CN113527502B

CN113527502B - Nano antibody recombinant protein for treating rheumatoid arthritis

Info

Publication number: CN113527502B
Application number: CN202110817014.2A
Authority: CN
Inventors: 林仪芮; 陈逸媛; 陈昱翰; 黄超; 陈妍; 张旭韬
Original assignee: Fujian Medical University
Current assignee: Fujian Medical University
Priority date: 2021-07-20
Filing date: 2021-07-20
Publication date: 2023-01-17
Anticipated expiration: 2041-07-20
Also published as: CN113527502A

Abstract

The invention discloses a nano antibody recombinant protein for treating rheumatoid arthritis, which belongs to the field of genetic engineering, and is characterized in that the nano antibody recombinant protein is formed by fusing sequences of camel source anti-TNF-alpha and anti-human serum protein nano antibodies together through flexible connecting peptide, and the amino acid sequence of the nano antibody recombinant protein is shown as SEQ ID No.1 or comprises an amino acid sequence which has at least 80%, 85%, 90%, 95%, 98% or 99% of identity with the SEQ ID No.1 and has the same function; the invention provides an anti-TNF-alpha nano antibody recombinant protein which can be used for preventing or treating rheumatoid arthritis and has the advantages of safety, reliability and strong specificity.

Description

Nano antibody recombinant protein for treating rheumatoid arthritis

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a nano antibody recombinant protein for treating rheumatoid arthritis.

Background

Rheumatoid Arthritis (RA) is a chronic inflammatory and destructive joint disease that affects 0.5-1% of the population in the industrialized world and often causes significant disability that reduces the quality of life of patients.

Angiogenesis in the synovium of patients with RA is considered an important early step in pathogenesis and perpetuation of disease (Taylor, 2002). As in neoplastic diseases, angiogenesis promotes dilation of the synovium (Walsh et al, 1998). Vascular growth is likely to contribute to the proliferation of inflammatory synovium pannus and to the entry of inflammatory leukocytes into synovial tissue. Synovium of patients with RA contains increased amounts of fibroblast growth factor-2 (FGF-2) and Vascular Endothelial Growth Factor (VEGF) (Koch, 2003). Serum VEGF concentrations correlate with disease activity and decrease when synovitis can be successfully inhibited by therapy (Taylor, 2002).

Tumor necrosis factor alpha (TNF α) is a multifunctional cytokine, is involved in important physiological processes such as apoptosis, survival, inflammatory response, and immune response of cells, and plays an important role in the development of diseases such as rheumatoid arthritis, crohn's disease, and psoriasis (psoriatic). Therefore, TNF α is considered to be a very important target for drug development for the treatment of the above-mentioned related diseases. Infliximab (infliximab), adalimumab (adalimumab), golimumab (golimumab) and the like are therapeutic anti-TNF α antibodies, show remarkable curative effects and safety in treating diseases such as RA and the like, and are one of the most popular drugs worldwide, and research and development of other therapeutic anti-TNF α antibodies are hot.

In the early 90 s of the 20 th century, the Hamers group discovered that camelid organisms were able to process two different types of immunoglobulins simultaneously, one being a classical antibody consisting of a two-domain light chain and a four-domain heavy chain, and the other being a naturally light chain-deficient antibody comprising only one heavy chain variable region (VHH) and two conventional CH2 and CH3 regions, but not as readily attached to each other or even aggregated into a mass as an artificially engineered single chain antibody fragment (scFv). More importantly, the structure of the VHH which is cloned and expressed separately has the structural stability which is equivalent to that of the original heavy chain antibody and the binding activity with antigen, and is the minimum unit which is known to bind with the target antigen. The VHH crystal is 2.5nm, 4nm long and has a molecular weight of only 15KDa, so the VHH crystal is also called a Nanobody (Nb).

Disclosure of Invention

The invention aims to provide a nano-antibody recombinant protein for treating rheumatoid arthritis, which aims to solve the problems in the prior art and fuse sequences of camel-derived anti-TNF-alpha and anti-Human Serum Albumin (HSA) nano-antibodies together through flexible connecting peptide to form an anti-TNF-alpha nano-antibody (TNF 50) with stronger biological activity.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a nano antibody recombinant protein, which is characterized in that sequences of camel anti-TNF-alpha and anti-human serum protein nano antibodies are fused together through flexible connecting peptide to form a fusion antibody, and the amino acid sequence of the fusion antibody is shown as SEQ ID No.1 or comprises an amino acid sequence which has at least 80%, 85%, 90%, 95%, 98% or 99% of identity with the SEQ ID No.1 and has the same function.

The invention also provides a nucleotide for encoding the nano antibody recombinant protein.

Further, the nucleotide sequence is shown as SEQ ID No. 2.

The invention also provides an expression vector comprising the nucleotide or a nucleotide sequence which has at least 80%, 85%, 90%, 95%, 98% or 99% identity with SEQ ID No.2 and encodes the same protein.

The invention also provides a genetic engineering expression bacterium, which comprises the vector.

Further, the genetically engineered bacterium is escherichia coli Rosetta (DE 3).

The invention also provides a construction method of the genetic engineering expression strain, which comprises the steps of connecting the nucleotide to pET-22b or pET-28a escherichia coli expression plasmid, constructing and obtaining the expression vector, transforming the expression vector into the escherichia coli, and screening to obtain the genetic engineering expression strain for expressing the nano antibody recombinant protein.

The invention also provides a pharmaceutical composition, which comprises the nano antibody recombinant protein and at least one pharmaceutically acceptable excipient.

Further, at least one pharmaceutically acceptable adjuvant is also included.

The pharmaceutical composition may comprise any number of excipients. Excipients that may be used include carriers, surfactants, thickening or emulsifying agents, solid binders, dispersing or suspending aids, stabilizers, colorants, flavorants, coatings, disintegrants, lubricants, sweeteners, preservatives, isotonic agents, and combinations thereof.

The primary vehicle or carrier in the pharmaceutical composition may be aqueous or non-aqueous in nature. For example, a suitable vehicle or carrier may be water for injection, saline, or artificial cerebrospinal fluid, which may be supplemented with other materials common in injections. For example, the vehicle or carrier may be a neutral buffered saline solution or a saline solution mixed with serum albumin. Other exemplary pharmaceutical compositions comprise Tris buffer, or acetate buffer, which may also comprise sorbitol or a suitable substitute thereof. In one embodiment of the invention, the composition may be prepared for storage by mixing the selected component with the desired purity with any formulation, either in lyophilized or aqueous solution form. In addition, the therapeutic composition can be formulated as a lyophilizate using suitable excipients such as sucrose.

Preferably, the pharmaceutical composition is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or bolus injection). Depending on the route of administration, the active molecule may be encapsulated in a material to protect it from the action of acids and other natural conditions that may inactivate it.

The invention also provides application of the nano antibody recombinant protein, the nucleotide, the expression vector, the genetic engineering expression bacterium or the pharmaceutical composition in preparation of drugs for treating rheumatoid arthritis.

The invention discloses the following technical effects:

the invention provides an anti-TNF-alpha nano antibody recombinant protein which can be used for preventing or treating rheumatoid arthritis and has the advantages of safety, reliability and strong specificity.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows two expression plasmids pET22-TNF50 and pET28-TNF50 constructed according to the present invention;

FIG. 2 shows the expression of TNF50 according to the invention;

FIG. 3 shows the sequence verification of the TNF50 protein of the present invention;

FIG. 4 shows the optimization of the culture medium of the present invention;

FIG. 5 is a graph showing TNF50 activity assays of the present invention.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including but not limited to.

Example 1

1. Designing and constructing an anti-TNF-alpha nano antibody and a gene engineering expression bacterium thereof, comprising the following steps:

obtaining of the TNFR 50 nucleic acid coding sequence

(1) The sequence of the camel-derived anti-TNF-alpha and anti-Human Serum Albumin (HSA) nano antibody is fused together through flexible connecting peptide to obtain the anti-TNF-alpha nano antibody (TNF 50) sequence with stronger biological activity;

(2) Translating the obtained sequence into a nucleotide sequence according to a standard amino acid codon table;

(3) Nucleotide sequences encoding TNF50 were synthesized.

2. Synthesis of primers

In total, 4 primers were designed and synthesized as follows:

EC01：ATCGAAGGTCGTGAAGTTCAACTTGTTGAATCAGG；

EC02：GCGAGGAGCTCATTATGATGAAACAGTAACAAGAG；

EC03：AACTTCACGACCTTCGATGCCGCTGCTGTGATGATG；

EC04：AGCTACATCACTCAGACTTCAGCAACCGCACCTGTG。

construction of TNFR 50 prokaryotic expression vector

To construct the TNF50 prokaryotic expression plasmids pET22-TNF50 and pET28-TNF50, we first synthesized the required primers, designated EC01, EC02, EC03 and EC04, respectively, where EC01 and EC04 contain the homologous sequence Xa.

(1) Amplifying a fragment PT7-Xa by using a plasmid pET28a as a template through primers EC03 and EC 04;

(2) Amplifying a fragment Xa-TNF50 by using a primer EC01 and an EC02 by using the synthesized TNF50 nucleotide sequence as a template;

(3) The fragments PT7-Xa and Xa-TNF50 are used as a common template, and the fragments PT7-TNF50 are amplified through primers EC02 and EC 04;

(PT 7-TNF50 contains 6 important elements-important promoter PT7, restriction enzyme recognition site of Nco I, 6xHistag tag sequence, protease Xa recognition site, target gene sequence TNF50, sac I restriction enzyme recognition site)

(4) The fragments PT7-TNF50, plasmids pET22b and pET28a were treated with restriction enzymes NcoI and SacI for 1 hour, respectively;

(5) Purifying the treated fragments and linear plasmids by agarose gel, and quantifying by a thermo ultraviolet nucleic acid protein quantifier;

(6) According to the molar ratio: the ligation reaction mixture was prepared in the manner of plasmid =1 and 3;

(7) Transforming the ligated ligation mixture into competent cells of E.coli DH 5. Alpha.;

(8) Selecting dozens of monoclonals from a transformation plate with white colonies for colony PCR;

(9) Selecting part of the positive clones obtained in the step (8), inoculating the selected positive clones into a test tube containing 5mL of LB culture medium, adding 5 mu L of ampicillin sodium salt solution (pET 22 b) or kanamycin sulfate solution (pET 28 a), placing the mixture into a shaking table for culturing at 37 ℃,220rpm and staying overnight;

(10) Extracting plasmids;

(11) Treating each tube of the extracted plasmid with restriction enzymes EcoRI and EcoRV and performing nucleic acid electrophoresis;

(12) Selecting part of the positive clones obtained in the step (11), and sending the positive clones to Beijing Jinwei Zhi Biotechnology limited company for sequencing; transferring the plasmid with correct sequencing into Escherichia coli Rosetta (DE 3);

(the primers used in the sequencing reaction are universal primers-T7 promoter and T7 terminator)

(13) Inoculating a positive clone of each of the two expression plasmids according to the step (9), adding an Inducer (IPTG) to a final concentration of 1mM when OD600 is 0.6, and then placing the mixture in a shaker for continuous culture for 7 hours at 30 ℃ and 220rpm;

(14) Collecting two thalli containing expression plasmids in each 1 mL-1.5 mL EP tube, centrifuging at 12000rpm for 2min at normal temperature;

(15) Discarding the supernatant, adding 1mL PBS, slightly blowing and suspending, and repeating the centrifugation operation in the step (14);

(16) Repeating the rinsing operation of the step (15);

(17) Carefully pipette off the supernatant, add 45 μ L PBS and 5 μ L5X protein loading buffer, and boil in boiling water for 10min;

(18) Taking 20 mu L of the sample in the step (17), loading the sample into 15% polyacrylamide gel prepared in advance, and starting electrophoresis; electrophoresis conditions: running concentrated glue at 70V and separating glue at 140V;

(19) Stopping electrophoresis, cutting separation gel, and performing Coomassie brilliant blue color development on a piece of gel; the other block carries out western-blot detection analysis according to the following steps;

4. purification and quantification of TNF 50.

5. TNF50 interaction with human TNF- α. The interaction of TNF50 with its target, human TNF-. Alpha.can be detected by immunoblotting.

6. TNF50 mL shake flask culture optimization

7. And (3) detecting the biological activity of TNF 50.

Carrageenan is a mucopolysaccharide in the cell wall of red algae, is an anionic linear polymer molecule consisting of 1,3 alpha-1, 4 beta galactose, and is divided into three configurations of kappa (1), iota (2) and lambda (3) according to the difference of sulfur contained in each monomer, wherein the former two configurations converge to form a helical structure to form a hard or soft jelly respectively, while carrageenan in the lambda configuration does not aggregate to a helical structure and is in a non-coagulated state in a solution. The animals developed inflammatory symptoms of edema, pain and erythema immediately after subcutaneous injection of carrageenan. The molecular mechanism of the injection is that carrageenan induces cells to generate stress molecules such as histamine, bradykinin, tachykinin, active oxygen, nitric oxide and the like, the molecules can recruit neutrophils to an injected site, and then the cells can secrete proinflammatory factors including TNF-alpha, so that inflammation is induced. According to the invention, the mouse ankle swelling is caused by the lambda carrageenan, and the biological activity of the prepared TNF50 is evaluated by measuring the ankle swelling degree. The specific method comprises the following steps:

(1) 40 SPF-grade KM mice, approximately 30 g each, half female and half male per group, were housed separately;

(2) After adapting to the environment for one week, the mice were evenly divided into 5 groups by weight, each group being half female and male;

(3)

Mice

1 and 2 were injected intraperitoneally with 200. Mu.L of PBS, group 3 with 50. Mu.L of 120mg/mL aspirin solution, mice 4 with 200. Mu.L of 5mg/mL TNF 50-containing PBS, and mice 5 with 200. Mu.L of 10mg/mL TNF 50-containing PBS;

(3) Half an hour later, injecting 25 mu L of PBS solution into the right hind leg ankle of the first group of mice, and injecting 25 mu L of PBS solution containing 1% lambda carrageenan into the right hind leg ankle of each of the other mice;

(4) Measuring the diameter of the ankle of the hind leg of the mouse by a vernier caliper every 1 hour after injection, and repeating the measurement for two times;

(5) The degree of toe swelling of the mice for each measurement was calculated and the changes in each group were plotted uniformly on the same "swelling-time" table. After the experiment is finished, the experimental part is taken for section analysis.

As a result:

FIG. 1 shows two expression plasmids pET22-TNF50 and pET28-TNF50 constructed according to the present invention. 10 transformants in the pET22-TNF50 transformation plate and 30 transformants in the pET28-TNF50 transformation plate are randomly picked respectively for PCR verification, blank agar near the transformants is used as a template of negative control, and as a result, 30 transformants all amplify fragments with the same target band size, but the negative fragments are not changed (FIG. 1 a). Further, 5 transformants of pET22-TNF50 and 5 transformants of pET28-TNF50 verified by PCR were selected for culture and plasmid extraction, and restriction map analysis was performed using EcoRI and EcoRV restriction enzymes, and the results showed that the plasmids from 10 transformants all cut the target bands belonging to the positive clones. Finally, three of each type of transformants were selected for DNA sequencing, which showed sequence identity to the target sequence (FIG. 1 b).

FIG. 2 shows the expression of TNF50 according to the invention. Coli Rosetta (DE 3) was used as the expression host for TNF50, since the sequence was not optimized according to the codon preference of e. After the constructed plasmids pET22-TNF50 and pET28-TNF50 are transformed into Rosetta (DE 3), the plasmids are respectively subjected to induction culture, and the expression of target protein is detected by SDS-PAGE and Western-blot. The results showed that both plasmids were successfully expressed in their expression hosts (fig. 2a, fig. 2 b).

FIG. 3 shows the sequence of the TNF50 protein of the present invention. To further determine the correctness of the sequence, mass spectrometric identification was performed. A single band of the target sequence was obtained by solid phase metal affinity purification and SDS-PAGE. Then, the band was cut off and sent to the analysis and test center of the institute of biomedical science and technology (Tianjin, china) for protein mass spectrometry. And detecting six peptide segments matched with the target sequence by result, wherein the coverage rate reaches 64 percent), and basically proving that the detected protein is the target protein.

Purification and quantification of TNF50 protein was performed. TNF50, which has His tag at the N-terminus, passes through the solid phase Co ²⁺ And (5) affinity chromatography purification. And finally, the optimal concentration of imidazole in the rinsing solution is determined to be 70mM through rinsing condition optimization, the collected elution peaks are subjected to buffer solution replacement and concentration by using an ultrafiltration tube, SDS-PAGE electrophoresis is carried out, the purity of the elution peaks is detected to be 95%, and the concentration of the concentrated protein is determined to be 10mg/mL through Bradford and BCA kit quantification.

FIG. 4 shows the optimization of the culture medium of the present invention. 9 kinds of colibacillus culture medium are selected to culture TNF50 expressing host bacteria so as to select relative optimum culture medium. The same initial inoculum was inoculated into 9 media and then cultured under the same conditions. Then, 1mL of the cells in each culture was collected and subjected to lysis and SDS-PAGE. The results show that almost no TNF50 was detected in M9 (FIG. 4 a), and therefore was discarded by subsequent data processing. In the data processing, the absolute expression level of TNF50 and the relative expression level of each cell in the most common Escherichia coli culture medium (i.e., high-salt LB) are used as reference, and the two results obtained in the other culture media are divided by the corresponding results obtained in the High-salt LB. The results showed that SB medium was optimal in both index comparisons (fig. 4b, fig. 4 c), so SB medium was used in the next optimization of culture conditions.

FIG. 5 is a graph showing TNF50 activity assays of the present invention. Firstly, the binding activity of TNF50 and human TNF alpha in vitro is detected through an immunoblotting experiment; then, the antagonistic activity of TNF50 against mouse TNF α in vivo was examined by swelling of mouse ankle with lambda carrageenan.

Human TNF-. Alpha.was developed in three lanes by SDS-PAGE during immunoblotting. Next, the three protein bands were transferred to NC membranes. Then, cutting three strips on the film, and respectively processing: the strip 1 is sealed and then incubated with an anti-His tag primary antibody, and then incubated with a secondary antibody; the strip 2 is incubated with TNF50 after being closed, then incubated with anti-His tag primary antibody, and finally incubated with secondary antibody; lane 3. Guanidine hydrochloride gradient rinse (this enables refolding of the protein on the membrane, bringing linearly distant amino acids of the peptide chain close to each other in three dimensions to prevent disruption of the epitope on SDS-PAGE electrophoresis), guanidine hydrochloride concentration is reduced from 6M to 0M, half of each time to below 0.5, rinsed with PBS, post-blocked, then incubated with TNF50, then incubated with anti-His tag primary antibody, and finally with secondary antibody. Finally, the three processed films were simultaneously subjected to infrared scanning. The results show that lane 1 has no color bands and

lanes

2 and 3 both have color bands (FIG. 5 a), indicating that TNF50 binds to human TNF α in vitro.

In animal experiments, two modes of intraperitoneal administration and leg administration are selected. Group 1 (pbs + pbs): injecting sterile pbs200 mu L into the abdominal cavity of the mouse, and injecting sterile pbs 25 mu L into the right leg half an hour later; group 2 (pbs + pbs): injecting 200 mu L of sterile pbs into the abdominal cavity of the mouse, and injecting 25 mu L of sterile 1 percent carrageenan solution into the right leg after half an hour; group 3 (pbs + pbs): injecting 200 mu L of sterile low-dose TNF50 (5 mg/mL) into the abdominal cavity of a mouse, and injecting 25 mu L of sterile 1% carrageenan solution into the right leg after half an hour; group 4 (pbs + pbs): injecting 200 mu L of sterile high-dose TNF50 (10 mg/mL) into the abdominal cavity of a mouse, and injecting 25 mu L of sterile 1% carrageenan solution into the right leg after half an hour; group 5 (pbs + pbs): 50 mu L of sterile aspirin solution (ASP, 120 mg/mL) is injected into the abdominal cavity of the mouse, and 25 mu L of sterile 1% carrageenan solution is injected into the right leg after half an hour. The diameter of the swollen part of the leg was measured every 1 hour after each group was administered, and then the experimental results were processed to finally obtain the corresponding statistical tables and statistical graphs (fig. 5b, fig. 5 c). The results indicate that TNF50 is able to antagonize the activity of mouse TNF α in vivo.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Fujian medical university

<120> a nano antibody recombinant protein for treating rheumatoid arthritis

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 239

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr

20 25 30

Trp Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Glu Ile Asn Thr Asn Gly Leu Ile Thr Lys Tyr Pro Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Ser Pro Ser Gly Phe Asn Arg Gly Gln Gly Thr Leu Val Thr

100 105 110

Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Glu Val Gln Leu

115 120 125

Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Asn Ser Leu Arg Leu

130 135 140

Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Phe Gly Met Ser Trp

145 150 155 160

Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Ile Ser

165 170 175

Gly Ser Gly Ser Asp Thr Leu Tyr Ala Asp Ser Val Lys Gly Arg Phe

180 185 190

Thr Ile Ser Arg Asp Asn Ala Lys Thr Thr Leu Tyr Leu Gln Met Asn

195 200 205

Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr Cys Thr Ile Gly Gly

210 215 220

Ser Leu Ser Arg Ser Ser Gln Gly Thr Leu Val Thr Val Ser Ser

225 230 235

<210> 2

<211> 717

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaagttcaac ttgttgaatc aggtggtggt cttgttcaac caggtggttc acttcgtctt 60

tcatgtgctg cttcaggttt tactttttca gattattgga tgtattgggt tcgtcaagct 120

ccaggtaaag gtcttgaatg ggtttcagaa attaatacta atggtcttat tactaaatat 180

ccagattcag ttaaaggtcg ttttactatt tcacgtgata atgctaaaaa tactctttat 240

cttcaaatga attcacttcg tccagaagat actgctgttt attattgtgc tcgttcacca 300

tcaggtttta atcgtggtca aggtactctt gttactgttt catcaggtgg tggtggttca 360

ggtggtggtt cagaagttca acttgttgaa tcaggtggtg gtcttgttca accaggtaat 420

tcacttcgtc tttcatgtgc tgcttcaggt tttacttttt catcatttgg tatgtcatgg 480

gttcgtcaag ctccaggtaa aggtcttgaa tgggtttcat caatttcagg ttcaggttca 540

gatactcttt atgctgattc agttaaaggt cgttttacta tttcacgtga taatgctaaa 600

actactcttt atcttcaaat gaattcactt cgtccagaag atactgctgt ttattattgt 660

actattggtg gttcactttc acgttcatca caaggtactc ttgttactgt ttcatca 717

Claims

1. An anti-TNF-alpha nano antibody is characterized in that the anti-TNF-alpha nano antibody is formed by fusing sequences of camel source anti-TNF-alpha and anti-human serum protein nano antibodies together through flexible connecting peptide; the amino acid sequence of the anti-TNF-alpha nano antibody is shown in SEQ ID No.1, and the nucleotide sequence of the anti-TNF-alpha nano antibody is shown in SEQ ID No. 2.

2. A nucleic acid encoding the anti-TNF- α nanobody of claim 1.

3. An expression vector comprising the nucleic acid of claim 2.

4. A genetically engineered expression bacterium comprising the expression vector of claim 3.

5. The genetically engineered expression strain of claim 4, wherein the genetically engineered strain is Escherichia coli

Rosetta(DE3)。

6. The method for constructing the genetically engineered expression strain of claim 4 or 5, wherein the nucleic acid of claim 2 is connected to an escherichia coli expression plasmid pET-22b or pET-28a to construct an expression vector of claim 3, the expression vector is transformed into escherichia coli, and the genetically engineered expression strain expressing the nano antibody recombinant protein is obtained through screening.

7. A pharmaceutical composition comprising the anti-TNF- α nanobody of claim 1 and at least

A pharmaceutically acceptable excipient.

8. The pharmaceutical composition of claim 7, further comprising at least one pharmaceutically acceptable adjuvant

And (3) preparing.

9. Use of the anti-TNF- α nanobody of claim 1, the nucleic acid of claim 2, the expression vector of claim 3, the genetically engineered expression bacterium of any one of claims 4 to 5, or the pharmaceutical composition of any one of claims 7 to 8 in the preparation of a medicament for the treatment of rheumatoid arthritis.