris X genome as a template, 2 fragments of PDI gene and P2 promoter are amplified by PCR, a fusion region is introduced into the primers, the two fragments of PDI gene and P2 promoter are fused by adopting a fusion PCR method, the fusion product is taken as the template, and P2-F1 and PDI-R1 are taken as the primers, so that the full-length fragment of P2-PDI is amplified by PCR, and the size is about 2kb.

The pPIC9k plasmid is used as a template, primers pPIC9k-F2 and pPIC9k-R2 are designed, a pPIC9k vector linear fragment is amplified, the recovered P2-PDI full-length fragment is connected with a vector pPIC9k vector linear, a vector is constructed as shown in figure 2, the connection product is transformed into competent cells of escherichia coli Top10, recombinant transformants are selected in a flat plate containing Amp (100 mug/mL) antibiotics, part of the transformants are picked up into LB+amp liquid medium, the culture is carried out for 3 hours at 37 ℃, bacterial liquid PCR verification is carried out by using P2-F1 and 3' AOX primers, the fragment size is about 2kb, the transformants are sent for sequencing, and the primer sequences are as follows:

PDI-F1：cctatttcaatcaattgaacaactatatgcaattcaactggaatattaaaactg

PDI-R1：gcaaatggcattctgacatcctcttgattaaagctcgtcgtgagcgtctgcc

P2-F1：gggaacactgaaaaataacagttattattcgaagatcttttttgtagaaatgtcttgg

P2-R1：atagttgttcaattgattgaaatagggttttaatattccagttgaattgcat

pPIC9k-F2：ggcagacgctcacgacgagctttaatcaagaggatgtcagaatgccatttgc

pPIC9k-R2：ccaagacatttctacaaaaaagatcttcatgttggtattgtgaaatagacgcagatct

3. BIP, VGB, HACI Gene and PDI Gene sequence analysis

Sequencing results were analyzed by biological analysis software Vector NTI, the open reading frame (Open Reading Frame, ORF) of BIP gene consisting of 2037 nucleotides, accession No. xm_002490982. Wherein, the start codon of the BIP gene is ATG, and the stop codon is TAG. The BIP gene encodes a 679 amino acid protein, and the theoretical molecular weight of the protein is predicted to be 74.3KDa.

The open reading frame (Open Reading Frame, ORF) of the VHB gene consists of 441 nucleotides, accession No. AY278220. Wherein, the start codon of the BIP gene is ATG, and the stop codon is TAA. The VHB gene encodes a 147 amino acid protein, and the theoretical molecular weight of the protein is predicted to be 15.9kDa.

The open reading frame (Open Reading Frame, ORF) of the HACI gene consists of 996 nucleotides, accession No. XM-002489994.1. Wherein, the initiation codon of the HACI gene is ATG and the termination codon is TGA. The HACI gene encodes a protein of 332 amino acids, predicted to have a theoretical molecular weight of 37.1KDa.

The open reading frame (Open Reading Frame, ORF) of the PDI gene consists of 1554 nucleotides, accession number EU805807. Wherein, the initiation codon of the PDI gene is ATG, and the termination codon is TAA. The PDI gene encodes a 518 amino acid protein, and the theoretical molecular weight of the protein is predicted to be 57.9kDa.

4. Construction of VectorBP, vectorVP, vectorHP

Designing primers vector B-F and vector B-R by taking successfully constructed vector B plasmid as a template, introducing a fusion region into the primers, and amplifying a linear vector fragment a by PCR; the linear fragment b was PCR amplified using the successfully constructed vector P plasmid as template and the P-F and P-R primers. The linear vector fragment a and the linear fragment b are fused by adopting a fusion PCR method, as shown in figure 3, a vector BP expression vector is constructed, a fusion circular plasmid is transformed into competent cells of escherichia coli Topl0, recombinant transformants are screened in a flat plate containing Amp (100 mug/mL) antibiotics, partial transformants are picked up into LB+amp liquid medium, the culture is carried out for 3 hours at 37 ℃, bacterial liquid is taken as a template, and verification primers AOX-F and P-R are used for amplifying a molecular chaperone complete expression frame, the fragment size is about 4.5kb, and the transformants are sent for sequencing.

VectorVP, vectorHP the construction method is described with reference to vector BP, the primer sequences are as follows:

VectorB-F：cacagttaaattgctaacgcagtcag

VectorB-R：ccaagacatttctacaaaaaagatcttctcacttaatcttctgtactctgaag

P-F：cttcagagtacagaagattaagtgagaagatcttttttgtagaaatgtcttgg

P-R：ctgactgcgttagcaatttaactgtg

AOX-F：gatctaacatccaaagacgaaaggttg

application of example 2 vector VectorBP, vectorVP, vectorHP in secretory expression of high-temperature-resistant phytase by pichia pastoris

(1) Expression of VectorBP, vectorVP, vectorHP in high temperature resistant phytase expression host V1

Cutting VectorBP, vectorVP, vectorHP, vectorB, vectorV, vectorH, vectorP carrier into linear DNA fragments by restriction enzyme, purifying VectorBP, vectorVP, vectorHP, vectorB, vectorV, vectorH, vectorP linear DNA fragments by a purification kit, respectively converting VectorBP, vectorVP, vectorHP, vectorB, vectorV, vectorH, vectorP linear DNA fragments into expression host V1 competent cells containing high temperature resistant phytase genes by an electrotransformation method, respectively constructing V11, V12, V13, V14, V15, V16 and V17 high temperature resistant phytase expression strains, coating the expression strains in YPD+G418 plates, reversely culturing for 3-4 days at 30 ℃, respectively picking about 300 single colonies into 2ml liquid BMGY culture medium, culturing for 24 hours at 30 ℃ at 200rpm, inducing and culturing for 24 hours by 1% methanol, collecting fermentation liquor, centrifuging, and obtaining supernatant as crude enzyme liquid.

(2) Screening of high-yield high-temperature-resistant phytase expression bacteria V11, V12, V13, V14, V15, V16 and V17

The phytase activity is defined as that the sample releases L pmol of inorganic phosphorus from sodium phytate per minute under the conditions that the concentration of sodium phytate is 5.0mmol/L, the temperature is 37 ℃ and the pH value is 5.5, namely, one phytase activity unit is expressed as U. The phytase activity was determined according to the national standard of China's national republic of people, GB/T18634-2002.

U＝FxC/(Vx30)

Wherein: the phytase activity in the U-sample, U/mL; c, calculating the enzyme activity according to a linear regression equation according to the light absorption value of the actual sample liquid, and U; f-total dilution factor of the sample solution before reaction; v-sample volume, mL; 30-reaction time, min.

The standard curve is formulated as in table 1:

phosphorus concentration (mmol/L)	0	1.5625	3.125	6.25	12.5	25
							OD value	0	0.0539	0.111	0.213	0.436	0.941

According to the national standard GB/T18634-2002, 263V 11, 212V 12, 237V 13, 273V 14, 232V 15, 257V 16 and 227V 17 transformants are respectively measured for enzyme activities of crude enzyme liquid phytase. The results show that the enzyme activities of 156V 11, 117V 12 and 132V 13 transformants are improved by more than 15% compared with the original strain; the enzyme activity of the V15 transformant is generally reduced, and the relative enzyme activity is 75% -95%; the enzyme activity of the V14, V16 and V17 transformants is not obviously improved, and the relative enzyme activity is between 95% and 105%. Compared with the co-expression of the independent chaperones BIP, VGB, HACI, PDI, the serial optimized chaperones BIP and PDI, VGB and PDI, HACI and PDI are more obvious in improvement of the enzyme activity of the V1 phytase, 10 transformants with the highest enzyme activity are screened respectively, the transformants with the most obvious improvement of the enzyme activity are screened again, finally, one transformant with the most obvious improvement of the enzyme activity is confirmed, the transformant contains the chaperone genes BIP and PDI which are connected in series and are named as V28-VTR-001, and compared with the original starting strain V1, the fermentation enzyme activity of the V28-VTR-001 phytase is improved by 27%. According to the construction method of VectorBP, vectorVP, vectorHP, 10 expression vectors such as PDI, SSAI, PDI, EROI, PDI, YDJI and the like are respectively constructed, and co-expression is carried out with an expression host V1, about 300 transformants of the VectorSP, vectorEP, vectorYP and other bimolecular partners are respectively subjected to 3 rounds of screening, and the result shows that the enzyme activity of the V1 phytase is slightly improved by the co-expression of the PDI and the EROI, the relative enzyme activity is about 107%, and the enzyme activity of the V1 phytase is generally reduced and the relative enzyme activity is between 53 and 97% when other molecular partners such as SSAI and the PDI are co-expressed. When BIP and PDI are co-expressed, the enzyme activity of the V1 phytase is improved most obviously, and the method is superior to the combination of BIP, PDI and other bimolecular chaperones, and the BIP and the PDI have obvious synergistic effect on the expression of the V1 phytase.

(3) High-density fermentation of high-temperature resistant phytase expression bacteria V28-VTR-001

The 50L fermentation test result shows that compared with the control V1, the fermentation enzyme activity of the V28-VTR-001 phytase is obviously improved, the tank release enzyme activity of the V28-VTR-001 phytase 209h is 37239U, and the fermentation enzyme activity is improved by 32.5% compared with the V1.

(4) Enzymatic Properties of high temperature resistant Phytase V28-VTR-001

As shown in FIG. 5, the V28-VTR-001 phytase has stable enzyme activity retention rate along with the temperature rise of heat treatment, the heat treatment is carried out for 5min at 80 ℃ and 85 ℃ in a water bath at 90 ℃, the enzyme activity loss rate is low, wherein the enzyme activity retention rate is more than 85% in the heat treatment in the water bath at 95 ℃ in 5min, and the excellent heat resistance ensures that the V28-VTR-001 phytase has higher enzyme activity retention rate in the post-treatment process, and reduces the waste of resources. As shown in FIG. 6, the optimum pH of V28-VTR-001 phytase is 4.5; the V28-VTR-001 phytase has good pH stability, and has high retention rate of enzyme activity after being treated for 4 hours under the buffer solution with the pH of 2.5-5.5, as shown in figure 7, and has high retention rate of enzyme activity under the acidic condition, so that the phytase can better play a role in animal intestinal tracts.

The V28-VTR-001 has high phytase fermentation enzyme activity, and the excellent acid resistance and heat resistance of the V28-VTR-001 phytase can effectively improve the release rate of phosphorus in soybean meal, corn and complete feed, improve the utilization rate of feed, reduce the pollution of phosphorus in feces to the environment, reduce the anti-nutritional effect of phytate, improve the absorption capacity of animals to proteins and trace elements, and have wide application value in the feed industry.

Sequence listing

<110> Guangdong Yiduoli Biotech stock Co., ltd

<120> molecular chaperone expression vector, strain for improving secretory expression of phytase in Pichia pastoris

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2037

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgctgtcgt taaaaccatc ttggctgact ttggcggcat taatgtatgc catgctattg 60

gtcgtagtgc catttgctaa acctgttaga gctgacgatg tcgaatctta tggaacagtg 120

attggtatcg atttgggtac cacgtactct tgtgtcggtg tgatgaagtc gggtcgtgta 180

gaaattcttg ctaatgacca aggtaacaga atcactcctt cctacgttag tttcactgaa 240

gacgagagac tggttggtga tgctgctaag aacttagctg cttctaaccc aaaaaacacc 300

atctttgata ttaagagatt gatcggtatg aagtatgatg ccccagaggt ccaaagagac 360

ttgaagcgtc ttccttacac tgtcaagagc aagaacggcc aacctgtcgt ttctgtcgag 420

tacaagggtg aggagaagtc tttcactcct gaggagattt ccgccatggt cttgggtaag 480

atgaagttga tcgctgagga ctacttagga aagaaagtca ctcatgctgt cgttaccgtt 540

ccagcctact tcaacgacgc tcaacgtcaa gccactaagg atgccggtct catcgccggt 600

ttgactgttc tgagaattgt gaacgagcct accgccgctg cccttgctta cggtttggac 660

aagactggtg aggaaagaca gatcatcgtc tacgacttgg gtggaggaac cttcgatgtt 720

tctctgcttt ctattgaggg tggtgctttc gaggttcttg ctaccgccgg tgacacccac 780

ttgggtggtg aggactttga ctacagagtt gttcgccact tcgttaagat tttcaagaag 840

aagcataaca ttgacatcag caacaatgat aaggctttag gtaagctgaa gagagaggtc 900

gaaaaggcca agcgtacttt gtcttcccag atgactacca gaattgagat tgactctttc 960

gtcgacggta tcgacttctc tgagcaactg tctagagcta agtttgagga gatcaacatt 1020

gaattattca agaagacact gaaaccagtt gaacaagtcc tcaaagacgc tggtgtcaag 1080

aaatctgaaa ttgatgacat tgtcttggtt ggtggttcta ccagaattcc aaaggttcaa 1140

caattattgg aggattactt tgacggaaag aaggcttcta agggaattaa cccagatgaa 1200

gctgtcgcat acggtgctgc tgttcaggct ggtgttttgt ctggtgagga aggtgtcgat 1260

gacatcgtct tgcttgatgt gaacccccta actctgggta tcgagactac tggtggcgtt 1320

atgactacct taatcaacag aaacactgct atcccaacta agaaatctca aattttctcc 1380

actgctgctg acaaccagcc aactgtgttg attcaagttt atgagggtga gagagccttg 1440

gctaaggaca acaacttgct tggtaaattc gagctgactg gtattccacc agctccaaga 1500

ggtactcctc aagttgaggt tacttttgtt ttagacgcta acggaatttt gaaggtctct 1560

gccaccgata agggaactgg aaaatccgag tccatcacca tcaacaatga tcgtggtaga 1620

ttgtccaagg aggaggttga ccgtatggtt gaagaggccg agaagtacgc cgctgaggat 1680

gctgcactaa gagaaaagat tgaggctaga aacgctctgg agaactacgc tcattccctt 1740

aggaaccaag ttactgatga ctctgaaacc gggcttggtt ctaaattgga cgaggacgac 1800

aaagagacat tgacagatgc catcaaagat accctagagt tcttggaaga caacttcgac 1860

accgcaacca aggaagaatt agacgaacaa agagaaaagc tttccaagat tgcttaccca 1920

atcacttcta agctatacgg tgctccagag ggtggtactc cacctggtgg tcaaggtttt 1980

gacgatgatg atggagactt tgactacgac tatgactatg atcatgatga gttgtag 2037

<210> 2

<211> 1554

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgcaattca actggaatat taaaactgtg gcaagtattt tgtccgctct cacactagca 60

caagcaagtg atcaggaggc tattgctcca gaggactctc atgtcgtcaa attgactgaa 120

gccacttttg agtctttcat caccagtaat cctcacgttt tggcagagtt ttttgcccct 180

tggtgtggtc actgtaagaa gttgggccct gaacttgttt ctgctgccga gatcttaaag 240

gacaatgagc aggttaagat tgctcaaatt gattgtacgg aggagaagga attatgtcaa 300

ggctacgaaa ttaaagggta tcctactttg aaggtgttcc atggtgaggt tgaggtccca 360

agtgactatc aaggtcaaag acagagccaa agcattgtca gctatatgct aaagcagagt 420

ttaccccctg tcagtgaaat caatgcaacc aaagatttag acgacacaat cgccgaggca 480

aaagagcccg tgattgtgca agtactaccg gaagatgcat ccaacttgga atctaacacc 540

acattttacg gagttgccgg tactctcaga gagaaattca cttttgtctc cactaagtct 600

actgattatg ccaaaaaata cactagcgac tcgactcctg cctatttgct tgtcagacct 660

ggcgaggaac ctagtgttta ctctggtgag gagttagatg agactcattt ggtgcactgg 720

attgatattg agtccaaacc tctatttgga gacattgacg gatccacctt caaatcatat 780

gctgaagcta acatcccttt agcctactat ttctatgaga acgaagaaca acgtgctgct 840

gctgccgata ttattaaacc ttttgctaaa gagcaacgtg gcaaaattaa ctttgttggc 900

ttagatgccg ttaaattcgg taagcatgcc aagaacttaa acatggatga agagaaactc 960

cctctatttg tcattcatga tttggtgagc aacaagaagt ttggagttcc tcaagaccaa 1020

gaattgacga acaaagatgt gaccgagctg attgagaaat tcatcgcagg agaggcagaa 1080

ccaattgtga aatcagagcc aattccagaa attcaagaag agaaagtctt caagctagtc 1140

ggaaaggccc acgatgaagt tgtcttcgat gaatctaaag atgttctagt caagtactac 1200

gccccttggt gtggtcactg taagagaatg gctcctgctt atgaggaatt ggctactctt 1260

tacgccaatg atgaggatgc ctcttcaaag gttgtgattg caaaacttga tcacactttg 1320

aacgatgtcg acaacgttga tattcaaggt tatcctactt tgatccttta tccagctggt 1380

gataaatcca atcctcaact gtatgatgga tctcgtgacc tagaatcatt ggctgagttt 1440

gtaaaggaga gaggaaccca caaagtggat gccctagcac tcagaccagt cgaggaagaa 1500

aaggaagctg aagaagaagc tgaaagtgag gcagacgctc acgacgagct ttaa 1554

<210> 3

<211> 441

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgttggatc aacagactat caacatcatc aaggctactg ttccagtctt gaaggaacat 60

ggtgttacta tcactactac tttctacaag aacttgtttg ctaagcatcc agaagttaga 120

ccattgtttg atatgggtag acaagaatct ttggaacaac caaaggcttt ggctatgact 180

gtcttggctg ctgctcagaa cattgagaac ttgccagcta tcttgccagc tgttaagaag 240

attgctgtta agcattgtca agctggtgtt gctgctgctc attacccaat tgttggtcaa 300

gaattgttgg gtgctatcaa ggaagtcttg ggtgatgctg ctactgatga tatcttggat 360

gcttggggta aggcttacgg tgttattgct gatgtcttca ttcaagttga agctgatttg 420

tacgctcaag ctgttgaata a 441

<210> 4

<211> 996

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgcccgtag attcttctca taagacagct agcccacttc cacctcgtaa aagagcaaag 60

acggaagaag aaaaggagca gcgtcgagtg gaacgtatcc tacgtaatag gagagcggcc 120

catgcttcca gagagaagaa acgaagacac gttgaatttc tggaaaacca cgtcgtcgac 180

ctggaatctg cacttcaaga atcagccaaa gccactaaca agttgaaaga aatacaagat 240

atcattgttt caaggttgga agccttaggt ggtaccgtct cagatttgga tttaacagtt 300

ccggaagtcg attttcccaa atcttctgat ttggaaccca tgtctgatct ctcaacttct 360

tcgaaatcgg agaaagcatc tacatccact cgcagatctt tgactgagga tctggacgaa 420

gatgacgtcg ctgaatatga cgacgaagaa gaggacgaag agttacccag gaaaatgaaa 480

gtcttaaacg acaaaaacaa gagcacatct atcaagcagg agaagttgaa tgaacttcca 540

tctcctttgt catccgattt ttcagacgta gatgaagaaa agtcaactct cacacattta 600

aagttgcaac agcaacaaca acaaccagta gacaattatg tttctactcc tttgagtctt 660

ccggaggatt cagttgattt tattaaccca ggtaacttaa aaatagagtc cgatgagaac 720

ttcttgttga gttcaaatac tttacaaata aaacacgaaa atgacaccga ctacattact 780

acagctccat caggttccat caatgatttt tttaattctt atgacattag cgagtcgaat 840

cggttgcatc atccagcagt gatgacggat tcatctttac acattacagc aggctccatc 900

ggctttttct ctttgattgg ggggggggaa agttctgtag cagggaggcg cagttcagtt 960

ggcacatatc agttgacatg catagcgatc aggtga 996

Claims (2)

1. A recombinant strain expressing phytase, wherein the recombinant strain has deposit No. GDMCC No.61456.

2. A method for producing phytase, characterized in that the method comprises the step of producing phytase by fermentation with the recombinant strain expressing phytase according to claim 1.