CN113528515A

CN113528515A - Technology for interfering and blocking reverse transcription transposition of virus based on CRISPR-Cas13a

Info

Publication number: CN113528515A
Application number: CN202010321800.9A
Authority: CN
Inventors: 李轩; 荆新云; 张牛冰; 朱艳
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2020-04-22
Filing date: 2020-04-22
Publication date: 2021-10-22
Anticipated expiration: 2040-04-22
Also published as: CN113528515B

Abstract

The invention provides a technology for interfering and blocking reverse transcription transposition of a reverse transcription organism based on CRISPR-Cas13 a. The invention discloses a technology for interfering and blocking reverse transcription and transposition of a reverse transcription organism based on CRISPR-Cas13a, a system for blocking reverse transcription and transposition of the reverse transcription organism in a eukaryotic cell and application thereof. In the present invention, Tf1 was studied and demonstrated as a model system of retrovirus. The technical scheme of the invention not only realizes the inhibition of reverse transcription transposition by using Cas13a for the first time, but also has ideal efficiency of blocking reverse transcription transposition.

Description

Technology for interfering and blocking reverse transcription transposition of virus based on CRISPR-Cas13a

Technical Field

The invention belongs to the field of virology, and particularly relates to a technology for interfering and blocking reverse transcription transposition of a virus based on CRISPR-Cas13 a.

Background

CRISPR (clustered Regularly Interspaced Short Palindromic repeats) is a Regularly clustered alternate Short Palindromic repeat, and is an acquired immune mode in most bacteria and archaea. In recent years, many molecular tools for knocking out a gene or introducing a mutation inside a gene using the CRISPR system have been successfully developed, but a tool capable of knocking out a gene or editing a gene at the RNA level is also urgently required.

CRISPRs have been used today as a tool for studying the inactivation of endogenous retroviruses against foreign retroviral pathogens and in organ transplantation. CRISPR-Cas9 is a system designed to combat animal and plant retroviral pathogens. The CRISPR-Cas9 can effectively inactivate potential HIV-1 in infected cells by targeting HIV-1 essential genes or LTRs, can target cytokines or HIV-1 genomes, reduces HIV-1 infection and eliminates provirus. A recently studied CRISPR-Cas9 inactivated Endogenous Retroviruses (ERVs) in pigs to create ERV inactivated animals for xenotransplantation.

However, with the progress of research, CRISPR-Cas9 has exposed its defects and limitations, such as poor inhibition effect, severe off-target effect, etc. In practical applications, the binding of CRISPR-Cas9 to the target is not precise, followed by the imprecise cleavage operation after the recognition sequence. For example, attempts by Chinese scientists to edit human embryos have found many non-specific cleavages, but have resulted in many mutations. Therefore, scientists are looking for new and more efficient gene editing systems while improving the accuracy of Cas9 protein.

In summary, although there are many applications of Cas9 for gene editing in the art, further research and exploration are urgently needed in the field of virus inhibition, especially the inhibition of retroviruses such as HIV, to develop more effective antiviral drugs. In addition, there is a lack in the art of test models for detecting the intracellular translocation of reverse transcribed organisms.

Disclosure of Invention

The invention aims to provide a technology for interfering and blocking the reverse transcription transposition of viruses based on CRISPR-Cas13 a.

In a first aspect of the invention, a system for blocking reverse transcription transposition of a reverse-transcribing organism in a eukaryotic cell is provided, comprising a Cas13a expression cassette and a crRNA expression cassette; wherein the crRNA targets an essential gene, a Long Terminal Repeat (LTR), or their adjacent regions of the reverse-transcribed organism.

In a preferred embodiment, the essential gene includes a gene selected from the group consisting of: structural genes, regulatory genes.

In another preferred embodiment, the structural or regulatory gene includes (but is not limited to): gag, PR, RT, IN, Env, Tat, Rev, Vpu, Nef, Vpr, or Vpx.

In another preferred example, in the system, the Cas13a expression cassette and the crRNA expression cassette are located in the same or different expression constructs (expression vectors); preferably, the two expression cassettes are located in different expression constructs, the Cas13a expression cassette is expressed integrated into the genome of the eukaryotic cell, and the crRNA expression cassette is expressed free in the eukaryotic cell.

In another preferred embodiment, said blocking reverse transcriptase transposition of a reverse transcriptase organism in a eukaryotic cell comprises: preventing the reverse transcribing organism from replicating and jumping in the eukaryotic cell through the reverse transcription step.

In another preferred embodiment, the reverse transcribing organism comprises: retroviruses (retroviruses), mimetibodies of retroviruses; preferably, the retroviral mimetic is retrotransposon Tf 1.

In another preferred embodiment, said retrotransposon Tf1 comprises: retrotransposable elements, screening genes for detecting retrotransposable events.

In another preferred embodiment, the retrotransposable element comprises an operably linked gene selected from the group consisting of: long Terminal Repeat (LTR), Gag, PR, RT, IN; the long terminal repeat includes a 5 'LTR and a 3' LTR.

In another preferred example, the selection gene is a resistance selection gene, a Marker gene (Marker gene) or a reporter gene; preferably, the resistance gene is Neo.

In another preferred embodiment, the marker genes include, but are not limited to: nat (nourseothricin, nourseothricin gene).

In another preferred embodiment, the reporter gene includes, but is not limited to: fluorescent proteins such as GFP, mCherry, luciferase, etc.

In another preferred embodiment, the selection gene is located upstream of the 3' LTR.

In another preferred embodiment, the selection gene is located adjacent to the long terminal repeat.

In another preferred embodiment, the retroviral mimetibody further comprises a promoter operably linked to the retrotransposon which drives transposition of the retrotransposon; preferably, the promoter is a regulatable promoter; more preferably, the regulatable promoter is nmt1 promoter, which is inhibited by thiamine.

In another preferred embodiment, the crRNA expression cassette comprises the following elements in operative linkage: direct repeat sequences (DR), gRNA; preferably, the crRNA expression cassette comprises the following elements in operative linkage: promoters, Direct Repeats (DR), grnas and ribozymes (HDVR); preferably, the promoter is rrk1 promoter.

In another preferred embodiment, the nucleotide sequence of the direct repeat sequence is shown as SEQ ID NO. 11, which is designed by the present inventors according to the design scheme of the present invention, and fully combines the characteristics of Cas13 a. The direct repeat sequence is connected with the gRNA and is used as an element of a crRNA expression cassette, so that the Cas13a protein and the crRNA are well combined, and the targeted cutting effect of the Cas13a/CrRNA is facilitated.

In another preferred embodiment, the structural or regulatory gene comprises Gag, and the crRNA targets position 306 or 360 of the Gag gene; more preferably, the gRNA is selected from: nucleotide sequences of 4 th to 31 th in the sequences shown in SEQ ID NO. 3 or 5, or reverse complementary sequences thereof.

In another preferred example, the Cas13a is Cas13a (LshCas13a) derived from trichoderma cilium (Leptotrichia shahii); preferably, when the eukaryotic cell is yeast, the Cas13a expression cassette is integrated into yeast chromosome II LEU1 site.

In a further aspect of the invention there is provided the use of a system as defined in any preceding claim for the preparation of a reagent (including research reagents) or composition (including pharmaceutical compositions) for blocking reverse transcription of a virus in a eukaryotic cell.

In a further aspect of the invention there is provided the use of a system as defined in any preceding claim for performing experimental tests on the transposition of a reverse transcribed organism in a eukaryotic cell or for preparing an experimental test system.

In another aspect of the invention, there is provided a method of blocking reverse transcription transposition of a reverse transcribing organism in a eukaryotic cell, comprising: (1) providing a system as described in any of the preceding; (2) introducing the system of (1) into a eukaryotic cell, whereby the eukaryotic cell has the ability to block reverse transcription and transposition of a reverse transcriptase.

In a preferred embodiment, the eukaryotic cell is a yeast cell, a plant cell, an animal cell; preferably, the yeast cell comprises a fission yeast cell.

In another aspect of the invention, there is provided a kit for blocking reverse transcription transposition of a reverse transcribing organism in a eukaryotic cell, comprising any of the systems described above.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, flow chart of plasmid construction of pDUAL-HFF1-LshCas13 a.

FIG. 2, flow chart of psk- (LshCas13a gRNA) -Tf1 plasmid construction.

FIG. 3 shows a flow chart of construction of pHL414- (LshCas13a gRNA) -Tf1 plasmid.

Fig. 4, transposition efficiency was counted based on a technique of CRISPR-Cas13a targeting transposition into a Tf1 RNA intermediate interfering transposition. Wherein, the upper diagram is a schematic diagram of an expression system for interfering and blocking the reverse transcription transposition of the virus based on CRISPR-Cas13 a; the lower panels show the results of colony formation assays for Tf1-835 and Tf 1-1165.

Detailed Description

Aiming at the current situation that the virus inhibition, particularly the retrovirus inhibition, is not successful enough in the prior art, the inventor of the invention discloses a technology for interfering and blocking the reverse transcription and transposition of a reverse transcription organism based on CRISPR-Cas13a, a system for blocking the reverse transcription and transposition of the reverse transcription organism in a eukaryotic cell and application thereof through intensive research. The technical scheme of the invention not only realizes the inhibition of reverse transcription transposition by using Cas13a for the first time, but also has ideal efficiency of blocking reverse transcription transposition.

Term(s) for

As used herein, the term "Retrotransposon (retrotransposonson)" refers to a transposon which transposes via RNA-mediated transformation, and which synthesizes mRNA by transcription, and then synthesizes a new element by reverse transcription to integrate into the genome to complete the transposition. Retroviruses and transposons replicate and hop in eukaryotic cells through a reverse transcription step. The "reverse transcription" may also be referred to as "reverse transcription".

As used herein, the term "reverse transcribing organism" refers to an organism, including a biological cell, that undergoes reverse transcription and transposition. In some preferred forms of the invention, the "reverse transcriptase" is a retrovirus or a mimic of a retrovirus. Unless otherwise indicated, the "retroviral mimetibody" is a retrotransposon of the LTR class, which has a structure and transposition pattern similar to those of retroviruses. In a more specific form of the invention, the retroviral mimetic is retrotransposon Tf 1.

As used herein, the "guide rna (crrna) sequence" is a sequence complementary to the reverse of the edited site-targeting sequence.

As used herein, the "crRNA" is a functional molecule that performs a targeted cleavage; preferably, it requires two parts to function: (1) a gRNA sequence portion and (2) a DR sequence portion that interacts with Cas13a, both of which constitute a crRNA expression cassette; DR allows good binding of Cas13a protein to crRNA.

As used herein, the "screening gene for detecting a retrotransposition event" refers to a gene having a reporter function or being capable of being detected artificially as to the presence or absence of a retrotransposition event. For example, it may be some resistance selection gene or a gene that exhibits color development or fluorescence after its expression.

The term "operably linked" or "operably linked" refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: the promoter region is placed in a specific position relative to the nucleic acid sequence of the gene of interest such that transcription of the nucleic acid sequence is directed by the promoter region, whereby the promoter region is "operably linked" to the nucleic acid sequence.

As used herein, the term "element" refers to a series of functional nucleic acid sequences useful for the expression of a protein, and in the present invention, is systematically constructed to form an expression construct. The sequence of the "element" may be those provided in the present invention, and also includes variants thereof, as long as the variants substantially retain the function of the "element", which are obtained by inserting or deleting some bases (e.g., 1 to 50 bp; preferably 1 to 30bp, more preferably 1 to 20bp, still more preferably 1 to 10bp), or by random or site-directed mutagenesis, or the like.

As used herein, the term "expression cassette" refers to a gene expression system comprising all the necessary elements required for expression of a protein of interest, typically including the following elements: promoter, gene sequence for coding protein and terminator. In addition, resistance elements, selection elements or reporter elements may optionally be included, which are operably linked.

As used herein, a "retrovirus" is a virus that undergoes retrotransposition. For example, such retroviruses include (but are not limited to): retroviruses include (but are not limited to): human Immunodeficiency Virus (HIV), Endogenous Retroviruses (ERVs), human T-lymphocyte virus (HTLV), and the like.

As used herein, "blocking" includes "inhibiting", "blocking", and the like.

System for blocking reverse transcription transposition and application thereof

In the invention, a system for interfering and blocking the reverse transcription transposition of the virus in eukaryotic cells (including yeast cells) is established based on CRISPR-Cas13 a. The Cas13a has the function of targeting single-stranded rna (ssrna). Cas13a can bind to a specific targeted ssRNA under the guidance of crRNA and cleave the ssRNA. In a preferred form of the invention, using the LshCas13a protein from ciliate bacteria (Leptotrichia shahii), the inventors have found that it has a precise editing function when used in the system of the invention.

The invention relates to a system for blocking reverse transcription transposition of a reverse transcription organism in a eukaryotic cell, which comprises a Cas13a expression cassette and a crRNA expression cassette.

Although the Cas13a protein and the Cas9 protein belong to CRISPR families, the structures and molecular weights of the proteins are different; meanwhile, the two mechanisms of action are also very different. Because the two have great difference, the gene editing principle, the intracellular working mode and the editing result of the two also have obvious difference, and the two can not be mutually applied or effect inference can not be carried out.

In a preferred form of the invention, a subspecies of the Cas13a protein is used, namely LshCas13a derived from trichoderma cilium (Leptotrichia shahii), the amino acid sequence of which may be as shown in GenBank accession No. WP _018451595.1, or a conservative variant polypeptide thereof. By "conservative variant polypeptide" is meant a polypeptide that retains substantially the same biological function or activity as the polypeptide. The "conservative variant polypeptide" may be (i) a polypeptide in which one or more (e.g., 1-50, 1-30, 1-20, 1-10, or 1-5) conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide formed by fusing the mature polypeptide to another compound, such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol, or (iv) a polypeptide formed by fusing an additional amino acid sequence to the polypeptide sequence (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein formed with an antigen IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

In the present invention, the crRNA targets several gene targets, including: essential genes, Long Terminal Repeats (LTRs), and the like of the reverse-transcribed organism, or their adjacent regions.

Examples of the essential genes of the reverse transcribed organism include, but are not limited to, structural genes thereof, regulatory genes thereof, and the like. Such as but not limited to: gag, PR, RT, IN, Env, Tat, Rev, Vpu, Nef, Vpr, Vpx, and the like. The essential gene may be different depending on the kind of the reverse-transcribed organism. It is more preferable to target a gene located between two LTRs, and more particularly, a gene located in the vicinity of the LTRs. For example, in the present embodiment, the targeted gene is disposed at a position between the essential gene and the LTR.

The Cas13a expression cassette and the crRNA expression cassette may be in the same expression construct (expression vector) or in different expression constructs. As a preferred mode of the invention, in the system, the two expression cassettes are located in different expression constructs, the Cas13a expression cassette is expressed integrated into the genome of the eukaryotic cell, and the crRNA expression cassette is expressed freely in the eukaryotic cell. This arrangement facilitates stable expression and accurate blocking of reverse transcription transposition of a reverse transcribing organism within a eukaryotic cell.

The system for blocking retrotransposition established by the invention can effectively prevent a retroorganism (retrovirus or transposon) from replicating and jumping in eukaryotic cells through a reverse transcription step. In particular embodiments of the invention, intervention in the retrotranspositions of the deterrent viruses/transposons by inducing simultaneous expression of Cas13a and crRNA is achieved, and high efficiency of suppressing retrotranspositions is achieved.

The system for blocking reverse transcription transposition established by the invention can be prepared into a kit for blocking reverse transcription transposition of a reverse transcription organism in eukaryotic cells, thereby being convenient for people to use. Preferably, the kit may further comprise an application instruction and the like.

Test system for blocking reverse transcription transposition and application thereof

In order to accurately understand the blocking effect of the system of the invention on reverse transcription, after intensive research, the inventors also establish a test system for blocking reverse transcription transposition.

The test system for blocking retrotransposition contained retrotransposon Tf 1. Tf1 is a retrotransposon from Schizosaccharomyces pombe (Schizosaccharomyces pombe) encoding a long polyprotein flanked by 385 base Long Terminal Repeats (LTRs). LTR retrotransposons and retroviruses share many common features in terms of genomic structure, replication machinery and life cycle. Both LTR retrotransposons and retroviruses replicate by reverse transcription and propagate by integration into the host genome, which is dependent on the host's transcriptional and translational machinery. Tf1 and retroviruses both use RNA as intermediates, and synthesize mRNA by transcription, and then synthesize new elements by reverse transcription, which are integrated into the genome to complete the interference to the host genome. Therefore, LTR retrotransposons can be used as an effective model for studying retroviruses. In a preferred form of the invention, a plasmid pHL414 which expresses Tf1 in fission yeast cells is selected and modified.

As a preferred mode of the present invention, the Tf1 includes a retrotransposable element (which may include LTR, Gag, PR, RT, IN at both ends) and a selection gene for detecting retrotransposable events. In some embodiments, the direction of transcription of the screening gene may be opposite to the retrotransposon; preferably, the crRNA targets cleavage Gag or other essential elements; when both Cas13a and crRNA are expressed, the cells expressing the screening gene are those undergoing reverse transcription, and the rest are those in which reverse transcription is inhibited.

In a more preferred embodiment, the promoter driving expression of the retrotransposable element is regulatable (e.g., inducible or repressible). Using this system, the present inventors can controllably regulate the expression of the retrotransposition system (for example, using a regulatable promoter such as nmt1, which is repressed by thiamine and can express when thiamine is withdrawn), and reverse transposition occurs; meanwhile, Cas13a and crRNA are expressed, and the change condition of reverse transcription transposition is observed.

The test system of the present invention can be tested in eukaryotic cells, such as yeast cells. In the specific embodiment of the invention, fission yeast cells are used as a platform for technology development, a technology for interfering and blocking the reverse transcription transposition of viruses/transposons based on CRISPR-Cas13a is provided, and the specific operation method is as follows:

(1) expression of CRISPR-Cas13a protein

The invention selects a second type VI CRISPR effector protein Cas13a, and the Cas13a has the functions of combining and cutting ssRNA. The invention constructs a vector for expressing LshCas13a protein. In a preferred embodiment of the invention, the expression vector established is pDUAL-HFF1-LshCas13 a. Then, the plasmid is linearized and transformed into fission yeast, and the LshCas13a protein expression cassette is inserted into LEU1 locus of yeast chromosome II by utilizing homologous recombination, so that a yeast strain for expressing a single copy of the LshCas13a gene in a yeast genome is generated. Schizosaccharomyces cerevisiae is cultured by using an MM medium so as to express the LshCas13a protein.

(2) Construction of CRRNA (short palindromic repeats) -Cas13 a-based RNA target cleavage and establishment of transposon model system

The invention selects a schizosaccharomyces three-type promoter rrk1, and the DR sequence of CRISPR-Cas13a is behind the promoter, and the function of the promoter is to combine Cas13a protein with crRNA; a gRNA space occupying sequence (place holder with BspQI) is accessed behind the DR sequence, and the gRNA can be connected to a BspQI enzyme cutting site; the position of gRNA insertion is followed by a ribozyme (HDVR) that cleaves itself at the 5' end; this design can produce grnas with accurate sequences.

Constructing an intermediate vector pSK- (LshCas13a gRNA) -target for expressing the gRNA, which specifically comprises the following steps: the expression cassette for crRNA was cloned into the expression plasmid pHL414 vector for retrotransposon Tf1, resulting in pHL414- (lshca 13a gRNA) -target plasmid.

Thereafter, pHL414- (LshCas13a gRNA) -target plasmid was transformed into a schizosaccharomyces-derived strain (containing the integrated expressed LshCas13a protein). By inducing simultaneous expression of Cas13a and crRNA, cleavage of intermediate RNA interferes with the reverse transposition of the stopped virus/transposon.

By using the established retrotransposon model system, the inventor quantitatively determines the transposition efficiency of the retrotransposon Tf1, and knows the interference efficiency of CRISPR-Cas13a on the transposition activity of Tf1 by targeting Tf1 RNA intermediate, and determines the condition that the retrotransposition is blocked (inhibited).

The test system for blocking reverse transcription transposition established by the invention can be prepared into a kit for blocking reverse transcription transposition of a reverse transcription organism in eukaryotic cells, thereby being convenient for people to use. Preferably, the kit may further comprise an application instruction and the like.

The CRISPR-Cas13 a-based RNA editing technology of the present invention inhibits the retrotransposition activity of viruses/transposons. The technology can be used for carrying out operation and interfering the blocking of the transposition of retrovirus and the infection amplification, and provides an effective means for the intervention and treatment of retrovirus (such as HIV) diseases.

The positive progress effects of the invention are as follows:

(1) the invention provides a new action mechanism for the interference of retrovirus pathogens by using the CRISPR-Cas13a technology for the first time, and the target gene is disabled by targeting the RNA intermediate (the RNA transcript in the reverse transcription process). There is no precedent in the art to use CRISPR-Cas13a to successfully interfere with the reverse transposition of deterrent viruses/transposons.

(2) In the invention, a CRISPR-Cas13 a-based DNA editing technology is used for constructing and implementing a CRISPR-Cas13a gene editing system in eukaryotic cells (fission yeast is taken as an example) for the first time, and has a remarkable effect on the efficiency of the retrotransposon of the virus/transposon which intervenes to stop.

(3) The DNA editing technology based on CRISPR-Cas13a of the invention obviously inhibits the transposition activity of virus/retrotransposon in eukaryotic cells (fission yeast matrix is taken as an example). Meanwhile, the technology can be used for carrying out operation and research of interfering retrovirus, and an effective tool is provided for research of RNA virus.

(4) The technical scheme of the invention has simple operation method, is superior to similar tools such as CRISPR-Cas9 and the like, and has higher blocking efficiency.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Materials and methods

pC001 plasmid: see, Abudayyeh, o.o.et al.c. 2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effect. science 353, aaf5573 (2016).

psk- (LshCas13a gRNA) backbone plasmid: see, king, x.et al.implantation of the CRISPR-Cas13a system in positioning and reusing for precision RNA editing. nucleic Acids res.46,90 (2018). In the backbone plasmid, the DR sequence is: ccaccccaatatcgaaggggactaaaac (SEQ ID NO: 11). The inventor finds that the DR sequence is connected with gRNA, so that the DR sequence is very suitable for enabling Cas13a protein to be well combined with crRNA, and is beneficial to the targeted cutting effect of Cas13 a/CrRNA.

pHL414-2 plasmid: see Garcia-pirz, j.l. transposons and Retrotransposons (Humana Press, 2016).

Example 1 expression of CRISPR-Cas13a protein in eukaryotic cells

The establishment of a cell expression system for expressing the CRISPR-Cas13a protein and a method for expressing the CRISPR-Cas13a protein in eukaryotic cells are as follows:

1. construction of vector pDAAL-HFF 1-LshCas13a for expressing LshCas13a protein

As shown in FIG. 1, a segment of the coding sequence LshCas13a is obtained by PCR amplification of a C2C2-NcoI-P5 (sequence TATGCATCACCACCATCATCATATGGGGAACCTGTTCGGACACAAG (SEQ ID NO:1)) and a C2C2-NcoI-P3 primer (sequence TCATCGTCGTCCTTGTAGTCCATGGTTACAGGGTATCGTTAGTATTCT (SEQ ID NO:2)) pair from a pC001 plasmid; the plasmid is inserted into a plasmid pDUAL-HFF1 to obtain a recombinant plasmid pDUAL-HFF1-LshCas13 a.

2. Transformation of plasmids

pDAAL-HFF 1-LshCas13a was linearized and the linear fragment was transformed into Schizosaccharomyces. 500ng of linear pDAAL-HFF 1-LshCas13a fragment was transformed into schizosaccharomyces cells in early logarithmic growth phase by lithium acetate/PEG/heat shock method and the LshCas13a gene was integrated into the LEU1 site of the yeast genome.

3. Protein expression

The fission yeast transformed with the recombinant plasmid is cultured by using an MM medium so as to express the LshCas13a protein.

Example 2 expression of grnas targeting CRISPR-Cas13a retrotransposon Tf1 RNA intermediate in eukaryotic cells

Through repeated studies, the inventors optimized gRNA targeting Tf1 RNA intermediate, targeting the Gag gene of Tf1, which has the following sequence (SEQ ID NO: 12):

5’-atgaaaaactcatcacagaaaagaattcgaatggatggaaatggtggatattgtactcaagatgatatttcagatatccttaagcattttgtaaatcaaaccacccgccatgtggaaacgtatagaaaaggcatggatatggaagagttcatcgttaaattaagaacattttttggtgaacattccgatagatattcaactgaacagtctaaaagactgtacgctatagaacgacttgaatcaagagatcaaaattatgctaataaaatcttttgtcaagattcttctcttacttgggatgaactattaagaagaatggtaaacctagttggatctgatgaagaagaaaggttgactaaaacctttttgaaacttaagaatgataaggacaaggtactattcattaagaaagtactctatgaagataatttaagtgagaaacgagtcagattatatctactatggatgcttccaccctatctgattaaacagagaggtgattcttactgggacatggataaaaatatagacaagatttttaactttgtaccagataaaggtgaaacgataattgaacgctacaccaaacctaggaatcttttaaaaacaaagactggaagcaattggaaaaacaataagtttttaaaggagaacgacactaaagatcgaaaaccaaagaaaacaaatgtttcaaggatcgaatactcatctgaaaattttacaaaatacaagaaaagacgttatgaaa-3’

wherein, starting from the 5' -end, the 306 th and 360 th positions of the nucleic acid are targeted editing sites.

The gRNA was prepared as follows:

1. primers were designed to target the grnas of the Tf1 RNA intermediate for a total of 3 pairs (2 targets and 1 non-target) with the following sequences (the first 3 bases in the following sequences are bases matching the backbone plasmid):

targeting Gag gene in retrotransposon Tf1 at position 306 (i.e.cleavage between positions 306-307):

Tf1-gRNA-P5(835)：AAC atccaactaggtttaccattcttcttaa(SEQ ID NO:3)；

Tf1-gRNA-P3(835)：GCC ttaagaagaatggtaaacctagttggat(SEQ ID NO:4)；

targeting behind Gag gene position 630 in retrotransposon Tf1 (i.e.cleavage between positions 630-631):

Tf1-gRNA-P5(1165)：AAC Tgtcgttctcctttaaaaacttattgtt(SEQ ID NO:5)；

Tf1-gRNA-P3(1165)：GCC aacaataagtttttaaaggagaacgaca(SEQ ID NO:6)；

Tf1-gRNA-P5(Control)：ACC cagactatgcgtcgacaagccaggcatt(SEQ ID NO:7)；

Tf1-gRNA-P3(Control)：GCC aatgcctggcttgtcgacgcatagtctg(SEQ ID NO:8)。

2. construction of plasmid pSK- (LshCas13a gRNA) -Tf1

Primers were synthesized based on the Tf1-gRNA-P5 and Tf1-gRNA-P3 primer sequences provided above, respectively, and annealed to form Tf1-gRNA, which was inserted into BspQI-digested pSK- (LshCas13a gRNA) backbone plasmid to obtain pSK-Tf1-gRNA-28bp-835 plasmid, pSK-Tf1-gRNA-28bp-1165 plasmid, or pSK-Tf1-gRNA-28bp-Control plasmid, as shown in FIG. 2.

3. Cloning the expression cassette of gRNA to the expression plasmid pHL414 vector of retrotransposon Tf1

As shown in fig. 3, primers NheI-TYB-P5 and NheI-TYB-P3 were used to amplify the gRNA expression cassette targeting Tf1 gene from the aforementioned pSK-Tf1-gRNA-28bp-835 plasmid, pSK-Tf1-gRNA-28bp-1165 plasmid, or pSK-Tf1-gRNA-28bp-Control plasmid, respectively; inserted into Nhe digested pHL414-2 plasmid to generate pHL414-Tf1-28bp- (LshCas13a gRNA) -835, pHL414-Tf1-28bp- (LshCas13a gRNA) -1165, pHL414-Tf1-28bp- (LshCas13a gRNA) -Control target plasmids respectively. These target plasmids are abbreviated as pHL414- (LshCas13a gRNA) -Tf1 plasmid.

NheI-TYB-P5：gggggatcccagctggctagcaattaaccctcactaaagg(SEQ ID NO:9)；

NheI-TYB-P3：tcactatggcgtgctgctagctaatacgactcactatagg(SEQ ID NO:10)。

The previously established pHL414- (LshCas13a gRNA) -Tf1 plasmid was transformed into the schizosaccharomyces derivative strain (containing the integrally expressed LshCas13a protein) prepared in the previous example 1. 100ng pHL414- (LshCas13a gRNA) -Tf1 plasmid was transformed into the initial log phase of fission yeast cells by lithium acetate/PEG/heat shock method, leaving the plasmid free.

Example 3 CRISPR-Cas13a interference retrotransposon Tf1 RNA intermediate effect test in eukaryotic cells such as fission yeast

In this embodiment, the established CRISPR-Cas13 a-based model system for interfering in blocking viral reverse transcription transposition is used to verify the effect of interfering transposition.

The experimental procedure was as follows:

1. transgenic fission yeast cells (3 in total) expressing the LshCas13a protein, episomally expressing the gRNA-Tf1 plasmid, established in the previous example, were cultured on MM + Thiamine (Thiamine; 10. mu.M) plates for 4 days at 32 ℃. Thiamine inhibits the nmt1 promoter from promoting the transposition of Tf 1.

2. Transposition activity of retrotransposon Tf1 was qualitatively determined

(1) Picking single clones on MM + Thiamine plate, streaking to PMG + Thiamine (10. mu.M) plate and incubating for 3 days;

(2) colonies were then transferred to PMG plates (Thianmie was removed to initiate transcription and transposition) and allowed to grow for 4 days;

(3) then transferring the colony to a plate containing PMG +5-FOA + Uracil + Thiamine (removing free plasmid), and growing for 3 days;

(4) finally, the colonies were transferred to plates containing YES +5-FOA + Uracil + G418. Transposition activity of Tf1 was monitored by observing whether derivative yeast strains containing 2 target (targeting Tf1-835, Tf1-1165 sites) and 1 non-target (Tf1-control) episomal plasmid designed by the inventors on G418 plates could continue to grow.

3. Quantitative measurement of transposition frequency of retrotransposon Tf1

(1) Selecting single clone on MM + Thiamine transformation plate and transferring to PMG + Thiamine (10 μ M) plate to incubate for 3 days;

(2) picking single clones and using initial Optical Density (OD)₆₀₀) 0.05 transfer to liquid PMG medium (Thianmie removed sufficiently to initiate transcription and transposition) and grow the culture at 32 ℃ for 4 days at 200 rpm;

(3) inoculation of a volume of culture into PMG +5-FOA + Uracil liquid Medium, with initial OD₆₀₀0.1 the culture was started for 36 h.

(4) The culture was then used 10⁷、10⁶And 10⁵Each cell/mL was subjected to gradient dilution, and then 100. mu.L of the gradient dilution was inoculated onto YES +5-FOA or YES +5-FOA + G418 plates, respectively, and cultured at 32 ℃ for 2 to 3 days.

(5) The number of single colonies formed on both plates was counted and the frequency of retrotransposition of Tf1 was estimated by comparing the number of colonies on the plates containing G418+5-FOA and the plates containing only 5-FOA.

Transposition frequency (%) - (plate clone number +5-FOA + G418) × 100/(YES plate clone number +5-FOA) × dilution difference (dilution differentiation)

Colony formation assay results for Tf1-835 and Tf1-1165 are shown in the lower panel of fig. 4, and Tf1-835 exhibits a significantly reduced frequency of reverse translocation compared to control (1% ± 0.033%), with 16% inhibition of Tf1 translocation; the effect of Tf1-1165 on reversing translocation frequency was relatively more pronounced, with a 60% inhibition of Tf1 translocation.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> China academy of sciences molecular plant science remarkable innovation center

<120> technology for interfering and blocking reverse transcription transposition of virus based on CRISPR-Cas13a

<130> 202258

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 46

<212> DNA

<213> primers (Primer)

<400> 1

tatgcatcac caccatcatc atatggggaa cctgttcgga cacaag 46

<210> 2

<211> 48

<212> DNA

<213> primers (Primer)

<400> 2

tcatcgtcgt ccttgtagtc catggttaca gggtatcgtt agtattct 48

<210> 3

<211> 31

<212> DNA

<213> primers (Primer)

<400> 3

aacatccaac taggtttacc attcttctta a 31

<210> 4

<211> 31

<212> DNA

<213> primers (Primer)

<400> 4

gccttaagaa gaatggtaaa cctagttgga t 31

<210> 5

<211> 31

<212> DNA

<213> primers (Primer)

<400> 5

aactgtcgtt ctcctttaaa aacttattgt t 31

<210> 6

<211> 31

<212> DNA

<213> primers (Primer)

<400> 6

gccaacaata agtttttaaa ggagaacgac a 31

<210> 7

<211> 31

<212> DNA

<213> primers (Primer)

<400> 7

acccagacta tgcgtcgaca agccaggcat t 31

<210> 8

<211> 31

<212> DNA

<213> primers (Primer)

<400> 8

gccaatgcct ggcttgtcga cgcatagtct g 31

<210> 9

<211> 40

<212> DNA

<213> primers (Primer)

<400> 9

gggggatccc agctggctag caattaaccc tcactaaagg 40

<210> 10

<211> 40

<212> DNA

<213> primers (Primer)

<400> 10

tcactatggc gtgctgctag ctaatacgac tcactatagg 40

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(28)

<223> DR sequence

<400> 11

ccaccccaat atcgaagggg actaaaac 28

<210> 12

<211> 748

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(748)

<223> Gag Gene

<400> 12

atgaaaaact catcacagaa aagaattcga atggatggaa atggtggata ttgtactcaa 60

gatgatattt cagatatcct taagcatttt gtaaatcaaa ccacccgcca tgtggaaacg 120

tatagaaaag gcatggatat ggaagagttc atcgttaaat taagaacatt ttttggtgaa 180

cattccgata gatattcaac tgaacagtct aaaagactgt acgctataga acgacttgaa 240

tcaagagatc aaaattatgc taataaaatc ttttgtcaag attcttctct tacttgggat 300

gaactattaa gaagaatggt aaacctagtt ggatctgatg aagaagaaag gttgactaaa 360

acctttttga aacttaagaa tgataaggac aaggtactat tcattaagaa agtactctat 420

gaagataatt taagtgagaa acgagtcaga ttatatctac tatggatgct tccaccctat 480

ctgattaaac agagaggtga ttcttactgg gacatggata aaaatataga caagattttt 540

aactttgtac cagataaagg tgaaacgata attgaacgct acaccaaacc taggaatctt 600

ttaaaaacaa agactggaag caattggaaa aacaataagt ttttaaagga gaacgacact 660

aaagatcgaa aaccaaagaa aacaaatgtt tcaaggatcg aatactcatc tgaaaatttt 720

acaaaataca agaaaagacg ttatgaaa 748

Claims

1. A system for blocking reverse transcription transposition of a reverse-transcribed organism in a eukaryotic cell, comprising a Cas13a expression cassette and a crRNA expression cassette;

wherein the crRNA is targeted to an essential gene, a long terminal repeat, or their adjacent regions of the reverse transcribed organism.

2. The system of claim 1, wherein said essential genes comprise genes selected from the group consisting of: structural genes, regulatory genes.

3. The system of claim 2, wherein the structural or regulatory genes comprise: gag, PR, RT, IN, Env, Tat, Rev, Vpu, Nef, Vpr, or Vpx.

4. The system of claim 1, wherein in the system, the Cas13a expression cassette and the crRNA expression cassette are in the same or different expression constructs; preferably, the two expression cassettes are located in different expression constructs, the Cas13a expression cassette is expressed integrated into the genome of the eukaryotic cell, and the crRNA expression cassette is expressed free in the eukaryotic cell.

5. The system of claim 1, wherein blocking reverse transcription of a reverse transcribing organism in a eukaryotic cell comprises: preventing the reverse transcribing organism from replicating and jumping in the eukaryotic cell through the reverse transcription step.

6. The system of any one of claims 1 to 5, wherein the reverse transcribed organism comprises: retroviruses, mimetibodies of retroviruses; preferably, the retroviral mimetic is retrotransposon Tf 1.

7. The system of claim 6, wherein said retrotransposon Tf1 comprises: retrotransposable elements, screening genes for detecting retrotransposable events.

8. The system of claim 7, wherein the retrotransposable element comprises an operably linked gene selected from the group consisting of: long terminal repeat, Gag, PR, RT, IN; the long terminal repeat includes a 5 'LTR and a 3' LTR.

9. The system of claim 7, wherein the selection gene is a resistance selection gene, a marker gene, or a reporter gene; preferably, the resistance gene is Neo.

10. The system of claim 7, wherein said retroviral mimetibody further comprises a promoter operably linked to said retrotransposon, which drives transposition of said retrotransposon; preferably, the promoter is a regulatable promoter; more preferably, the regulatable promoter is nmt1 promoter, which is inhibited by thiamine.

11. The system of claim 1, wherein the crRNA expression cassette comprises the following elements in operative linkage: direct repeat sequence, gRNA; preferably, the crRNA expression cassette comprises the following elements in operative linkage: a promoter, direct repeat, gRNA, and ribozyme; preferably, the promoter is rrk1 promoter; preferably, the nucleotide sequence of the direct repeat sequence is shown as SEQ ID NO. 11.

12. The system of claim 3 or 11, wherein the structural or regulatory gene comprises Gag and the crRNA targets Gag gene at position 306 or 360; more preferably, the gRNA is selected from: nucleotide sequences of 4 th to 31 th in the sequences shown in SEQ ID NO. 3 or 5, or reverse complementary sequences thereof.

13. The system of claim 1, wherein the Cas13a is Cas13a derived from rhizoctonia shahii (Leptotrichia shahii); preferably, when the eukaryotic cell is yeast, the Cas13a expression cassette is integrated into yeast chromosome II LEU1 site.

14. Use of a system according to any one of claims 1 to 13 for the preparation of an agent or composition for blocking retrotransposition of a virus in a eukaryotic cell; or

The method is used for carrying out experimental test of transposition of reverse transcription organisms in eukaryotic cells or preparing an experimental test system.

15. A method of blocking reverse transcription transposition of a reverse transcribing organism in a eukaryotic cell, comprising:

(1) providing a system according to any one of claims 1 to 13;

(2) introducing the system of (1) into a eukaryotic cell, whereby the eukaryotic cell has the ability to block reverse transcription and transposition of a reverse transcriptase.

16. The use according to claim 14 or the method according to claim 15, wherein the eukaryotic cell is a yeast cell, a plant cell, an animal cell; preferably, the yeast cell comprises a fission yeast cell.

17. A kit for blocking reverse transcriptase transposition in a eukaryotic cell by a reverse transcriptase organism, comprising the system of any one of claims 1 to 13.