CN113527481B

CN113527481B - Anti-human NKX3.1 monoclonal antibody and preparation method and application thereof

Info

Publication number: CN113527481B
Application number: CN202110797621.7A
Authority: CN
Inventors: 柴素真; 宋辉; 张楠; 常秋霜; 王迎利; 张倩; 曹晓菲; 刘文弟; 齐华
Original assignee: Henan Celnovtebio Biotechnology Inc
Current assignee: Henan Celnovtebio Biotechnology Inc
Priority date: 2021-07-14
Filing date: 2021-07-14
Publication date: 2022-06-24
Anticipated expiration: 2041-07-14
Also published as: CN113527481A

Abstract

The invention relates to an anti-human NKX3.1 monoclonal antibody and a preparation method and application thereof. The invention provides an anti-human NKX3.1 monoclonal antibody, and further provides variable region amino acid sequences of a heavy chain and a light chain thereof, and on the basis, the antibody can be prepared by a conventional genetic engineering method. Compared with the traditional monoclonal antibody preparation method, the anti-human NKX3.1 recombinant antibody prepared by the genetic engineering method has the advantages of known sequence, stable antibody property, good repeatability and the like, can specifically identify human NKX3.1 protein, and can be used for IHC immunohistochemical detection. And the standardized antibody production flow avoids risk factors in the traditional monoclonal antibody production and storage process. Furthermore, on the basis of the amino acid sequence of the antibody provided by the invention, one or more amino acid additions, deletions, substitutions and other modifications can be adopted to obtain an active fragment or a conservative variant thereof, thereby laying a foundation for further improving the specificity and the affinity of the antibody.

Description

Anti-human NKX3.1 monoclonal antibody and preparation method and application thereof

Technical Field

The invention belongs to the technical field of immunology, and particularly relates to an anti-human NKX3.1 monoclonal antibody, and a preparation method and application thereof.

Background

The human NKX3.1cDNA has a total length of 3263bp and 2 exons. The exon I has 96 amino acids, and no obvious functional region is found; exon II includes its homologous domain, which contains 28 amino acid residues at its N-terminus and 53 amino acid residues at its C-terminus. Human and murine NKX3.1 proteins are identical at the homeodomain, and their expression is androgen regulated. The coding region of the human NKX3.1 gene is located at 8P21 and encodes 1 protein consisting of 234 amino acids. NKX3.1 is linked to the gene coding regions of macrophage phagosome II MSR2, lipoprotein LPL and neurofilament light chain. Research results show that the NKX3.1 gene is expressed in various human prostate tissues and testis, is not expressed in other tissues such as stomach, lung, kidney and the like, and the expression strength in the testis is obviously lower than that of the prostate tissues, which shows that the NKX3.1 has high prostate tissue specificity.

NKX3.1 is highly localized to be expressed in prostate cancer and normal prostate tissue, normal testis is low-level expressed, partial breast cancer tissue is expressed, the tissue distribution is more limited than PSA, and the prostate epithelial tissue specificity is high. NKX3.1 is a prostate cancer marker that is more sensitive than PSA, PSAP in determining the primary site of metastatic tumors; low expression of NKX3.1 is a typical feature of human prostate cancer and prostatic intraepithelial neoplasia, whereas anti-NKX 3.1 negative staining is common in urinary epithelial cancers. NKX3.1 may be used as an adjunct to differentiate high grade prostate cancer from high grade invasive urothelial cancer.

The currently prepared NKX3.1 monoclonal antibody mostly adopts prokaryotic expression NKX3.1 full-length recombinant protein for immunization, and has the advantages of fewer types, high price and improvement on specificity and stability. Moreover, the traditional preparation method of the monoclonal antibody is not favorable for standardized production, and the antibody has large batch-to-batch difference and poor stability.

Disclosure of Invention

The purpose of the present invention is to provide an anti-human NKX3.1 monoclonal antibody.

The second objective of the invention is to provide the application of the anti-human NKX3.1 monoclonal antibody.

The third purpose of the invention is to provide NKX3.1 immunohistochemical detection reagent.

The fourth object of the present invention is to provide a nucleic acid molecule comprising the gene encoding the monoclonal antibody, and an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium comprising the nucleic acid molecule.

The fifth purpose of the invention is to provide the application of the nucleic acid molecule, the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacterium.

The sixth object of the present invention is to provide a method for producing an anti-human NKX3.1 monoclonal antibody.

In order to achieve the purpose, the invention adopts the following technical scheme:

an anti-human NKX3.1 monoclonal antibody comprising an amino acid sequence as set forth in SEQ ID NO: 1-3, and

VLCDRs

1, 2, and 3, and

VLCDRs

1, 2, and 3, the amino acid sequences of which are set forth in SEQ ID NOs 4-6.

It is obvious to those skilled in the art that, based on the heavy and light chain variable region amino acid sequences of the monoclonal antibody specifically disclosed in the present invention, one or more amino acid additions, deletions, substitutions and other modifications can be made by conventional protein engineering methods to obtain conservative variants or fragments thereof, while still maintaining specific binding to the NKX3.1 protein.

Preferably, the monoclonal antibody comprises an amino acid sequence as set forth in SEQ ID NO: 7 and a light chain variable region with the amino acid sequence shown as SEQ ID NO. 8.

Preferably, the monoclonal antibody comprises a nucleotide sequence as set forth in SEQ ID NO: 9 and a light chain variable region with the nucleotide sequence shown as SEQ ID NO. 10.

The anti-human NKX3.1 monoclonal antibody is applied to preparation of NKX3.1 in-vitro immunoassay reagents or kits.

An NKX3.1 immunohistochemical detection reagent, which comprises the anti-human NKX3.1 monoclonal antibody. The reagent or the kit containing the reagent can be used for in vitro immunodetection of the expression condition of NKX3.1 in tissue cells.

A nucleic acid molecule comprising a gene sequence encoding the above anti-human NKX3.1 monoclonal antibody. Preferably, the gene sequence of the heavy chain variable region of the anti-human NKX3.1 monoclonal antibody is shown in SEQ ID NO: 9 is shown in the figure; the gene sequence of the variable region of the light chain of the anti-human NKX3.1 monoclonal antibody is shown as SEQ ID NO: shown at 10.

The antibody nucleic acid molecule can be obtained by using genetic engineering recombination technology or chemical synthesis method. It is obvious to those skilled in the art that the variable sequences of the heavy chain variable region nucleotide sequence and/or the light chain variable region nucleotide sequence obtained after the above-mentioned nucleic acid molecules provided by the present invention are mutated by one or more nucleotide additions, deletions, substitutions, modifications, etc., and the single-chain antibody or chimeric monoclonal antibody or modified monoclonal antibody or other forms of monoclonal antibody or antibody fragment consisting of the encoded amino acid sequences still retain the ability to specifically bind to the NKX3.1 protein.

An expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium containing the nucleic acid molecule.

Preferably, the recombinant expression vector is selected from prokaryotic or eukaryotic expression vectors; further, the recombinant expression vector is selected from the group consisting of bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, and other vectors.

Preferably, the expression system is a bacterial, yeast, filamentous fungus, mammalian cell, insect cell, plant cell or cell-free expression system.

The application of the nucleic acid molecule or the expression cassette, the recombinant vector, the recombinant cell or the recombinant bacterium in preparing the anti-human NKX3.1 antibody.

The invention provides the variable region amino acid sequences of heavy chains and light chains of anti-human NKX3.1 monoclonal antibodies, and on the basis, the monoclonal antibodies can be obtained by adopting a conventional genetic engineering method.

A preparation method of an anti-human NKX3.1 monoclonal antibody comprises the following steps: introducing the nucleic acid molecule into a host cell.

The invention has the following beneficial effects:

the immunogen adopted by the preparation of the anti-human NKX3.1 monoclonal antibody is a recombinant protein NKX3.1-A and NKX3.1-B obtained by selecting two parts of truncated sequences of the head and the tail of NKX3.1 on the basis of combining the characteristics of homeobox protein sequences and purifying through prokaryotic expression, and experiments prove that the truncated antigen can realize the expected immune effect. The invention adopts a mixed immunization mode to improve the immune hit rate on NKX 3.1.

The present invention also provides the variable region amino acid sequences of the heavy and light chains of the anti-human NKX3.1 monoclonal antibody, on the basis of which the monoclonal antibody of the present invention can be obtained by conventional antibody engineering methods (see example 6). Experiments prove that the obtained anti-human NKX3.1 recombinant antibody can specifically recognize human NKX3.1 protein and can be used for IHC immunohistochemical detection. Compared with the traditional monoclonal antibody preparation method, the anti-human NKX3.1 recombinant antibody prepared by the genetic engineering method has the advantages of known sequence, stable antibody property, good repeatability and the like, and the risk factors in the production and storage processes of the traditional monoclonal antibody are avoided by the standardized antibody production process. Furthermore, on the basis of the amino acid sequence of the antibody provided by the invention, one or more amino acid additions, deletions, substitutions and other modifications can be adopted to obtain an active fragment or a conservative variant thereof, thereby laying a foundation for further improving the specificity and the affinity of the antibody.

Drawings

FIG. 1 shows the results of Westernblot assay of the anti-human NKX3.1 monoclonal antibody obtained in example 2 of the present invention;

in the figure, M: marker; 1: sp2/0 cell lysate; 2: LNCaP cell lysate.

FIG. 2 shows immunohistochemistry results for NKX3.1 monoclonal antibody obtained in example 2 of the present invention, and the detected tissue is prostate (200X);

FIG. 3 shows the immunohistochemistry results of NKX3.1 monoclonal antibody obtained in example 2 of the present invention, and the tissue was determined to be breast (200X);

FIG. 4 shows immunohistochemistry results of NKX3.1 monoclonal antibody obtained in example 2 of the present invention, and the detected tissue is testis (200X);

FIG. 5 shows the Westernblot results of the recombinant anti-human NKX3.1 antibody obtained in example 6 of the present invention, wherein the samples are human prostate tissue lysate and LNCaP cell lysate;

in the figure, left lane: marker; middle lane: human prostate tissue lysate; lane on right: LNCaP cell lysate.

FIG. 6 shows the immunohistochemistry results for anti-human NKX3.1 recombinant antibody.

Detailed Description

The invention will be further described with reference to specific embodiments, but the scope of the invention is not limited thereto; the instruments and equipment involved in the following examples are conventional instruments and equipment unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods mentioned are conventional unless otherwise specified.

EXAMPLE 1 preparation of immunogen

1. NKX3.1 head and tail selection

Head and tail sequences were selected according to the NKX3.1 sequence and structure published by Uniprot for fusion expression of NKX 3.1. The accession number of Uniprot of human NKX3.1 is Q99801, and contains 234 amino acids, wherein 1-123 is the head part, 124-183 is the rod part, 184-234 is the tail part, and the head amino acid and the nucleic acid sequence are respectively shown in SEQ ID NO: 11 and 12, and the tail amino acid and nucleic acid sequences are respectively shown as SEQ ID NO: 13 and 14.

2. Fusion expression and purification

1) Artificially synthesizing the head and tail nucleic acid sequences of NKX3.1, introducing enzyme cutting sites NdeI and XhoI at the two ends of the sequences, cloning the synthesized product into a pET-28a expression vector, and constructing the pET-28a-NKX3.1-A, pET-28a-NKX3.1-B expression vector.

2) The recombinant plasmid constructed above was transformed into BL21(DE3) and competent Escherichia coli, and a single colony was cultured in 4mL of LB liquid medium containing kanamycin (50. mu.g/mL), and then expression analysis was performed by adding IPTG at a final concentration of 1mM, and a strain capable of expressing the target protein was stored.

3) The above-mentioned strain capable of expressing the target protein was inoculated into 350mL of LB liquid medium containing kanamycin (50. mu.g/mL), and cultured at 37 ℃ to OD₆₀₀When the concentration reached 0.8, IPTG was added to a final concentration of 0.4mM, and the expression was induced at 37 ℃ for 4 hours.

4) The above-mentioned cells induced to express were collected by centrifugation, resuspended in ice-cooled 10mM PBS, sonicated (350W, 20min, working 3s, resting 3s), centrifuged at 12000g for 10min, and the supernatant solution was collected for further purification.

5) The supernatant solution was filtered through a 0.45 μm filter, and the filtrate was purified by nickel sepharose gel. The filtrate was loaded onto the equilibrated gel and the flow rate was controlled at 1 mL/min. Washing with 10mM PBS to remove unadsorbed protein, linear elution with PBS and PBS containing 0.5M imidazole, collecting different elution peaks for SDS-PAGE identification of protein, and ultrafiltration of samples with purity greater than 90% to 10mM PBS. Obtaining the purified head recombinant protein NKX3.1-A and the tail recombinant protein NKX3.1-B of the NKX 3.1.

Example 2 screening of NKX3.1 hybridoma cell lines and monoclonal antibody preparation

1. Animal immunization:

mixing the NKX3.1-A, NKX 3.1.1-B proteins obtained by purification respectively with equal volume of Freund complete adjuvant, immunizing 6-8 weeks old BalB/c mice by adopting a subcutaneous injection method, wherein the immunizing dose is 100 mu g/mouse, immunizing for the second time after two weeks, emulsifying the antigen by adopting Freund incomplete adjuvant, and adopting an intraperitoneal injection method, wherein the immunizing dose is the same as that of the first time. After the second immunization, tail blood is taken and subjected to gradient dilution by an indirect ELISA method to determine the serum titer, and a mouse with the highest antibody titer is selected for tail vein impact immunization, wherein the impact dose is 50 mu g/mouse.

2. Cell fusion:

the myeloma cells are sp2/0 from BalB/c, and are in logarithmic growth phase when fused; aseptically picking the spleen of the mouse after the impact immunization to prepare a single-cell suspension of spleen cells; mixing mouse spleen cells and myeloma cells at a ratio of 1:5, dropwise adding 1mL of 50% PEG (PH8.0) at 37 ℃, adding an incomplete culture medium, centrifuging, removing supernatant, adding HAT culture medium, suspending, uniformly mixing, diluting to 50mL, dropwise adding into a 96-well cell culture plate, and culturing in a constant-temperature incubator at 37 ℃ and 5% CO 2.

3. Screening and cloning:

selecting cell clones within 7-10 days after fusion, and carrying out ELISA screening detection, wherein the specific steps are as follows:

first, a coated plate was prepared at a coating amount of 50 ng/well, and coated overnight at 4 ℃ in accordance with a loading amount of 100. mu.L/well. The supernatant was discarded the next day and patted dry. Adding 150 mu L of sealing liquid into each hole, or standing at 37 ℃ for 2 h; the supernatant was discarded again and patted dry. Extracting fusion cell culture supernatant, adding 100 μ L of fusion cell culture supernatant into an enzyme-linked immunoassay plate per well for primary antibody incubation, incubating the primary antibody at 37 ℃ for 30min, and washing with ELISA washing solution for 5 times; and then carrying out secondary antibody incubation: after the detection plate is patted dry, adding a secondary antibody reagent which is diluted by an antibody diluent according to the proportion of 1:5000 into each hole, and incubating for 30min at 37 ℃ in each hole; followed by 5 washes with ELISA wash; substrate reaction: after the detection plate is dried, 50 mu L of color development liquid A and 50 mu L of color development liquid B are added into each hole. Firstly adding the color developing agent A, and then adding the color developing agent B. Incubated at room temperature in the dark for 5 min. And finally, terminating the reaction: to the substrate after completion of the reaction, 50. mu.L/well stop solution was added. Placing the mixture into a microplate reader, shaking and uniformly mixing the mixture, and reading the mixture (450 nm). Selecting the cell culture supernatant with the positive hole OD value larger than or close to the positive hole, and then carrying out IHC detection, wherein the IHC detection comprises the following steps: firstly, preparing a paraffin section, and baking the paraffin section at 65 ℃ for 2 hours; and then paraffin sections are dewaxed and hydrated: soaking the slices in fresh xylene for 2 times (15 min/time); then sequentially soaking in anhydrous ethanol I, II, 95% ethanol, 85% ethanol and 70% ethanol for 1 time and 5 min/time respectively; then putting into purified water for washing and soaking for 5 min; then, antigen retrieval is carried out: adding sufficient antigen repairing buffer solution into a pressure cooker, heating the solution to boil by an electromagnetic oven, setting a cooking mode at 300W, placing the solution into a slide rack, timing for 20min, leaving the pressure cooker from a heat source, naturally cooling for 5min, carrying out tap water bath for 15min, taking out, soaking in purified water, confining tissues in the purified water by an oil pen, soaking the purified water for 5min, and soaking a cleaning solution for 5 min. Taking out the dyeing frame; and then blocking endogenous peroxidase: 80-100 μ L (the amount of addition is kept consistent before and after, the same below) of endogenous peroxidase blocker is added dropwise onto the slices, and incubation is carried out for 5min at 25 ℃. Washing with cleaning solution, soaking for 2 times (5 min/time); then adding a primary antibody reagent: dripping 80-100 μ L primary antibody reagent (sample reagent and contrast reagent), incubating at 37 deg.C for 30min, washing with cleaning solution, and soaking for 2 times (5 min/time); then adding a primary anti-post reagent: dripping 80-100 μ L of primary antibody reagent, incubating at 25 deg.C for 20min, washing with cleaning solution, and soaking for 2 times (5 min/time); then adding an enzyme-labeled polymer: dripping 80-100 μ L enzyme-labeled polymer, incubating at 25 deg.C for 20min, washing with cleaning solution, and soaking for 2 times (5 min/time). Developing (DAB dilution ratio 1:50, ready-to-use preparation) by dripping 80-100 μ LDAB developing solution, incubating at 25 deg.C for 4min, washing with purified water, soaking for 2 times, 5 min/time; then, counterdyeing: 80-100 mul hematoxylin staining solution is dripped to incubate for 3min at 25 ℃, and the mixture is washed by tap water and turns blue. And finally, dehydrating, transparent and sealing: slicing with 70%, 85%, 95% ethanol, anhydrous ethanol twice, and xylene twice, soaking for 1min, sealing with transparent, neutral gum and cover glass, and reading.

Limiting dilution is carried out on positive hole cells with correct IHC detection positioning, ELISA value is measured 5-6 days after limiting dilution each time, and OD is selected₄₅₀And (4) carrying out limited dilution on the monoclonal wells with higher positive values until the whole plate result of the 96-well plate is positive by ELISA (enzyme-Linked immunosorbent assay). And selecting a monoclonal antibody with a high positive value to determine a cell strain.

Through screening, a hybridoma cell strain capable of stably secreting the anti-human NKX3.1 monoclonal antibody is finally obtained.

4. Preparing and purifying ascites monoclonal antibody:

injecting 0.5ml liquid paraffin into the abdominal cavity of 8-10 week old BalB/c mice, injecting 1ml injector into the abdominal cavity of each mouse after one week, wherein the cell dosage is 5 × 10⁶Per, 3 mice were used per cell line. Collecting ascites after ascites accumulation, centrifuging to obtain supernatant, purifying by Protein A column chromatography, measuring the concentration of purified monoclonal antibody, packaging, and freezingThe presence was-20 ℃.

Example 3 detection of the specificity of the NKX3.1 monoclonal antibody by Western blotting (Western-Blot)

1. Sample preparation: an sp2/0 cell lysate and an LNCaP cell lysate were prepared, and after cleavage with RAPI containing 1mM PMSF, 5XSDS-PAGE Loading buffer was added to prepare a sample. Sp2/0 is mouse myeloma cells without fusion as negative control, LNCaP cells are human prostate cancer cells as positive control, the lysates of the two release intracellular proteins, the mouse myeloma cells do not express NKX3.1, the LNCaP cells are cells specifically expressing NKX3.1, the LNCaP cells are combined with the positive monoclonal antibody obtained by screening, and WB shows positive reaction.

2. Electrophoresis and membrane transfer: each sample was loaded at 30. mu.g, run at 80V for 20min, and then run at 120V to bromophenol blue to the bottom of the gel. Then starting to transfer the membrane, soaking the NC membrane and the filter paper in a transfer buffer solution in advance, and placing the membrane in a wet-transfer membrane converter in a sandwich form in the following sequence: electrode (-) -sponge-filter paper-gel-NC membrane-filter paper-sponge-electrode (+), constant pressure 90V, 90 min.

3. And (3) sealing: the NC membrane was submerged in blocking solution (TBST containing 5% skim milk) and incubated at 37 ℃ for 2 hours.

4. Primary antibody incubation: the NC membrane was placed in a primary antibody containing the anti-human NKX3.1 monoclonal antibody obtained in example 2 (the antibody was diluted 1:2000 with blocking solution), incubated at 37 ℃ in an incubator for 1 hour, and then washed 3 times with TBST for 5min each.

5. And (3) secondary antibody incubation: the NC membrane was placed in a goat anti-mouse IgG secondary HRP-labeled antibody (antibody diluted 1:5000 with blocking solution), incubated at 37 ℃ for 30min with a shaker, and then washed 3 times with TBST for 5min each time.

6. Color development: the components A and B in the ECL luminescent liquid are as follows: 1, mixing uniformly, adding the mixture on an NC film, and exposing the mixture in an exposure instrument.

As shown in FIG. 1, it is clear from FIG. 1 that NKX3.1 murine mAb has a desired band of 30kD in LNCaP cell lysate, wherein the NKX3.1 murine mAb is diluted at a ratio of 1: 800. The NKX3.1 mouse monoclonal antibody can specifically react with prostate cells and can specifically identify the NKX3.1 protein.

Example 4 Immunohistochemistry (IHC) detection of the specificity of the NKX3.1 monoclonal antibody

1. Wax blocks of human prostate tissue, breast tissue and testis tissue are respectively taken, sliced by a Leica tissue slicer, the tissue thickness is 3 mu m, and the wax blocks are dried and baked for 2h at 65 ℃.

2. The antibody of the invention is subjected to immunohistochemical staining test by using a manual immunohistochemical method, and the specific steps are as follows: performing HIGH-temperature remediation for 20min by using DAKO HIGH pH remediation solution; cooling, incubating at room temperature with 100 μ l of endogenous peroxidase blocking solution for 5min, and soaking in cleaning solution for 2 times and 5 min/time; the anti-human NKX3.1 monoclonal antibody obtained in example 2 is diluted by an antibody diluent according to a ratio of 1:1000, 100 mu l of the diluted antibody is dripped, incubation is carried out at 37 ℃ for 30min, and the antibody is soaked in a cleaning solution for 2 times and 5 min/time; incubating at room temperature for 20min with 100 μ l enzyme-labeled polymer, and soaking in cleaning solution for 2 times and 5 min/time; incubating for 5min at room temperature by using 100 μ l of DAB color development solution, and soaking for 2 times and 5 min/time in purified water; 100 mu L of hematoxylin is dripped for counterstaining, the incubation is carried out for 5min at room temperature, and the mixture is washed by tap water and turns blue.

3. Dehydration, transparency and mounting: cleaning with deionized water for 3 min; ethanol 85% for 1 min; 95% ethanol for 1 min; 100% ethanol for 1min, 2 times; xylene for 1min, 2 times; and (5) sealing the neutral gum.

4. Microscopic examination: as shown in FIGS. 2-4, the NKX3.1 protein localized to the nucleus and showed specific expression in prostate tissue, breast tissue and testis tissue.

Example 5 NKX3.1 antibody Gene calling

1. Total RNA extraction: recovering the cells, detecting the titer of the cell strain, and collecting the cells; adding 1ml Trizol, blowing uniformly, standing at room temperature for 5-10min until the cells are completely lysed, centrifuging at 12000rpm for 5min, removing the precipitate, adding 200 μ l chloroform, violently turning upside down, standing for 15min, centrifuging at 12000rpm at 4 deg.C for 15min, and collecting the upper aqueous phase; adding isopropanol with the same volume, mixing gently, and standing for 10 min; centrifuging at 12000rpm at 4 deg.C for 10min, and removing supernatant; adding 1ml of precooled 75% ethanol, flicking the bottom of the tube, centrifuging at 12000rpm and 4 ℃ for 5min, removing the supernatant, airing at room temperature for a plurality of minutes, then adding 30-50 mu l of precooled DEPC water until the solution is dissolved to obtain an RNA product, and storing for a long time at-80 ℃; the whole extraction process needs to be provided with a mask and gloves to prevent the RNase from being polluted.

2. 5' RACE for obtaining NKX3.1 antibody gene

The invention mainly uses SMARTER RACE 5 '/3 ' Kit (Clontech, Cat.No.634859) to separate the antibody 5 ' sequence of NKX 3.1. First-strand cDNAsynthesis was performed using 1. mu.g of total RNA as a template and 5 ' -CDS primer A, SMART II oligo and 3 ' -CDS primer A provided in the kit according to the method provided in the specification to obtain 5 ' -RACE-Ready cDNA. PCR, i.e., Rapid Amplification of cDNA Ends, was performed using these cDNAs as templates. 5' -RACE PCR was designed based on the gene-specific sequence using UPM (Universal primer) primer and GSP (gene specific primer) primer. The reaction system of the first round of PCR is 50. mu.l, and the components are as follows: 5' -RACE-Ready cDNA 2.5. mu.l, 10 × UPM 5. mu.l, 10. mu.M GSP 1. mu.l, 2 × SeqAmp buffer 25. mu.l, SeqAmp DNA polymerase 1. mu.l, ddH2O 15.5. mu.l. The PCR reaction program is: 5cycles, 94 ℃ for 30sec, 72 ℃ for 3min per cycle; 5cycles, each cycle 94 ℃ 30sec, 70 ℃ 30sec, 72 ℃ 3 min; 25cycles, each cycle 94 ℃ 30sec, 68 ℃ 30sec, 72 ℃ 3 min; the PCR product was stored at 4 ℃. And (3) taking 5 mu l of PCR product, carrying out electrophoresis by using 1.0% agarose gel, detecting, if the band is single, recovering the residual cut gel, constructing on pRACE, and then selecting positive clone for sequencing. If the bands are not single, nested PCR is carried out for further amplification, and then the bands are constructed on pRACE, and then positive clones are selected for sequencing.

EXAMPLE 6 preparation of recombinant antibodies

1. Designing light chain primers and heavy chain primers according to sequencing results and IMGT database

LF：TAAACGGATCTCTAGCGAATTCATGGAGTCAGACACACTCCTG；

LR：CGAGCGGCCGCTAGCAAGCTTTTAACACTCATTCCTGTTGAAG；

HF：TAAACGGATCTCTAGCGAATTCATGGGCTTGGGTGTGGACCTG；

HR：CGAGCGGCCGCTAGCAAGCTTTTATTTACCAGGAGAGTGGGAGAG；

The cDNA is taken as a template, PrimeSTAR Max DNApolymerase (TAKARACode No. R045Q) is used for amplification, and the reaction conditions of PCR are as follows: 3min at 98 ℃; 32 cycles of 98 ℃ for 10s, 62 ℃ for 10s and 72 ℃ for 10 s; 5min at 72 ℃. After the PCR amplified fragment and pTT5 vector were digested for 3h with EcoRI/HindIII, the gel was cut and recovered by agarose gel electrophoresis. And then, constructing an antibody expression vector in a recombination mode, and carrying out plasmid extraction on positive clones with correct sequencing for transfection.

2. Antibody heavy and light chain gene information determination and IMGT database analysis

Through sequencing analysis, the nucleotide sequences of the heavy chain variable region and the light chain variable region of the anti-human NKX3.1 monoclonal antibody are respectively shown as SEQ ID NO.9 and SEQ ID NO. 10; the amino acid sequences of the heavy chain variable region and the light chain variable region are respectively shown as SEQ ID NO.7 and SEQ ID NO. 8. Further analyzing to obtain the amino acid sequences of the heavy chain variable region VHCDR1-3 of the monoclonal antibody as shown in SEQ ID NO.1-3 respectively; the amino acid sequences of the light chain variable region VLCDR1-3 of the monoclonal antibody are respectively shown in SEQ ID NO. 4-6.

3. Anti-human NKX3.1 recombinant antibody expression and purification

Including cell culture before transfection, preparation of transfected cells, transient transfection and product expression and detection.

1) The method for culturing the cells before transfection comprises the following steps: CHO cells are placed in a constant-temperature shaking table of 5% CO2, shaking culture is carried out at constant temperature of 37 ℃ and 120rpm, cell counting is needed firstly during passage, cells are not needed to be centrifuged after the density is confirmed, cell suspension can be directly added into a culture solution according to a needed proportion, and if excessive dead cells occur in the culture process, the cells are discarded and new cells are used.

2) The preparation of transfected cells was performed by: before the cells are transiently transfected, the cell density and survival rate of the cells need to be determined; directly adding the cells into CHO culture solution without centrifugation to dilute the cells to 2 × 10⁶Per milliliter; the shake flask was placed in a 5% CO2 constant temperature shaker, and after shaking culture at 37 ℃ and 120rpm for 10min, transfection was initiated. The transient transfection method comprises the following steps: two 15ml sterile centrifuge tubes were prepared and 5ml of KPM and sterile plasmid DNA were added to one of the tubes according to the weight ratio: light chain 1:1, adding the mixture in proportion, and lightly blowing, beating and uniformly mixing; taking the other centrifugal tube, adding 5ml of KPM and 500 mu l of TA-293 transfection reagent, and lightly blowing, beating and uniformly mixing; placing the centrifuge tube containing the transfection reagentTransferring all the liquid into a centrifuge tube containing plasmids, and lightly blowing, beating and uniformly mixing; standing for 10 minutes at room temperature to prepare a plasmid-vector compound; taking out the cells from the constant temperature shaking table, adding the prepared plasmid-vector complex while shaking, and returning CO₂Shake culturing in constant temperature shaking table, and adding appropriate amount of antibiotic after 3 hr. The method for expressing and detecting the product comprises the following steps: after 24 hours of transfection, 600 mul 293 cell protein expression enhancer can be added to increase the expression level of the product; transient transfection nutritional additives were added 24 hours after transfection.

4. Performing antibody validation

The antibody verification method comprises the following steps: WB verification, IHC verification, WB verification method see example 4, and IHC verification method see example 5.

WB verification is carried out on the anti-human NKX3.1 recombinant antibody prepared by the genetic engineering method, the result is shown in figure 5, and the NKX3.1 recombinant monoclonal antibody has target bands of 30KD in human prostate tissue lysate and LNCaP cell lysate, wherein the dilution ratio of the NKX3.1 mouse monoclonal antibody is 1: 800. The NKX3.1 recombinant antibody is shown to have specific reaction with human prostate tissue and human prostate cancer cells, and can specifically identify the NKX3.1 protein. Meanwhile, the IHC verification result is shown in FIG. 6, and it can be known that the NKX3.1 mouse monoclonal antibody is positioned correctly in the prostate tissue and is obviously positive, and is expressed at a low level in the testis and breast cancer tissues and is weakly positive.

The invention provides the variable region amino acid sequences of heavy chains and light chains of anti-human NKX3.1 monoclonal antibodies, and on the basis, the monoclonal antibodies can be obtained by adopting a conventional antibody engineering method, and the specific method refers to the embodiment. WB and IHC specificity verification tests prove that the obtained anti-human NKX3.1 recombinant antibody can specifically recognize human NKX3.1 protein and can be used for IHC immunohistochemical detection. Compared with the traditional monoclonal antibody preparation method, the anti-human NKX3.1 recombinant antibody prepared by the genetic engineering method has the advantages of known sequence, stable antibody property, good repeatability and the like, and the risk factors in the production and storage processes of the traditional monoclonal antibody are avoided due to the standardized antibody production process. Furthermore, on the basis of the amino acid sequence of the antibody provided by the invention, one or more amino acid additions, deletions, substitutions and other modifications can be adopted to obtain an active fragment or a conservative variant thereof, thereby laying a foundation for further improving the specificity and the affinity of the antibody.

<110> Henan Sainur Biotechnology Ltd

<120> anti-human NKX3.1 monoclonal antibody, preparation method and application thereof

<160> 18

<170> PatentIn version 3.5

<210> 1

<211> 8

<212> PRT

<213> Artificial sequence

<221> VHCDR1

<400> 1

Gly Tyr Ile Phe Thr Asn Phe Gly

1 5

<210> 2

<211> 8

<212> PRT

<213> Artificial sequence

<221> VHCDR2

<400> 2

Ile Asn Thr Tyr Thr Gly Glu Pro

1 5

<210> 3

<211> 9

<212> PRT

<213> Artificial sequence

<221> VHCDR3

<400> 3

Ser His Glu Gly Tyr Thr Met Asp Tyr

1 5

<210> 4

<211> 10

<212> PRT

<213> Artificial sequence

<221> VLCDR1

<400> 4

Lys Ser Val Ser Thr Ser Gly Tyr Ser Tyr

1 5 10

<210> 5

<211> 3

<212> PRT

<213> Artificial sequence

<221> VLCDR2

<400> 5

Leu Val Ser

1

<210> 6

<211> 8

<212> PRT

<213> Artificial sequence

<221> VLCDR3

<400> 6

Gln His Ile Arg Gly Ala Tyr Thr

1 5

<210> 7

<211> 116

<212> PRT

<213> Artificial sequence

<221> heavy chain variable region

<400> 7

Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Leu Lys Lys Pro Gly Glu

1 5 10 15

Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ile Phe Thr Asn Phe

20 25 30

Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu Lys Trp Met

35 40 45

Gly Trp Ile Asn Thr Tyr Thr Gly Glu Pro Thr Tyr Ala Asp Asp Phe

50 55 60

Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Thr Thr Ala Tyr

65 70 75 80

Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Met Ala Thr Tyr Phe Cys

85 90 95

Ser His Glu Gly Tyr Thr Met Asp Tyr Trp Gly Gln Gly Thr Ser Val

100 105 110

Thr Val Ser Ser

115

<210> 8

<211> 110

<212> PRT

<213> Artificial sequence

<221> light chain variable region

<400> 8

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Tyr Arg Ala Ser Lys Ser Val Ser Thr Ser

20 25 30

Gly Tyr Ser Tyr Met His Trp Asn Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Arg Leu Leu Ile Tyr Leu Val Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Glu Glu Asp Ala Ala Thr Tyr Tyr Cys Gln His Ile Arg

85 90 95

Gly Ala Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 9

<211> 348

<212> DNA

<213> Artificial sequence

<221> heavy chain variable region

<400> 9

cagatccagt tggtgcagtc tggacctgag ctgaagaagc ctggagagac agtcaagatc 60

tcctgcaagg cttctgggta tattttcaca aactttggaa tgaactgggt gaagcaggct 120

ccaggaaagg gtttaaagtg gatgggctgg ataaacacct acactggaga gccaacatat 180

gctgatgact tcaagggacg ttttgccttc tctttggaaa cctctgccac cactgcctat 240

ttgcagatca acaacctcaa aaatgaggac atggctactt acttctgttc acatgaggga 300

tatactatgg actactgggg tcaaggaacc tcagtcaccg tctcctca 348

<210> 10

<211> 330

<212> DNA

<213> Artificial sequence

<221> light chain variable region

<400> 10

gacattgtgc tgacacagtc tcctgcttcc ttagctgtat ctctggggca gagggccacc 60

atctcataca gggccagcaa aagtgtcagt acatctggct atagttatat gcactggaac 120

caacagaaac caggacagcc acccagactc ctcatctatc ttgtatccaa cctagaatct 180

ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caacatccat 240

cctgtggagg aggaggatgc tgcaacctat tactgtcagc acattagggg agcttacacg 300

ttcggagggg ggaccaagct ggaaataaaa 330

<210> 11

<211> 123

<212> PRT

<213> Artificial sequence

<221> NKX3.1 header

<400> 11

Met Leu Arg Val Pro Glu Pro Arg Pro Gly Glu Ala Lys Ala Glu Gly

1 5 10 15

Ala Ala Pro Pro Thr Pro Ser Lys Pro Leu Thr Ser Phe Leu Ile Gln

20 25 30

Asp Ile Leu Arg Asp Gly Ala Gln Arg Gln Gly Gly Arg Thr Ser Ser

35 40 45

Gln Arg Gln Arg Asp Pro Glu Pro Glu Pro Glu Pro Glu Pro Glu Gly

50 55 60

Gly Arg Ser Arg Ala Gly Ala Gln Asn Asp Gln Leu Ser Thr Gly Pro

65 70 75 80

Arg Ala Ala Pro Glu Glu Ala Glu Thr Leu Ala Glu Thr Glu Pro Glu

85 90 95

Arg His Leu Gly Ser Tyr Leu Leu Asp Ser Glu Asn Thr Ser Gly Ala

100 105 110

Leu Pro Arg Leu Pro Gln Thr Pro Lys Gln Pro

115 120

<210> 12

<211> 369

<212> DNA

<213> Artificial sequence

<221> NKX3.1 header

<400> 12

atgctcaggg ttccggagcc gcggcccggg gaggcgaaag cggagggggc cgcgccgccg 60

accccgtcca agccgctcac gtccttcctc atccaggaca tcctgcggga cggcgcgcag 120

cggcaaggcg gccgcacgag cagccagaga cagcgcgacc cggagccgga gccagagcca 180

gagccagagg gaggacgcag ccgcgccggg gcgcagaacg accagctgag caccgggccc 240

cgcgccgcgc cggaggaggc cgagacgctg gcagagaccg agccagaaag gcacttgggg 300

tcttatctgt tggactctga aaacacttca ggcgcccttc caaggcttcc ccaaacccct 360

aagcagccg 369

<210> 13

<211> 51

<212> PRT

<213> Artificial sequence

<221> NKX3.1 Tail

<400> 13

Leu Ser Ser Glu Leu Gly Asp Leu Glu Lys His Ser Ser Leu Pro Ala

1 5 10 15

Leu Lys Glu Glu Ala Phe Ser Arg Ala Ser Leu Val Ser Val Tyr Asn

20 25 30

Ser Tyr Pro Tyr Tyr Pro Tyr Leu Tyr Cys Val Gly Ser Trp Ser Pro

35 40 45

Ala Phe Trp

50

<210> 14

<211> 153

<212> DNA

<213> Artificial sequence

<221> NKX3.1 Tail

<400> 14

ctctcctcgg agctgggaga cttggagaag cactcctctt tgccggccct gaaagaggag 60

gccttctccc gggcctccct ggtctccgtg tataacagct atccttacta cccatacctg 120

tactgcgtgg gcagctggag cccagctttt tgg 153

<210> 15

<211> 43

<212> DNA

<213> Artificial sequence

<221> LF

<400> 15

taaacggatc tctagcgaat tcatggagtc agacacactc ctg 43

<210> 16

<211> 43

<212> DNA

<213> Artificial sequence

<221> LR

<400> 16

cgagcggccg ctagcaagct tttaacactc attcctgttg aag 43

<210> 17

<211> 43

<212> DNA

<213> Artificial sequence

<221> HF

<400> 17

taaacggatc tctagcgaat tcatgggctt gggtgtggac ctg 43

<210> 18

<211> 45

<212> DNA

<213> Artificial sequence

<221> HR

<400> 18

cgagcggccg ctagcaagct tttatttacc aggagagtgg gagag 45

Claims

1. The anti-human NKX3.1 monoclonal antibody is characterized by comprising an amino acid sequence shown as SEQ ID NO: 1-3, and VLCDR1, VLCDR2 and VLCDR3 having the amino acid sequences shown in SEQ ID NO. 4-6.

2. The monoclonal antibody of claim 1, comprising an amino acid sequence as set forth in SEQ ID NO: 7 and a light chain variable region with the amino acid sequence shown as SEQ ID NO. 8.

3. Use of the anti-human NKX3.1 monoclonal antibody of claim 1 or 2 in the preparation of NKX3.1 in vitro immunoassay reagent or kit.

4. An NKX3.1 immunohistochemical detection reagent comprising the anti-human NKX3.1 monoclonal antibody according to claim 1 or 2.

5. A nucleic acid molecule encoding the anti-human NKX3.1 monoclonal antibody of claim 1 or 2.

6. The nucleic acid molecule of claim 5, wherein the gene sequence encoding the heavy chain variable region of the anti-human NKX3.1 monoclonal antibody is as set forth in SEQ ID NO: 9 is shown in the figure; the gene sequence of the light chain variable region of the coding anti-human NKX3.1 monoclonal antibody is shown as SEQ ID NO: shown at 10.

7. An expression cassette, recombinant vector or recombinant bacterium comprising the nucleic acid molecule of claim 5 or 6.

8. Use of the nucleic acid molecule of claim 5 or 6 or the expression cassette, recombinant vector or recombinant bacterium of claim 7 for the preparation of an anti-human NKX3.1 antibody.

9. A method for preparing an anti-human NKX3.1 monoclonal antibody is characterized by comprising the following steps: introducing a nucleic acid molecule according to claim 5 or 6 into a host cell.