CN113527460B - Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof - Google Patents
Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof Download PDFInfo
- Publication number
- CN113527460B CN113527460B CN202110755119.XA CN202110755119A CN113527460B CN 113527460 B CN113527460 B CN 113527460B CN 202110755119 A CN202110755119 A CN 202110755119A CN 113527460 B CN113527460 B CN 113527460B
- Authority
- CN
- China
- Prior art keywords
- arac
- mutant
- aracmt1
- seq
- dnt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
Abstract
The invention discloses an Arac mutant AraCmt1 for sensing explosive molecules, and a screening method and application thereof. The amino acid sequence of the AraCmt1 mutant is shown as SEQ ID NO.13, and the nucleotide sequence of the coding gene of the AraCmt1 mutant is shown as SEQ ID NO.12, or the nucleotide sequence which has more than 95% homology with the nucleotide sequence shown as SEQ ID NO.12 and can code the amino acid sequence shown as SEQ ID NO. 13. The mutant AraCmt1 can specifically bind to the explosive molecule 2, 4-dinitrotoluene (2, 4-DNT) and is induced by the explosive molecule to activate P BAD The promoter expresses the downstream reporter gene, and detects trace 2,4-DNT through fluorescence intensity or color reaction, so that the promoter is suitable for preparing the microbial sensor for sensing 2,4-DNT.
Description
Technical Field
The invention belongs to the technical fields of genetic engineering and molecular biology, and particularly relates to an AraCmt1 mutant of an Arac for sensing explosive molecules, and a screening method and application thereof.
Background
Residual explosives (such as mines) in a war zone cause irreparable harm to life safety and ecosystems, and the safety and effective detection of the explosives are of great strategic significance. The effective component of the explosive is TNT, which can be decomposed into various compounds, such as 1, 3-dinitrobenzene (1, 3-DNB) and 2, 4-dinitrotoluene (2, 4-DNT).
The molecular formula of the explosive 2,4-DNT with the CAS number of 121-14-2 is shown as follows:
the ismmshon Belkin reported that the sensor element, namely yqjF promoter, for explosive molecules 2,4-DNT was used as a reporter element by the israel scientist, and a microbial sensor for detecting 2,4-DNT was constructed by using GFP gene as a reporter element. In the research, 2,4-DNT and metabolites thereof can directly induce yqjF promoter, and after the yqjF promoter is induced, downstream GFP genes are transcribed, so that the sensitivity of a direct induction system is low, and the requirement of field detection cannot be met.
Wild-type AraC-P BAD The system comprises: transcription factor AraC is capable of responding naturally to L-arabinose, binding I of AraC dimer in the absence of L-arabinose 1 And O 2 Site at P BAD Forming a DNA loop upstream of the promoter to inhibit transcription; upon binding to L-arabinose, the AraC dimer changes conformation so as to be adjacent to I 1 And I 2 Half-site binding activates transcription. It has been reported that AraC mutants obtained by mutation can bind to compounds other than L-arabinose, thereby activating P BAD Transcriptional activity of the promoter allows the AraC mutant to be induced by other compounds. Such AraC-P compared to a promoter that directly senses 2,4-DNT BAD The system has an amplifying effect, and the signal is stronger.
Disclosure of Invention
The invention aims to provide an Arac mutant AraCmt1 for sensing explosive molecules, a screening method and application thereof, wherein the mutant AraCmt1 has obvious effect of sensing explosive molecules 2,4-DNT and is dose-dependent.
In order to achieve the aim of the invention, the invention is realized by adopting the following technical scheme:
the invention provides an Arac mutant AraCmt1 for sensing explosive molecules, wherein the amino acid sequence of the Arac mutant AraCmt1 is shown as SEQ ID No. 13.
The invention also provides a coding gene of the AraCmt1, and the coding gene of the Arac mutant AraCmt1 has one of the following nucleotide sequences:
(1) A nucleotide sequence shown as SEQ ID NO. 12;
(2) A nucleotide sequence which has more than 95 percent of homology with the nucleotide sequence shown as SEQ ID NO.12 and can code an amino acid sequence shown as SEQ ID NO. 13.
The invention also provides a screening method of the AraCmt1 mutant, which comprises the following steps:
(1) Constructing recombinant plasmid P-AraC-P by using plasmid pEGFP-1 as template and amplifying BAD -eGFP；
(2) Obtaining AraC multiple site saturated mutant fragment ABC by degenerate primers, and subjecting the recombinant plasmid P-AraC-P BAD After eGFP amplification, assembling with ABC fragments, and transforming competent cells to obtain an AraC mutant library;
(3) The AraC mutant library is subjected to primary screening by using a culture medium containing explosive molecules, and single colonies with obvious fluorescence are obtained through screening;
(4) Putting the single colony on a culture medium containing explosive molecules with different concentrations for re-screening, detecting real-time fluorescence, and finally screening to obtain a strain with the strongest fluorescence intensity, namely a target strain containing AraC mutants;
(5) And culturing the target strain containing the AraC mutant, extracting plasmids, and sequencing and identifying to obtain the Arac mutant.
Further, the amplification primer in the step (1) is
PBAD-EGFP-F：5’- TTGGGCTAGCAGGAGGAATTCTTTGTTTAACTTTA AGAAGGAGATATACAAATGG-3’；
PBAD-EGFP-R：5’- CTCTAGAGGATCCCCGGGTACCTTACTTGTACA GCTCGTCCATG-3’。
Further, the primary screening step of the step (3) is as follows: transfer plates containing AraC mutant library through a nitric acid microporous membrane, transfer to M9Y plates containing 100 mg/L ampicillin and 50 mg/L explosive molecules, continue to stand in a 37℃incubator for 12 hours; when obvious colony grows, the plate is subjected to fluorescent observation through an ultraviolet lamp, and single colony with obvious fluorescence is obtained through screening.
Further, the re-screening step of the step (4) is as follows: single colonies with obvious fluorescence are placed in a 96-deep well plate containing 200 mu L M Y culture medium of 100 mg/L ampicillin for activation culture, and are subjected to shaking culture at 37 ℃ overnight; according to 1% inoculum size, transferring into 96 micro-well plate containing M9Y culture medium, culturing until OD600 = 0.2, adding explosive molecules with concentrations of 0 mg/L, 5 mg/L and 10 mg/L respectively, shake culturing in enzyme-labeled instrument, real-time monitoring fluorescence intensity at 30deg.C, detecting once every 10 min, total monitoring 10 h, excitation light 485 nm, emitted light 528 nm, and measuring three times in parallel.
Further, the components of the M9Y culture medium comprise disodium hydrogen phosphate 6g/L, monopotassium phosphate 3g/L, ammonium chloride 1g/L, sodium chloride 0.5g/L, magnesium sulfate 1 mM and 0.05% yeast powder.
The invention also provides a recombinant expression vector of the coding gene of the AraCmt1 of the Arac mutant.
The invention also provides a recombinant strain of the coding gene of the AraCmt1 of the Arac mutant.
The invention also provides application of the AraCmt1 mutant, the recombinant expression vector or the recombinant strain in preparing a microbial sensor for detecting explosive molecules.
Further, the explosive molecule is 2,4-DNT.
Compared with the prior art, the invention has the following advantages and beneficial effects:
the invention screens and obtains a brand new mutant AraCmt1 through a method for constructing AraC mutant, has the function of sensing explosive molecules 2,4-DNT, can be used for constructing a microbial sensor, and can be combined with L-arabinose and responded. The method for screening the AraC mutant can be also suitable for screening other AraC mutants capable of sensing explosive molecules, and is simple and quick. The microbial sensor constructed by the mutant AraCmt1 or the mutant AraCmt1 has good effect of sensing 2,4-DNT, can detect 2,4-DNT with different concentrations and trace amounts through fluorescence intensity or color reaction, and is dose-dependent, so that the microbial sensor has great application prospect.
Drawings
FIG. 1 is a constructed vector P-AraC-P BAD -map of product purification results during eGFP.
FIG. 2 is a constructed vector P-AraC-P BAD Map of eGFP plasmid and the fluorescence production results of its corresponding strain under arabinose-induced conditions.
FIG. 3 is a flow chart of the screening of AraC mutants.
FIG. 4 shows the results of partial plate primary screening of AraC mutant strains.
FIG. 5 is a graph showing the results of the action of AraCmt1 mutant in detecting explosive molecule 2,4-DNT.
Detailed Description
The invention will be further illustrated with reference to specific examples, but the invention is not limited to the examples.
The specific techniques or conditions are not identified in the examples and are performed according to techniques described in the literature in this field or according to product specifications. The reagents or apparatus used were conventional products available commercially without the manufacturer's attention.
Example 1: screening of AraC mutants
1. Base vector P-AraC-P BAD Construction of eGFP and corresponding strains
The PCR was performed using plasmid pEGFP-1 (Clontech, cat# 6086_1) as a template, primers pBAD-EGFP-F and pBAD-EGFP-R, and an eGFP fragment was amplified by the Polymerase Chain Reaction (PCR), and the PCR amplification system was as follows:
the PCR procedure was: 95. 3 min at the temperature; 30. x (95 ℃ 15 s,55 ℃ 15 s,72 ℃ 1 min); 72 ℃ for 5 min; and (3) carrying out the temperature of 16 ℃ to infinity.
The primer sequences are shown below:
PBAD-EGFP-F：5’- TTGGGCTAGCAGGAGGAATTCTTTGTTTAACTTTAAGAAGGAGATATACAAATGG-3’ （SEQ ID NO.1）；
PBAD-EGFP-R：5’- CTCTAGAGGATCCCCGGGTACCTTACTTGTACAGCTCGTCCATG-3’ （SEQ ID NO.2）。
the PCR products were gel recovered and purified using gel recovery and purification kit (Vazyme, cat. DC 301-01) (FIG. 1A).
By means of restriction enzyme 1EcoRІ (TaKaRa, cat 1611) and restriction enzyme 2KpnІ (TaKaRa, cat.1618) double-digested pBAD24 plasmid, the restriction system was:
| plasmids or |
3 |
| 10 × |
10 |
| Restriction enzyme | |
| 1 | 5 |
| Restriction endonuclease | |
| 2 | 5 μL |
| Ultrapure water | Up to 100 mu L |
The enzyme digestion system is placed at 37 ℃ for incubation for 1h, and glue recovery and purification are carried out (figure 1B).
The two PCR products were ligated by means of seamless cloning using a 2 XClon Express Mix (Vazyme, cat. C115) as follows:
| PCR fragment of vector | 0.03 pmol |
| PCR fragment of inserted gene | 0.06 pmol |
| 2× |
5 μL |
| Ultrapure water | Is added to 10 mu L |
The system is placed at 50 ℃ for incubation for 30 min. Conversion of the productE. coliDH5 alpha competence, coating on LB solid plate containing 100 mg/L ampicillin, PCR screening positive clone (FIG. 1C), extracting recombinant plasmid P-AraC-P from positive clone BAD eGFP (FIG. 2), identified by restriction and sequencing, the plasmid P-AraC-P BAD The nucleotide sequence of eGFP is shown as SEQ ID NO. 3.
Will construct the P-AraC-P BAD Transformation of eGFP plasmid intoE. coliBL21 (DE 3) was competent, plated on LB solid plates containing 100 mg/L ampicillin, and cultured overnight to obtain a single strain. Four positive clone monoclonals were picked and streaked into M9Y (1L medium) containing 100 mg/L ampicillinThe plates were subjected to fluorescent observation by an ultraviolet lamp when apparent colony growth was found by placing the plates on a solid plate containing 6g of disodium hydrogen phosphate, 3g of potassium dihydrogen phosphate, 1g of ammonium chloride, 0.5g of sodium chloride, 1 mM of magnesium sulfate, 0.05% of yeast powder) and on an M9Y solid plate containing 100 mg/L of ampicillin plus arabinose 1 mM in a incubator at 37℃for 12 hours. The results (FIG. 2) show that colonies on plates with arabinose have significant green fluorescence and plates without arabinose do not have fluorescence, indicating that P-AraC-P is contained BAD The engineered bacteria of the eGFP plasmid can bind to and respond to L-arabinose.
2. Construction of AraC mutant library (scheme shown in FIG. 3)
(1) Polymerase Chain Reaction (PCR) was performed with the vector P-AraC-P BAD -eGFP is used as a template, a fragment A is obtained by amplifying a primer AraC-P8-F, araC-T24-R, a fragment B is obtained by amplifying a primer araC-comp-T24-F, araC-H80-Y82-R, and a fragment C is obtained by amplifying a primer AraC-H93-F, araC-rev-4, wherein the PCR amplification system is as follows:
the PCR procedure was: 95 ℃ for 3 min; 30. x (95 ℃ 15 s,55 ℃ 15 s,72 ℃ 30 s); 72 ℃ for 5 min; and (3) carrying out the temperature of 16 ℃ to infinity.
The primer sequences are as follows:
AraC-P8-F：5’-tggctgaagcgcaaaatgatNNSctgctgccg-3’ （SEQ ID NO.4）；
AraC-T24-R：5’-taaccgttggcctcaatcggSNNtaaacccgc-3’ （SEQ ID NO.5）；
araC-comp-T24-F：5’-ccgattgaggccaacggtta-3’ （SEQ ID NO.6）；
araC-H80-Y82-R：5’-cgagcctccggatgacgaccSNNgtgSNNaatctctcc-3’ （SEQ ID NO.7）；
AraC-H93-F：5’-ggtcgtcatccggaggctcgcgaatggtatNNScagtgggtt-3’ （SEQ ID NO.8）；
AraC-rev-4：5’-attgctgtctgccaggtgatc-3’ （SEQ ID NO.9）。
the PCR product was subjected to gel recovery and purification using gel recovery and purification kit (Vazyme, cat. DC 301-01).
The recovered A, B, C fragment is subjected to overlap extension PCR to obtain a fragment ABC with multiple site saturation mutation, and the PCR amplification system is as follows:
the PCR procedure was: 95 ℃ for 3 min;10 cycles X (95 ℃ C15 s,55 ℃ C15 s,72 ℃ C30 s); 72 ℃ for 5 min; and (3) carrying out the temperature of 16 ℃ to infinity.
Then adding the primer:
| AraC-P8-F： | 0.5 μM |
| AraC-rev-4 | 0.5 μM |
continuing the PCR amplification reaction procedure: 95 ℃ for 3 min; 30. x (95 ℃ 15 s,55 ℃ 15 s,72 ℃ 30 s); 72 ℃ for 5 min; and (3) carrying out the temperature of 16 ℃ to infinity.
The PCR product of fragment ABC was subjected to gel recovery and purification using gel recovery and purification kit (Vazyme, cat. DC 301-01).
(2) By P-AraC-P BAD The eGFP plasmid was used as a template, and primers AraC-I-F and AraC-I-R were used for PCR, and the vector fragment was amplified by the PCR amplification system as follows:
the PCR procedure was: 95 ℃ for 3 min;30 cycles X (15 s at 95 ℃, 15 s at 55 ℃ and 5 min at 72 ℃); 72 ℃ for 5 min; and (3) carrying out the temperature of 16 ℃ to infinity.
The primer sequences are as follows:
AraC-I-F：5’-GATCACCTGGCAGACAGCAA-3’ （SEQ ID NO.10）；
AraC-I-R：5’-ATCATTTTGCGCTTCAGCCA-3’ （SEQ ID NO.11）。
1. Mu.L of restriction enzyme was added to the PCR productDpnІ (TaKaRa, cat# 1609) was digested at 37℃for 1h, and the liquid was recovered and purified using a recovery and purification kit (Vazyme, cat# DC 301-01).
(4) The ABC fragment was cloned onto the vector fragment using seamless cloning, the system of which is as follows:
the connection system is placed at 50 ℃ for incubation for 30 min. Ligation product conversionE. coliBL 21-. DELTA.AraC was competent, plated on LB solid plates containing 100 mg/L ampicillin, and cultured overnight to obtain a mutation library.
3. Large-scale screening of 2, 4-DNT-sensitive AraC mutant libraries
(1) Preliminary screening of mutation library by ultraviolet lamp irradiation
The plate obtained above was transferred to an M9Y plate containing 100 mg/L ampicillin and 50 mg/L2, 4-DNT by transferring through a microporous nitric acid membrane, and the plate was left in a constant temperature incubator at 37℃for 12 hours. When obvious colony growth exists on the LB solid plate with the transfer film, fluorescent observation is carried out on the plate through an ultraviolet lamp, and single colony with obvious fluorescence is obtained through screening, namely the Arac mutant inducing 2,4-DNT. As a result, as shown in FIG. 4, the present invention co-screened 20 more obvious mutants in 5000 clones.
(2) Re-screening by 96 microwell plates
Single colonies obtained by primary screening were picked with sterile toothpicks and placed in 96-well plates containing 200. Mu. L M9Y medium of 100 mg/L ampicillin for activation culture, shaking overnight at 37 ℃. According to 1% inoculum size was transferred to 96-well plates of the same medium and incubated to OD 600 When=0.2, 2,4-DNT with concentrations of 0 mg/L, 5 mg/L and 10 mg/L were added respectively, and the mixture was subjected to shake culture in an enzyme-labeled instrument (Biotek), and the fluorescence intensity (RFU) was monitored at 30 ℃ in real time at constant temperature, once every 10 min, 10 h was monitored in total, 485 to nm to excitation light, 528 to nm to emitted light, and three replicates were measured per group. Of the 20 strains initially screened, 1 strain 8-10 was screened, whose fluorescence intensity (RFU) showed the following changes: under the action of 2,4-DNT with different concentrations, the RFU value shows different changes, and the higher the 2,4-DNT concentration is, the higher the RFU value is.
4. Identification of AraC mutants that sense 2,4-DNT
The strain with obvious fluorescence effect is transferred to 10 mL and added into LB liquid medium with 100 mg/L ampicillin for culture, and the strain is cultured by shaking table overnight at 37 ℃. Plasmid extraction was performed using a plasmid extraction kit (Vazyme, cat. DC 201-01). The extracted plasmids were sent to sequencing companies for sequencing, and finally the mutant sequences of the AraC mutants were determined. Sequencing results show that the nucleotide sequence of the obtained AraCmt1 mutant is shown as SEQ ID NO.12, and the encoded amino acid sequence is shown as SEQ ID NO. 13.
Example 2: application of AraC mutant in detection of explosive molecule 2,4-DNT
Single colonies containing AraCmt1 mutant were picked with sterile toothpicks and placed in 10 mL M9Y medium containing 100 mg/L ampicillin for activation culture, and shake-cultured overnight at 37 ℃. According to 1% inoculum size, the obtained product was transferred to 96-well plates of the same culture medium, when the culture was carried out until OD600 = 0.2, 2,4-DNT was added at concentrations of 0 mg/L, 5 mg/L and 10 mg/L, and the mixture was placed in a microplate reader (Biotek), and fluorescence intensity (RFU) was monitored at 30℃to obtain results, as shown in FIG. 5, the RFU values of 5 mg/L and 10 mg/L were significantly higher than those of the 0 mg/L group, and the higher the concentration of 2,4-DNT was, which indicated that the AraCmt1 mutant selected by the invention had the effect of significantly inducing explosive molecules of 2,4-DNT, and was excellent in sensitivity.
The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Qingdao university of agriculture
<120> an Arac mutant AraCmt1 inducing explosive molecules, screening method and application thereof
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 55
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
ttgggctagc aggaggaatt ctttgtttaa ctttaagaag gagatataca aatgg 55
<210> 2
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ctctagagga tccccgggta ccttacttgt acagctcgtc catg 44
<210> 3
<211> 5287
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atcgatgcat aatgtgcctg tcaaatggac gaagcaggga ttctgcaaac cctatgctac 60
tccgtcaagc cgtcaattgt ctgattcgtt accaattatg acaacttgac ggctacatca 120
ttcacttttt cttcacaacc ggcacggaac tcgctcgggc tggccccggt gcatttttta 180
aatacccgcg agaaatagag ttgatcgtca aaaccaacat tgcgaccgac ggtggcgata 240
ggcatccggg tggtgctcaa aagcagcttc gcctggctga tacgttggtc ctcgcgccag 300
cttaagacgc taatccctaa ctgctggcgg aaaagatgtg acagacgcga cggcgacaag 360
caaacatgct gtgcgacgct ggcgatatca aaattgctgt ctgccaggtg atcgctgatg 420
tactgacaag cctcgcgtac ccgattatcc atcggtggat ggagcgactc gttaatcgct 480
tccatgcgcc gcagtaacaa ttgctcaagc agatttatcg ccagcagctc cgaatagcgc 540
ccttcccctt gcccggcgtt aatgatttgc ccaaacaggt cgctgaaatg cggctggtgc 600
gcttcatccg ggcgaaagaa ccccgtattg gcaaatattg acggccagtt aagccattca 660
tgccagtagg cgcgcggacg aaagtaaacc cactggtgat accattcgcg agcctccgga 720
tgacgaccgt agtgatgaat ctctcctggc gggaacagca aaatatcacc cggtcggcaa 780
acaaattctc gtccctgatt tttcaccacc ccctgaccgc gaatggtgag attgagaata 840
taacctttca ttcccagcgg tcggtcgata aaaaaatcga gataaccgtt ggcctcaatc 900
ggcgttaaac ccgccaccag atgggcatta aacgagtatc ccggcagcag gggatcattt 960
tgcgcttcag ccatactttt catactcccg ccattcagag aagaaaccaa ttgtccatat 1020
tgcatcagac attgccgtca ctgcgtcttt tactggctct tctcgctaac caaaccggta 1080
accccgctta ttaaaagcat tctgtaacaa agcgggacca aagccatgac aaaaacgcgt 1140
aacaaaagtg tctataatca cggcagaaaa gtccacattg attatttgca cggcgtcaca 1200
ctttgctatg ccatagcatt tttatccata agattagcgg atcctacctg acgcttttta 1260
tcgcaactct ctactgtttc tccatacccg tttttttggg ctagcaggag gaattctttg 1320
tttaacttta agaaggagat atacaaatgg tgagcaaggg cgaggagctg ttcaccgggg 1380
tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc agcgtgtccg 1440
gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc tgcaccaccg 1500
gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctacggc gtgcagtgct 1560
tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc atgcccgaag 1620
gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag acccgcgccg 1680
aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc atcgacttca 1740
aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc cacaacgtct 1800
atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc cgccacaaca 1860
tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc atcggcgacg 1920
gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg agcaaagacc 1980
ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc gggatcactc 2040
tcggcatgga cgagctgtac aagtaaggta cccggggatc ctctagagtc gacctgcagg 2100
catgcaagct tggctgtttt ggcggatgag agaagatttt cagcctgata cagattaaat 2160
cagaacgcag aagcggtctg ataaaacaga atttgcctgg cggcagtagc gcggtggtcc 2220
cacctgaccc catgccgaac tcagaagtga aacgccgtag cgccgatggt agtgtggggt 2280
ctccccatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc tcagtcgaaa 2340
gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag taggacaaat 2400
ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg ggcaggacgc 2460
ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga tggccttttt 2520
gcgtttctac aaactctttt gtttattttt ctaaatacat tcaaatatgt atccgctcat 2580
gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca 2640
acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca 2700
cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta 2760
catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt 2820
tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc gtgttgacgc 2880
cgggcaagag caactcggtc gccgcataca ctattctcag aatgacttgg ttgagtactc 2940
accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc 3000
cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa 3060
ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga 3120
accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat 3180
ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca 3240
attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc 3300
ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat 3360
tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag 3420
tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa 3480
gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt tacgcgccct 3540
gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 3600
ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg 3660
gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac 3720
ggcacctcga ccccaaaaaa cttgatttgg gtgatggttc acgtagtggg ccatcgccct 3780
gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 3840
tccaaacttg aacaacactc aaccctatct cgggctattc ttttgattta taagggattt 3900
tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 3960
ttaacaaaat attaacgttt acaatttaaa aggatctagg tgaagatcct ttttgataat 4020
ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga ccccgtagaa 4080
aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg cttgcaaaca 4140
aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc aactcttttt 4200
ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct agtgtagccg 4260
tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc 4320
ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga 4380
cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc 4440
agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc 4500
gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca 4560
ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg 4620
tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta 4680
tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct 4740
cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag 4800
tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa 4860
gcggaagagc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 4920
atagggtcat ggctgcgccc cgacacccgc caacacccgc tgacgcgccc tgacgggctt 4980
gtctgctccc ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc 5040
agaggttttc accgtcatca ccgaaacgcg cgaggcagca aggagatggc gcccaacagt 5100
cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat gagcccgaag 5160
tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc aaccgcacct 5220
gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatctgctc atgtttgaca 5280
<210> 4
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
tggctgaagc gcaaaatgat nnsctgctgc cg 32
<210> 5
<211> 32
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
taaccgttgg cctcaatcgg snntaaaccc gc 32
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ccgattgagg ccaacggtta 20
<210> 7
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
cgagcctccg gatgacgacc snngtgsnna atctctcc 38
<210> 8
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
ggtcgtcatc cggaggctcg cgaatggtat nnscagtggg tt 42
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
attgctgtct gccaggtgat c 21
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gatcacctgg cagacagcaa 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
atcattttgc gcttcagcca 20
<210> 12
<211> 879
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
atggctgaag cgcaaaatga tgggctgctg ccgggatact cgtttaatgc ccatctggtg 60
gcgggtttaa gcccgattga ggccaacggt tatctcgatt tttttatcga ccgaccgctg 120
ggaatgaaag gttatattct caatctcacc attcgcggtc agggggtggt gaaaaatcag 180
ggacgagaat ttgtttgccg accgggtgat attttgctgt tcccgccagg agagattgtc 240
cacggcggtc gtcatccgga ggctcgcgaa tggtatcacc agtgggttta ctttcgtccg 300
cgcgcctact ggcatgaatg gcttaactgg ccgtcaatat ttgccaatac ggggttcttt 360
cgcccggatg aagcgcacca gccgcatttc agcgacctgt ttgggcaaat cattaacgcc 420
gggcaagggg aagggcgcta ttcggagctg ctggcgataa atctgcttga gcaattgtta 480
ctgcggcgca tggaagcgat taacgagtcg ctccatccac cgatggataa tcgggtacgc 540
gaggcttgtc agtacatcag cgatcacctg gcagacagca attttgatat cgccagcgtc 600
gcacagcatg tttgcttgtc gccgtcgcgt ctgtcacatc ttttccgcca gcagttaggg 660
attagcgtct taagctggcg cgaggaccaa cgtatcagcc aggcgaagct gcttttgagc 720
accacccgga tgcctatcgc caccgtcggt cgcaatgttg gttttgacga tcaactctat 780
ttctcgcggg tatttaaaaa atgcaccggg gccagcccga gcgagttccg tgccggttgt 840
gaagaaaaag tgaatgatgt agccgtcaag ttgtcataa 879
<210> 13
<211> 292
<212> PRT
<213> Artificial sequence (Artificial Sequence)
<400> 13
Met Ala Glu Ala Gln Asn Asp Gly Leu Leu Pro Gly Tyr Ser Phe Asn
1 5 10 15
Ala His Leu Val Ala Gly Leu Ser Pro Ile Glu Ala Asn Gly Tyr Leu
20 25 30
Asp Phe Phe Ile Asp Arg Pro Leu Gly Met Lys Gly Tyr Ile Leu Asn
35 40 45
Leu Thr Ile Arg Gly Gln Gly Val Val Lys Asn Gln Gly Arg Glu Phe
50 55 60
Val Cys Arg Pro Gly Asp Ile Leu Leu Phe Pro Pro Gly Glu Ile Val
65 70 75 80
His Gly Gly Arg His Pro Glu Ala Arg Glu Trp Tyr His Gln Trp Val
85 90 95
Tyr Phe Arg Pro Arg Ala Tyr Trp His Glu Trp Leu Asn Trp Pro Ser
100 105 110
Ile Phe Ala Asn Thr Gly Phe Phe Arg Pro Asp Glu Ala His Gln Pro
115 120 125
His Phe Ser Asp Leu Phe Gly Gln Ile Ile Asn Ala Gly Gln Gly Glu
130 135 140
Gly Arg Tyr Ser Glu Leu Leu Ala Ile Asn Leu Leu Glu Gln Leu Leu
145 150 155 160
Leu Arg Arg Met Glu Ala Ile Asn Glu Ser Leu His Pro Pro Met Asp
165 170 175
Asn Arg Val Arg Glu Ala Cys Gln Tyr Ile Ser Asp His Leu Ala Asp
180 185 190
Ser Asn Phe Asp Ile Ala Ser Val Ala Gln His Val Cys Leu Ser Pro
195 200 205
Ser Arg Leu Ser His Leu Phe Arg Gln Gln Leu Gly Ile Ser Val Leu
210 215 220
Ser Trp Arg Glu Asp Gln Arg Ile Ser Gln Ala Lys Leu Leu Leu Ser
225 230 235 240
Thr Thr Arg Met Pro Ile Ala Thr Val Gly Arg Asn Val Gly Phe Asp
245 250 255
Asp Gln Leu Tyr Phe Ser Arg Val Phe Lys Lys Cys Thr Gly Ala Ser
260 265 270
Pro Ser Glu Phe Arg Ala Gly Cys Glu Glu Lys Val Asn Asp Val Ala
275 280 285
Val Lys Leu Ser
290
Claims (5)
1. An Arac mutant AraCmt1 for sensing explosive molecules, wherein the Arac mutant AraCmt1 has an amino acid sequence shown in SEQ ID No. 13.
2. The Arac mutant AraCmt1 coding gene of claim 1, wherein the Arac mutant AraCmt1 coding gene has a nucleotide sequence as shown in SEQ ID No. 12.
3. A recombinant expression vector comprising the gene encoding the AraCmt1 of Arac mutant of claim 2.
4. A recombinant strain comprising the gene encoding the AraCmt1 of Arac mutant of claim 2.
5. Use of the Arac mutant AraCmt1 of claim 1, the recombinant expression vector of claim 3 or the recombinant strain of claim 4 for the preparation of a microbial sensor for detecting an explosive molecule, characterized in that the explosive molecule is 2,4-DNT.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110755119.XA CN113527460B (en) | 2021-07-05 | 2021-07-05 | Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110755119.XA CN113527460B (en) | 2021-07-05 | 2021-07-05 | Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113527460A CN113527460A (en) | 2021-10-22 |
| CN113527460B true CN113527460B (en) | 2023-06-20 |
Family
ID=78126650
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110755119.XA Active CN113527460B (en) | 2021-07-05 | 2021-07-05 | Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113527460B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116284276B (en) * | 2023-02-28 | 2023-10-03 | 江苏省中国科学院植物研究所 | Escherichia coli regulatory protein AraC mutant protein AraCm and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103626852A (en) * | 2012-08-23 | 2014-03-12 | 中国科学院微生物研究所 | AraC mutant protein and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1580273A1 (en) * | 2004-03-26 | 2005-09-28 | Friedrich-Alexander-Universität Erlangen-Nürnberg | Peptide-based method for monitoring gene expression in a host cell |
| WO2018075486A1 (en) * | 2016-10-17 | 2018-04-26 | Northwestern University | Generation of novel metabolite-responsive transcription regulator biosensors |
-
2021
- 2021-07-05 CN CN202110755119.XA patent/CN113527460B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103626852A (en) * | 2012-08-23 | 2014-03-12 | 中国科学院微生物研究所 | AraC mutant protein and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| AraC Regulatory Protein Mutants with Altered Effector Specificity;Shuang-Yan Tang et al.;《JACS》;第130卷;5267–5271 * |
| GenBank：AAM63382.1;Lefebre, M. D. et al.;《NCBI》;序列部分 * |
| 改性B 炸药主要组分的近红外光谱检测方法;温晓燕等;《Chinese Journal of Energetic Materials》;第27卷(第2期);162-166 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113527460A (en) | 2021-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102424721B1 (en) | Peptide-mediated delivery of rna-guided endonuclease into cells | |
| Pan et al. | Target identification of natural products and bioactive compounds using affinity-based probes | |
| CN113527460B (en) | Arac mutant AraCmt1 for sensing explosive molecules, screening method and application thereof | |
| Zhao et al. | Rapid detection of Vibrio parahaemolyticus strains and virulent factors by loop-mediated isothermal amplification assays | |
| RU2733652C2 (en) | Modified hematopoietic stem cells/progenitor cells and non-t effector cells, and use thereof | |
| JP6140615B2 (en) | Light controllable gene expression system | |
| KR101964746B1 (en) | Composition and method for improving sensitivity and specificity on detection of nucleic acids with using dCas9 protein and gRNA for binding to target nucleic acid sequence | |
| DK2768848T3 (en) | METHODS AND PROCEDURES FOR EXPRESSION AND SECRETARY OF PEPTIDES AND PROTEINS | |
| JP2014509196A5 (en) | ||
| CN108504670B (en) | Construction method and application of escherichia coli cold shock solubilizing expression plasmid | |
| JP2016517687A (en) | Recombinant phage and bacterial detection method | |
| Soliman et al. | Loop mediated isothermal amplification combined with nucleic acid lateral flow strip for diagnosis of cyprinid herpes virus-3 | |
| Guan et al. | A multiplex PCR assay for the detection of five human pathogenic Vibrio species and Plesiomonas | |
| JP6467829B2 (en) | Improved RT-PCR reaction | |
| CN113278061B (en) | Method for preparing cable Ma Lutai by biochemical method | |
| KR20170030746A (en) | Primers used for LAMP reaction for the detection of Salmonella and its use | |
| JP2009077660A (en) | Mutant firefly luciferase | |
| Chen et al. | Simultaneous detection of duck hepatitis A virus types 1 and 3, and of duck astrovirus type 1, by multiplex RT-PCR | |
| CN113481284A (en) | Colorimetric nucleic acid detection kit based on constant temperature amplification and detection method | |
| KR20220041214A (en) | Immunoreactive cells armed with spatiotemporal restriction activity of cytokines of the IL-1 superfamily | |
| AU614174B2 (en) | The expression of homologous and heterologous proteins, which are able to function, on the outer membrane of e. coli and other gram-negative bacteria | |
| KR101557844B1 (en) | Primer set for loop-mediated isothermal amplification reaction for detecting iridovirus, Primer composition having the same, and Detecting method for iridovirus using the same | |
| CN109777782A (en) | A kind of universal CAR-T cell and its preparation method and application | |
| JPWO2009066673A1 (en) | Composition for nucleic acid analysis | |
| KR101559287B1 (en) | Primer set for loop-mediated isothermal amplification reaction for detecting iridovirus, Primer composition having the same, and Detecting method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |