CN113519460B

CN113519460B - Construction and application of induced uterine epithelium specific gene engineering mouse

Info

Publication number: CN113519460B
Application number: CN202110738465.7A
Authority: CN
Inventors: 苏仁伟; 吴瑶; 刘晓征
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-06-30
Filing date: 2021-06-30
Publication date: 2023-02-17
Anticipated expiration: 2041-06-30
Also published as: CN113519460A

Abstract

The invention discloses construction and application of an inducible uterine epithelium specific gene engineering mouse, wherein a Wnt7a gene expression sequence is constructed by knocking in a rtTA gene expression sequence at a fixed point behind a Wnt7a gene sequence of a mouse ^rtTA/+ Inducible uterine epithelium specific genetically engineered mouse, and TetO ^cre/+ The mice and the mice with target genes Loxp are hybridized, so that a Tet-On system can be activated after DOX is given, cre enzyme is expressed, and the target genes are knocked out. The knockout or over-expression of the gene of interest in the mouse uterine epithelial cells with temporal and spatial control can be realized, so that the function of the gene in the uterine epithelium can be researched. The technology can also realize the tracking of cell lineages in the growth and differentiation process of mouse uterine epithelium by hybridizing with a reporter gene mouse. In addition, homozygote mice (rtTA/rtTA) are also used, so that the breeding speed of the target mice is increased.

Description

Construction and application of induced uterine epithelium specific gene engineering mouse

Technical Field

The invention belongs to the technical field of biology, and particularly relates to construction and application of an induced uterine epithelium specific gene engineering mouse.

Background

The construction of the uterine epithelium specific gene engineering mouse mainly comprises the following steps:

in 2014, the Ltf-Cre genetically engineered mouse edited by Sudhansu K.Dey laboratory is a genetically engineered mouse specifically expressing Cre enzyme in uterine cavity epithelium and uterine gland, but the Cre enzyme is fully expressed only after the mouse is grown up.

Sprr2f-Cre (Small proline-rich protein 2 f) is also a knockout gene mouse of uterine epithelium, but the specificity is poor, and the leakage expression occurs in cerebellum and kidney; wnt7a-Cre is also a knockout gene mouse of the uterine epithelium, but similarly, gene editing has also occurred in the hair follicle epithelium.

Ltf-iCre: the expression of the estrogen in adults can be induced by the estrogen, but the estrogen is an important regulatory hormone in the physiological pathology of female reproduction, and has great influence on experimental results. There is leakage in immune cells, which have important functions in reproductive life, affecting experimental conclusions.

Wnt7a-Cre: expression in fetal stage, if the target gene plays an important role in the uterus in fetal stage, it may cause the development problem of uterus, and the function of the gene in the normal physiological process of adult uterus cannot be studied.

The Cre sequence of several gene engineering mice replaces the position of the corresponding gene, resulting in the deletion of the gene, and thus only heterozygotes (Cre/+) can be used.

Disclosure of Invention

The invention aims to construct a genetically engineered mouse which can knock out genes or express reporter genes in uterine epithelial cells at any time point in the process of mouse uterine development and reproduction.

The technical scheme adopted by the invention is as follows:

the invention provides a construction method of an inducible uterine epithelium specific gene engineering mouse, which comprises the following steps:

s1: genotyping mouse Wnt7a ^rtTA/+ And TetO ^cre/+ Hybridizing, screening gene type Wnt7a ^rtTA/+ TetO ^cre/+ Then the genotype is Wnt7a ^rtTA/+ TetO ^cre/+ The mice are hybridized and screened to have the genotype Wnt7a ^rtTA/rtTA TetO ^cre/+ The mouse of (1);

s2: the genotype is Wnt7a ^rtTA/rtTA TetO ^cre/+ And mTmG ^F/F The mice of (2) were crossed and screened for Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ A mouse.

In some embodiments of the invention, the Wnt7a is ^rtTA/+ Mice were constructed by knocking in rtTA gene expression sequences at a site downstream of the mouse Wnt7a gene sequence.

In some embodiments of the invention, the knock-in site is: the TGA stop codon of the mouse No. 6 chromosome Wnt7a gene is 20-30bp downstream. After the IRES-rtTA sequence is knocked in at this point, both Wnt7a protein and rtTA protein can be expressed under the control of the Wnt7a gene promoter.

In some preferred embodiments of the invention, the mouse is a C57 mouse.

In some embodiments of the invention, the method of knock-in is CRISPR/Cas9 technology.

In some embodiments of the invention, the Wnt7a in step S2 is Wnt 7b ^rtTA/rtTA TetO ^cre/+ Is a male mouse, the mTmG ^F/F Is a female mouse.

In some embodiments of the present invention, the induction is specifically induced by Doxycycline (DOX) as an inducer, and the gene engineering mouse and the breeding and identification method thereof can knock out or express a reporter gene in uterine epithelial cells at any time point in the mouse uterine development and reproductive processes, so as to knock out or express the gene or the reporter gene at any time in different physiological processes.

In some embodiments of the invention, the DOX is used at a concentration of 5mg/ml to 10mg/ml.

In some preferred embodiments of the invention, said DOX is used at a concentration of 5mg/ml or 10mg/ml.

In some preferred embodiments of the invention, the injection conditions of the newborn mouse uterine cavity DOX of PND7 are: the concentration is 10mg/ml, the volume is 2-2.5 mul/piece, and the operation is carried out once.

In some preferred embodiments of the invention, the injection conditions of the p.o. abdominal cavity DOX of the newborn mouse of PND5 are: the concentration was 10mg/ml, and the volume was 10. Mu.l/tube, once.

In some preferred embodiments of the present invention, the conditions under which the dam 15 days of gestation freely drinks DOX are: the concentration was 5mg/ml, volume 6 ml/mouse, until the mouse was born, once a day.

The invention also provides application of the construction method in preparation of a mouse model.

In some embodiments of the invention, the mouse model is an inducible uterine epithelium-specific genetically engineered mouse.

The invention also provides application of the construction method in functional research of genes in uterine epithelium.

The invention also provides application of the construction method in tracking cell lineages in growth and differentiation processes of mouse uterine epithelium.

The invention has the beneficial effects that:

the invention constructs Wnt7a by knocking in rtTA gene expression sequence at fixed point behind mouse Wnt7a gene sequence ^rtTA ^/+ Inducible uterine epithelial specific genetically engineered mouse, and TetO ^cre/+ The hybridization of the mouse and the mouse with the target gene Loxp can activate the Tet-On system after DOX is given, express Cre enzyme and knock out the target gene. Can realize the knockout or over-expression of the gene of interest in the mouse uterine epithelial cells with space-time control, thereby researching the function of the gene in the uterine epithelium. The technology can also realize the tracking of cell lineages in the growth and differentiation process of mouse uterine epithelium by hybridizing with a reporter gene mouse. In addition, the insertion site of the rtTA sequence is behind the Wnt7a gene sequence, and the two gene sequences are connected through IRES, so that the simultaneous expression of the two gene sequences can be realized, the expression and the function of the Wnt7a gene are not influenced, a homozygote mouse (rtTA/rtTA) can be used, and the breeding speed of a target mouse is accelerated.

In addition, the invention constructs a gene engineering mouse which uses Dox as an inducer and can knock out genes or report gene expression in uterine epithelial cells at any time point in the process of mouse uterine development and reproduction, and a breeding and identification method thereof. The gene or the reporter gene in different physiological processes can be knocked out or expressed at any time, and the possible mechanism of the gland generating process can be deduced finally through the gland fluorescence composition after the gland generating.

Drawings

FIG. 1 shows Wnt7a ^rtTA/+ A gene mouse constructing method.

FIG. 2 shows Wnt7a ^rtTA/+ And (5) identifying the genotype of the gene mouse.

FIG. 3 shows uterine fluorescence of a newborn mouse PND7 injected with DOX 10mg/ml, 2. Mu.l, 3 days after the uterine injection.

FIG. 4 shows uterine fluorescence of newborn mice PND7 after uterine injection of DOX 10mg/ml, 2. Mu.l, 15 days.

FIG. 5 shows uterine fluorescence of newborn mice PND7 after uterine injection of DOX 10mg/ml, 2. Mu.l, 23 days.

FIG. 6 shows uterine fluorescence after the neonatal PND5 is intraperitoneally injected with DOX 10mg/ml, 10. Mu.l, 5 days.

FIG. 7 shows the fluorescence of PND5 uterus of pregnant female mice on day 15 with free drinking water DOX 5mg/ml,6 ml/day/mouse.

Note: an objective lens: 20X.

Detailed Description

The idea of the invention and the resulting technical effects will be clearly and completely described below in connection with the embodiments, so that the objects, features and effects of the invention can be fully understood. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and those skilled in the art can obtain other embodiments without inventive effort based on the embodiments of the present invention, and all embodiments are within the protection scope of the present invention.

CRISPR/Cas9 technology: the CRISPR/Cas9 system is an adaptive immune defense mechanism formed by prokaryotic bacteria and archaea during long-term evolution. Scientists have found that in the presence of guide RNA and Cas9, the cellular genomic DNA to be edited will be regarded as viral or foreign DNA, precisely sheared, one of the most important areas in the biological and medical fields, and will increase the possibility of treating many diseases.

Cre-Loxp system: the Cre recombinase can specifically recognize a Loxp base sequence with the length of 34bp, the sequence is divided into an inverted repeat sequence with the sizes of 13bp at two ends and a spacer sequence with the size of 8bp in the middle, and the spacer sequence with the size of 8bp also determines that the Loxp sequence has directionality. The Cre-Loxp system is divided into the following three gene modification modes according to the Loxp sequence direction and position: when two Loxp sequences are on the same DNA chain and the direction is the same, shearing of a DNA fragment in the middle of the two Loxp sequences can occur; when the two Loxp sequences are on the same DNA strand and in opposite orientations, inversion of the intermediate DNA fragment occurs; when the two Loxp sequences are on two DNA strands, respectively, an exchange of DNA fragments occurs.

mTmG reporter mouse: inserting a terminator into td-tomato, namely the downstream of the expressed red fluorescent gene, adding Loxp sites at two ends of the td-tomato and the terminator, inserting Gfp, namely a green fluorescent gene behind the Loxp sites, and when Cre splicing enzyme is not expressed, the ribosome protein translates the red fluorescent protein and stops translating at the terminator, and at the moment, the red fluorescent protein is expressed; however, when the red fluorescent protein gene sequence and the terminator are cleaved after expressing Cre enzyme and cleaving the Loxp site, the ribosomal protein translates the green fluorescent protein, i.e., in cells expressing Cre enzyme, the green fluorescent protein is expressed. R26R is Rosa26Reporter safety locus Reporter gene, td-tomato is red fluorescent protein, and Gfp is green fluorescent protein.

Estrogen receptor inducible CreER system: the ligand binding region of the modified estrogen receptor is fused with Cre enzyme to form fusion protein positioned in cytoplasm, so that a Cre-Loxp system only responds to stimulation of exogenous artificially synthesized estrogen such as Tamoxifen, and after stimulation of exogenous drugs is given, cre in cytoplasm is enzymolyzed and enters cell nucleus to recognize Loxp sites for cutting. The reason why estrogen receptor inducible systems are not used is that the physiological and pathological state of the uterus is severely affected by exogenous hormone administration.

Tetracycline-inducible tetO-Cre system: the tetracycline regulatory system is divided into the Cre tool mouse (tetO-Cre) controlled by a tetracycline-responsive promoter element and the mice expressing the tetracycline transcriptional activator rtTA or tTA driven by tissue-specific drivers. tetO itself has no promoter activity, and the expression of Cre is activated only when rtTA or tTA having transcriptional activity binds to tetO, which is regulated by tetracycline or tetracycline derivative doxycycline (Dox). rtTA and tTA are Tet-ON and Tet-OFF control elements respectively, rtTA is combined with tetO when Dox exists to induce Cre expression, and is not combined with tetO when Dox does not exist, and Cre is not expressed; in contrast, tTA induces Cre expression by combining with tetO in the absence of Dox, and can not combine with tetO and not express Cre in the presence of Dox, so that the on and off of a Cre-Loxp system of a report mouse can be regulated and controlled by controlling the time and dosage of Dox administration.

Experimental animal Wnt7a ^rtTA/+ The gene mouse is constructed by Seisaku Bio Inc., the construction method is shown in figure 1 ^cre/+ Gene mouseThe mTmG gene mouse, purchased from Jackson Lab, USA, is offered as a gift by professor Jea-Wook Jeong, michigan State university.

Rat tail lysate: tris-HCl 0.24228g, KCl 0.7455 g and Triton X-100 mu L, adding distilled water to a constant volume of 200mL, adjusting the pH value of the solution to 9.0, and storing at room temperature.

Example 1

1) The genome DNA extraction steps are as follows:

1. an ear tag is marked on the ear of the mouse by using an ear tag clamp and a matched ear tag, a small section of tail tissue with the length of about 0.2cm is cut and placed in a 1.5ml EP tube, and a corresponding ear tag number is written on the EP tube.

2. Adding 200 μ l of rat tail lysate and 4 μ l of proteinase K (invitrogen) with a concentration of 20mg/ml into each EP tube, mixing uniformly, centrifuging to submerge tail tissues in the mixture, heating at 60 ℃ for 3h and 95 ℃ for 15min in a metal heater, cooling, centrifuging, and taking supernatant, namely the mouse genome DNA solution.

2) Agarose gel electrophoresis:

preparation of 2% agarose gel: 120mL of 1 XTEA working solution and 2.4g of agar powder are added into a conical flask, the conical flask is placed into a microwave oven to be heated until agarose is completely dissolved, 6 mu L of nucleic acid dye (biological engineering) is added according to the proportion of 1 to 2000, the mixture is evenly shaken and then poured into an assembled gel making device as soon as possible, and the gel making device is placed in a horizontal position to be cooled and solidified for about 30 min.

10 μ L of the sample solution was spotted, and the band size was labeled with 100bp ladders (band sizes of 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, in this order) from Dongsheng Bio Inc. Electrophoresis was performed at 120V for 30min and imaged using a gel imager.

3) The mouse genotype identification method comprises the following steps:

Wnt7a ^rtTA/+ the primers used in the genotypic test of the genemice are:

Wnt7a-WT-F3：GTGCGTGCCAGTCGAAACAA(SEQ ID NO.1)；

Wnt7a-WT-R3：TTGCTATGACGAGGCCCGAG(SEQ ID NO.2)；

Wnt7a-rtTA-F2：GTTGTGAGTTGGATAGTTGTGGAA(SEQ ID NO.3)；

Wnt7a-rtTA-R4：GAGTAATTCCAGAGCGCCGTT(SEQ ID NO.4)。

PCR procedure: 30min at 94 ℃; 30s at 94 ℃,35s at 60 ℃,35s at 72 ℃ and 35 cycles; 72 ℃ for 5min; storing at 4 ℃.

Wherein F3R3 WT:624bp, F2R4 rtaT:277bp. The results of the assay are shown in FIG. 2. Wherein, strip 1 is a negative control group, strip 2 is WT (wild type), strip 3 is rtTA/+, strip 4 is rtTA/rtTA, and strip 5 is Marker.

It can be seen that the genotype identification method can accurately and unmistakably identify the mouse genotype.

Example 2

Wnt7a ^rtTA/+ TetO ^+/+ mTmG ^F/+ The construction method mainly comprises two steps:

s1: firstly, the genotype mouse Wnt7a is used ^rtTA/+ And TetO ^cre/+ Hybridizing, and obtaining the genotype Wnt7a at the first generation ^rtTA/+ TetO ^cre/+ The probability of (2) is 1/4, then the genotypes are all Wnt7a ^rtTA/+ TetO ^cre/+ Hybridizing the pair of female and male mice to obtain the genotype Wnt7a ^rtTA/rtTA TetO ^cre/+ The probability of (2) is 1/8.

S2: the genotypes are respectively mTmG ^F/F And Wnt7a ^rtTA/rtTA TetO ^cre/+ The female and male mice of (1) are crossed, and the genotype in the offspring is Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ The mice can be used for dox induction type experiments, and the genotype is Wnt7a ^rtTA/+ TetO ^+/+ mTmG ^F/+ The mice of (a) can be used as control mice.

Example 3

On the 7 th day after birth, uterine cavity injection surgery was performed and 2. Mu.l of DOX was administered to the uterine cavity of the newborn mouse at a concentration of 10mg/ml. Wherein the uterine cavity injection operation of the newborn mouse is a technical key point, because the uterine cavity of the newborn mouse is too small, the newborn mouse is weak and still in a lactation stage, and the operation method and the recovery process of the newborn mouse after the operation need to be carefully and repeatedly tested to determine the optimal scheme. After repeated groping and practice, the following experiences are obtained:

firstly, ether with low toxicity and convenient operation is selected for the selection of the anesthetic, the operation can be started after the newborn mouse of the PND7 is anesthetized by the ether for about 1min according to the operation experience, and the operation process is controlled to be about 7min altogether.

Secondly, a cage is separated from the female mice before operation, so that the nutrition of the mice can be better ensured, and the injury of other adult mice in the cage to the postoperative mice can be avoided. The upper part of the lateral uterus is provided with an opening, the peritoneum is torn away, the uterus is found, one hand holds the forceps to lightly fix the uterus, the other hand holds the insulin needle to prick a small opening on the uterus, and then the DOX medicament in the capillary suction tube is injected into the uterus. Then the uterus is reset, blood stain at the wound is wiped and a layer of liquid wound plaster is smeared after the skin is sutured, on one hand, the pollution to the skin of the operation part can be reduced, the healing of the skin of the operation part is accelerated, and on the other hand, the blood fishy smell at the wound can be isolated, because the blood fishy smell can easily cause the condition that the female mouse eats young mice. Through a series of groping and practice, the success rate of the uterine cavity injection operation of the newborn mouse can reach more than 70 percent under the normal condition.

The operation is carried out by connecting a long hose as an injector after a capillary suction tube with the thickness of 1.8-2.2 mm is drawn on the flame of an alcohol lamp, and the operation is completely carried out under a body view mirror. The injection amount is about 2 mu L approximately, materials are drawn at the 10 th, 18 th and 30 th postnatal days of the abdomen of the newborn mouse, and the materials can be drawn at different time points:

DOX is given at the 7 th day after birth, the epithelial part of the uterine cavity of the mouse is marked to express green fluorescence at the 10 th day after birth, then the uterine of the mouse is taken at different days after operation and the fluorescence condition of the uterine of the mouse is observed, the DOX is given at the 7 th day after birth, and the fluorescence composition condition of the uterine gland of the mouse at the 10 th to 30 th day after birth is mainly observed; wherein, the uterine fluorescence of the newborn mouse PND7 after the 3d is shown in figure 3 after the uterine cavity is injected with DOX 10mg/ml 2.5. Mu.l, the uterine fluorescence after the 15d is shown in figure 4, the uterine fluorescence of the newborn mouse PND7 after the uterine cavity is injected with DOX 10mg/ml 2.5. Mu.l, and the uterine fluorescence after the 23d is shown in figure 5. Is illustrated in Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ In mice, knockout and expression of a gene of interest can be induced at an early stage.

Example 4

On the 5 th day after birth, the newborn mice were injected with DOX at a concentration of 10mg/ml and a dose of 10 μ l intraperitoneally, five days later, the uterus was obtained, and the fluorescence of the uterus is shown in fig. 6. Is illustrated in Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ In mice, knockout and expression of a gene of interest can be induced at an early stage.

Example 5

At genotype mTmG ^F/F And Wnt7a ^rtTA/rtTA TetO ^cre/+ In a pair of female and male mouse breeding cages at mTmG ^F/F The concentration of DOX in drinking water is 5mg/ml and the concentration of sucrose is 1g/ml in 15 am of the female mice. The water intake of the pregnant female mouse is about 6 ml/day/mouse, so that sufficient drinking water is ensured, and the normal drinking water is recovered until the fifth day after the birth of the newborn mouse. Newborn mouse PND5 was obtained from uterus, and fluorescence of uterus is shown in FIG. 7. Description is given in Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ In mice, knockout and expression of a gene of interest can be induced at an early stage.

The present invention is not limited to the above embodiments, and various changes can be made without departing from the spirit of the present invention within the knowledge of those skilled in the art. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> construction and application of induced uterine epithelium specific gene engineering mouse

<130>

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

gtgcgtgcca gtcgaaacaa 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

ttgctatgac gaggcccgag 20

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence

<400> 3

gttgtgagtt ggatagttgt ggaa 24

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence

<400> 4

gagtaattcc agagcgccgt t 21

Claims

1. A construction method of an inducible uterine epithelium specific genetic engineering mouse comprises the following steps:

s1: genotype mouse Wnt7a ^rtTA/+ And TetO ^cre/+ Hybridizing, screening gene type Wnt7a ^rtTA/ +TetO ^cre/+ Then the genotype is Wnt7a ^rtTA/+ TetO ^cre/+ The mice are hybridized and screened to have the genotype Wnt7a ^rtTA/rtTA TetO ^cre/+ The mouse of (1);

s2: the genotype is Wnt7a ^rtTA/rtTA TetO ^cre/+ And mTmG ^F/F The mice of (2) were crossed and screened for Wnt7a ^rtTA/+ TetO ^cre/+ mTmG ^F/+ A mouse; the Wnt7a ^rtTA/rtTA TetO ^cre/+ Is a male mouse, the mTmG ^F/F Is a female mouse;

the Wnt7a ^rtTA/+ The mouse is constructed by knocking in rtTA gene expression sequence at the downstream of mouse Wnt7a gene sequence; the knock-in sites are: the TGA stop codon of the Wnt7a gene of the mouse chromosome 6 is 20-30bp downstream; the method of typing in is CRISPR/Cas9 technology;

the inducing agent is doxycycline; the concentration of the doxycycline is 5-10 mg/ml.

2. Use of the construction method of claim 1 for the preparation of a mouse model.

3. Use of the construction method according to claim 1 for the study of gene function in uterine epithelium.

4. The use of the construction method of claim 1 to achieve lineage tracing of cells during growth and differentiation of uterine epithelium in mice.