CN113512607A - Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica - Google Patents
Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica Download PDFInfo
- Publication number
- CN113512607A CN113512607A CN202110925920.4A CN202110925920A CN113512607A CN 113512607 A CN113512607 A CN 113512607A CN 202110925920 A CN202110925920 A CN 202110925920A CN 113512607 A CN113512607 A CN 113512607A
- Authority
- CN
- China
- Prior art keywords
- primer
- quality control
- standard
- enterobacter
- hepatica
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention relates to a fluorescent quantitative PCR method for detecting prawn enterobacter hepatica, which comprises a pair of specific primers taking prawn enterobacter hepatica spore wall protein SWP as a target gene and an SWP standard kit. The standard kit comprises SWP standard plasmids diluted by 10 times of gradient and bacterial suspension of SWP standard strains. The invention adopts a TBGreen fluorescent dye method, quantitatively detects the shrimp enterobacter hepatica spore wall protein SWP, has higher sensitivity and specificity, can be used for quickly detecting and diagnosing the shrimp enterobacter hepatica, and lays a foundation for monitoring and early preventing and controlling the shrimp enterobacter hepatica infection.
Description
Technical Field
The invention relates to a fluorescent quantitative PCR (polymerase chain reaction) rapid detection method for prawn enterobacter hepatica, belonging to the technical field of aquatic organism pathogen detection.
Background
Enterobacter Hepaticae (EHP) is a kind of obligate intracellular parasitism microsporidian, mainly infects intestinal epidermis and hepatopancreas of cultured prawns, and parasitizes in hepatopancreas tubule epithelial cells. The digestion and absorption functions of the prawns are reduced due to infection, the absorption of nutrient substances is influenced, obvious symptoms and death do not exist in the early stage of infection, the prawns are difficult to find, and the phenomena of slow growth, different sizes and the like of the cultured prawns can be seen after the prawns are cultured for 30-45 days. And the growth rate of the prawn individual is obviously and negatively correlated with the EHP load index in vivo. In addition, EHP infection also increases the susceptibility of penaeus vannamei to acute hepatopancreas necrosis (AHPND) and infectious hepatopancreas necrosis (SHPN) pathogens, thereby increasing the incidence of AHPND and SHPN. Therefore, the healthy development of the prawn culture industry is greatly harmed by EHP infection.
EHP was first discovered in 2004 as an unknown microsporidian in the small epithelial cells of the hepatopancreas of the slow growing prawns of thailand. Classified and named in 2009, and is considered to be a new species of intestinal epithelial cell microsporidian. Up to now, in countries of southeast Asia including China, such as Thailand, Vietnam, India, Indonesian and Malaysia, it has been reported that EHP infects Penaeus vannamei or Penaeus monodon, and has seen a wide-range prevalence, and there is no effective treatment and prevention and control method for EHP infection at present, so that establishing a rapid detection technology with high sensitivity and strong specificity is particularly important for the prevention and control of pathogens.
The length of the EHP polypide is about 0.7-1.1 um, the EHP polypide is difficult to find by conventional optical microscopy, and the currently established rapid detection technology mainly takes the SSU rRNA sequence as a target gene, so that the problem of false positive is considered to be caused, and the detection is not beneficial to pathogen monitoring. And the detection with the sporoderm protein SWP sequence as the target gene has higher specificity. At present, a nested-PCR detection technology taking SWP as a target gene is established, but the technology can only be used for qualitative detection, is complex to operate, needs a plurality of pairs of primers to carry out multiple amplification reactions, and is long in time consumption. Therefore, it is important to establish a rapid and simple quantitative detection technique and a diagnostic method using SWP as a target gene.
Disclosure of Invention
Aiming at the problems, the invention designs a primer by taking EHP spore wall protein SWP as a target gene, and explores the optimal reaction condition and reaction system to establish a fluorescent quantitative PCR method. The method has strong specificity and high sensitivity, can realize quick, effective and accurate quantitative detection, and is suitable for monitoring, diagnosing and early preventing the enterobacter hepatica of prawns.
In order to achieve the purpose, the technical scheme adopted by the invention comprises the following steps:
the invention provides a primer for fluorescence quantitative detection of prawn enterobacter hepatica SWP, which comprises the following components:
the nucleotide sequence of the primer EHP146F is shown as SEQ ID NO. 1;
the nucleotide sequence of the primer EHP146R is shown as SEQ ID NO. 2;
the amplified nucleotide sequence is shown as SEQ ID NO. 3.
The invention provides a standard kit for detecting a SWP full-length ORF sequence containing prawn enterobacter hepatica, which comprises a SWP standard plasmid (10)1～107) And a specific primer as described in claim 1; in the embodiment, according to an EHP-SWP sequence provided by Ncbi, a primer is designed, the ORF full length of the EHP-SWP is obtained by PCR amplification, and after a vector is connected, the clone competence is transformed; selecting positive clones, expanding culture, extracting plasmids, measuring the concentration of the plasmids, and converting the copy number of the plasmids per microliter according to the Avoganlo constant; gradient dilution of plasmid to establish standards and copying of plasmidEach number is 101～107copies/ul。
The invention provides a positive quality control product and a negative quality control product, wherein the positive quality control product is a strain suspension containing EHP-SWP plasmid, and the negative quality control product is a strain suspension containing empty vector.
The invention provides a method for detecting EHPSWP by adopting the primer group, which comprises the following steps:
1) collecting a sample and extracting DNA: taking whole individual from larval shrimp, young shrimp and less than 2cm, and taking hepatopancreas from larval shrimp, sub-adult shrimp and adult shrimp larger than 2 cm. 10-50 mg of sample is collected, and total DNA is extracted by adopting a QiagenDNAMiniKit kit according to the kit description strictly.
2) Extracting DNA from the sample, and standard plasmid (10)1～107) And placing the positive quality control product and the negative quality control product in a fluorescent quantitative PCR reaction system for PCR amplification and fluorescent signal monitoring. The total volume of the fluorescent quantitative PCR reaction system is 25 ul. Primers comprising sequences described by TB Green Premix Ex Taq II (TliRNaseH Plus) (2X) 12.5ul, EHP146F and EHP146R each 1.25ul, template (target sample DNA or standard plasmid) 1ul, and sterile water 9 ul.
3) The fluorescent quantitative PCR amplification reaction program is 30s at 95 ℃; 40 cycles, 95 ℃ for 5s and 51 ℃ for 30 s.
4) The method also comprises a positive control and a negative control, wherein the positive control quality control and the negative control quality control are respectively used as templates in the reaction system. The method also includes a no template control.
5) And (5) judging a result: and drawing a standard curve according to the Cq value of the standard plasmid, and calculating the copy number of the EHP contained in the target sample according to the standard curve and the amplified Cq value of the target sample. The Cq of the sample is less than 35, an obvious S-shaped amplification curve is formed, the result is positive, and the EHP infection copy number can be calculated by combining a standard curve; the sample Cq has a prime number and no obvious S-shaped amplification curve, and the result is negative. The positive quality control Cq value is less than 35, an obvious S-shaped amplification curve exists, meanwhile, the negative quality control Cq template pair and the template-free control Cq template pair do not have an obvious S-shaped amplification curve, and the judgment result is effective. The Cq value of the positive quality control substance is more than or equal to 35 or the Cq values of the negative quality control substance and the template-free control are less than 35, the reaction is invalid
Compared with the prior art, the invention has the following advantages:
the invention designs a primer according to an EHPSWP sequence, provides a real-time fluorescence quantitative PCR detection method taking SWP as a target site, and detects the infection of EHP by SWP gene detection through an absolute fluorescence quantitative PCR technology. The invention avoids the false positive problem of detection by taking the SSU gene as a target spot, and has higher specificity; compared with the established nested-PCR detection technology, the sensitivity of detection is improved, and the lowest copy number of detection reaches 101The detection time is greatly shortened, and all reactions can be completed within 2 h. In addition, the kit realizes quantitative detection, is suitable for detection and diagnosis of EHP, and has higher application value in EHP infection monitoring, epidemiology research and research on EHP infection mechanism and the correlation between the EHP infection mechanism and a host.
Drawings
FIG. 1 is a graph showing the melting profile of primers in example 1 of the present invention;
FIG. 2 is a graph showing the real-time fluorescence quantitative PCR amplification curve of the gradient dilution standard plasmid in the embodiment 1 of the present invention;
FIG. 3 is a standard curve diagram of the construction of real-time fluorescence quantitative PCR of gradient dilution standard plasmid in the embodiment 1 of the present invention;
FIG. 4 is a graph of the EHP positive and negative quality controls, no template control real-time fluorescent quantitative PCR amplification curve in example 1 of the present invention;
FIG. 5 is a graph showing the amplification curve of the test sample in example 1 of the present invention;
FIG. 6 is a graph showing the locations of Cq values of 1 test sample on a standard curve according to an embodiment of the present invention;
FIG. 7 is a primer-specific detection chart of the present invention.
Detailed Description
The principles and features of the present invention are described below with reference to examples, which are provided for illustration only and are not intended to limit the scope of the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention.
The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The experimental methods used in the following examples are conventional methods unless otherwise specified.
The following examples were prepared with DNA extraction kits from Qiagen Biotechnology, Inc.
The primers in the following examples were synthesized by Nanjing Kinshire Biotechnology Ltd.
In the quantitative experiments in the following examples, 3 duplicate wells were made and the arithmetic mean was taken.
Example 1
The pMD19T cloning vector, DH 5. alpha. cloning competence and easy dilution for plasmid construction Standard referred to in this example were purchased from Takara Biotechnology Ltd
The EHPSWP sequence information referred to in this embodiment is disclosed in NCBI.
The implementation case constructs an EHP-SWP standard plasmid and mainly comprises the following steps:
1) extracting EHP naturally infected litopenaeus vannamei hepatopancreas total DNA;
2) designing a primer according to an EHP-SWP sequence published by Ncbi, and carrying out PCR amplification to obtain an EHP-SWPORF sequence;
3) connecting pMD19T plasmid, transforming DH5 alpha;
4) sequencing and identifying to obtain positive clone, and extracting plasmid after amplification culture;
5) measuring the plasmid concentration by a Nanodrop nucleic acid determinator, and converting the EHP infection copy number according to the Avogastrol constant;
6) the plasmid was diluted with an easy dilution 10-fold gradient to a copy number of 101～107Constructing a standard product;
7) and (3) identifying the bacterial suspension of the correct SWP clone bacterial strain as a positive control quality control product by sequencing, and identifying the bacterial suspension of the clone bacterial strain containing the empty pMD19T vector as a negative control quality control product.
EXAMPLE 2 screening of specific primers
On the basis of the primary screening, the following 2 pairs of primers are finally determined to carry out multiple groups of comparison experiments:
primer pair 1EHP 146F: TGGCGGCACAATTCTCAA
EHP146R：GCTGTTTGTCTCCAACTGTA
Primer pair 2F: TGGCGGCACAATTCTCAAACAT
R：GCTGTGTCTGTGTAAATATCGTCTC
TB Green Premix Ex Taq II (TliRNaseH Plus) (2X) was purchased from Takara Biotechnology Ltd
The implementation case detects the EHP infection amount in the small shrimps (<2cm) of the Penaeus vannamei Boone and the grown shrimps with slow growth by constructing a standard curve, and comprises the following specific steps:
1. sample collection and DNA extraction: taking whole individual from larval shrimp, young shrimp and less than 2cm, and taking hepatopancreas from larval shrimp, sub-adult shrimp and adult shrimp larger than 2 cm. 10-50 mg of sample is collected, and the total DNA of the sample is extracted by adopting a QiagenDNAMiniKit kit strictly according to the kit instructions.
2. And (3) fluorescent quantitative PCR detection:
1) the reaction system was as follows, with a total volume of 25 ul: TB Green Premix Ex Taq II (TliRNaseH Plus) (2X): 12.5ul of each primer, 1.25ul of each primer of the primer pair, 1ul of template and 9ul of sterilized water.
The templates were respectively standard plasmids (10)1-107copies/ul), sample DNA, negative quality control substance and positive quality control substance, each reaction is provided with 3 repeated holes, and a template-free control is set.
2) And (3) amplification reaction program: 30s at 95 ℃ for 1 cycle; 5s at 95 ℃ and 30s at 51 ℃ (fluorescence collected), 40 cycles;
3) outcome decision (from Cq value): standard plasmid (10) according to gradient dilution1-107copies/ul) to construct a standard curve, and the sample results are judged as follows
Through experiments, the practical use effect difference of the two groups of primer pairs is as follows:
and determining the adopted primer pair 1 as a final detection primer according to a screening principle of high specificity, small Cq value, small detection limit value and good repeatability.
TB Green Premix Ex Taq II (TliRNaseH Plus) (2X) was purchased from Takara Biotechnology Ltd
The implementation case detects the EHP infection amount in the small shrimps (<2cm) of the Penaeus vannamei Boone and the grown shrimps with slow growth by constructing a standard curve, and comprises the following specific steps:
1. sample collection and DNA extraction: taking whole individual from larval shrimp, young shrimp and less than 2cm, and taking hepatopancreas from larval shrimp, sub-adult shrimp and adult shrimp larger than 2 cm. 10-50 mg of sample is collected, and the total DNA of the sample is extracted by adopting a QiagenDNAMiniKit kit strictly according to the kit instructions.
2. And (3) fluorescent quantitative PCR detection:
1) the reaction system was as follows, with a total volume of 25 ul: TB Green Premix Ex Taq II (TliRNaseH Plus) (2X): 12.5ul, 1.25ul each of primers for EHP146F and EHP146R sequences, 1ul template, and 9ul sterile water.
The templates were respectively standard plasmids (10)1-107copies/ul), sample DNA, negative quality control substance and positive quality control substance, each reaction is provided with 3 repeated holes, and a template-free control is set.
2) And (3) amplification reaction program: 30s at 95 ℃ for 1 cycle; 5s at 95 ℃ and 30s at 51 ℃ (fluorescence collected), 40 cycles;
3) outcome decision (from Cq value): standard plasmid (10) according to gradient dilution1-107copies/ul) to construct a standard curve, and the sample results are judged as follows
The results of the above experiments are shown in FIGS. 1-6.
FIG. 1 is a graph of primer melting curves showing a single peak indicating no non-specific amplification.
FIGS. 2 and 3 show the standards in example 1 of the present inventionA particle real-time fluorescence quantitative PCR amplification curve and a constructed standard curve graph, wherein the abscissa represents lg plasmid copy number (x), the ordinate is Cq value, the constructed standard curve is Cq-3.233 lgx +37.608, the amplification efficiency E is 103.9%, and the correlation coefficient is R2＝0.999。90％<E<105％，R2>And the standard deviation of the Cq value among all gradient repeated samples is less than 0.98, which indicates that the quantification is accurate and can be used for detecting position samples.
FIG. 4 is a graph of the real-time fluorescence quantitative PCR amplification curve of EHP positive and negative quality control products without template control in example 1 of the present invention, the results show that the Cq value of the positive quality control product is 19.89<35 and has an obvious S-type amplification curve, and the negative quality control product and the template control without amplification show that the experimental results are effective.
FIGS. 5 and 6 are graphs showing the amplification curves of two samples and their positions on the standard curve, which were measured in example 1 of the present invention. The results showed that the value of DNACq extracted from adult shrimp was 20.28 and the number of copies calculated from the standard curve was 2.29 x 105The shrimp DNACq value was 28.50 and the copy number calculated from the standard curve was 6.57 x 102。
In the embodiment, total DNA of IHHNV, SHIV and WSSV positive infection samples and SPF shrimp samples is extracted as a template, fluorescent quantitative PCR detection is carried out, a positive quality control product is used as a positive control, and the detection method and the detection system are as in embodiment 2. As shown in FIG. 7, only the positive control was amplified, and no band was observed in any of the other samples, indicating that the established method has high specificity.
In conclusion, the EHP fluorescent quantitative PCR detection method is established by using the EHP-SWP as a target gene design primer. The method has the advantages of high specificity and sensitivity, simple and convenient operation and rapidness, can be used for quantitative detection of EHP infection, is suitable for early diagnosis and real-time monitoring of EHP infection, and is suitable for relevant research on EHP etiology and the correlation between the EHP etiology and a host.
The above-described embodiments are merely illustrative of the principles and applications of the present invention, and are not intended to be limiting. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.
Sequence listing
<110> Hangzhou city agriculture technology promotion center
<120> primer and method for fluorescent quantitative PCR detection of shrimp liver enterosporidium
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tggcggcaca attctcaa 18
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gctgtttgtc tccaactgta 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tggcggcaca attctcaaac at 22
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gctgtgtctg tgtaaatatc gtctc 25
Claims (6)
1. A specific primer for a fluorescent quantitative PCR method for rapidly detecting prawn enterobacter hepatica is characterized by comprising a primer EHP146F and a primer EHP146R,
the nucleotide sequence of the primer EHP146F is shown as SEQ ID NO. 1;
the nucleotide sequence of the primer EHP146R is shown as SEQ ID NO. 2;
the amplified sequence is 146 bp.
2. A standard kit for detecting SWP gene of prawn enterobacter hepatica, which is characterized by comprising SWP standard plasmid and the specific primer of claim 1.
3. The kit of claim 2, further comprising a negative quality control material and a positive quality control material, wherein the negative quality control material is a bacterial suspension of a clonal strain containing empty plasmid pMD19T, and the positive quality control material is a bacterial suspension of a SWP clonal strain.
4. A fluorescence quantitative PCR method for detecting prawn enterobacter hepatica is characterized in that the method adopts the standard kit of claim 2 or 3, and the method comprises the following steps:
step 1: collecting and extracting samples, wherein larval shrimps, juvenile shrimps and juvenile shrimps smaller than 2cm are taken as complete individuals, and the juvenile shrimps larger than 2cm, sub-adult shrimps and adult shrimps are taken as hepatopancreas; collecting 10-50 mg of a sample, and extracting total DNA of the sample by adopting a QiagenDNAMiniKit kit;
step 2: placing the extracted sample to be detected and the standard plasmid in a fluorescent quantitative PCR reaction system for PCR amplification and fluorescent signal monitoring; the PCR reaction system comprises the primer and a Takara TB Green Premix Ex TaqTM II reagent; setting positive quality control substances, negative quality control substance control substances and no-template control substances at the same time;
and step 3: drawing a standard curve according to the Cq value of standard plasmid amplification;
and 4, step 4: calculating the EHP copy number contained in the target sample according to the standard curve and the amplified Cq value of the sample to be detected; wherein: the sample Cq is less than 35, an obvious S-shaped amplification curve is formed, the result is positive, and the copy number can be calculated according to the Cq value and a standard curve; the sample Cq is a standard curve without an obvious S-shaped amplification curve, and the result is negative; the positive quality control Cq value is less than 35, an obvious S-shaped amplification curve exists, meanwhile, the negative quality control Cq template pair and the template-free control Cq template pair do not have an obvious S-shaped amplification curve, and the judgment result is effective. The positive quality control Cq value is more than or equal to 35 or the negative quality control Cq value and the no-template comparison Cq value are less than 35, and the judgment result is invalid.
5. The detection method as claimed in claim 4, wherein the total volume of the fluorescent quantitative PCR reaction system is 25ul, and comprises TB Green Premix Ex Taq II (TliRNaseH Plus) (2x) 12.5ul, 1.25ul of each of the primer EHP146F and the primer EHP146R, 1ul of the sample DNA or the standard plasmid to be detected, and 9ul of sterilized water.
6. The detection method according to claim 4, wherein the fluorescent quantitative PCR amplification reaction program is 95 ℃ for 30 s; 40 cycles, 95 ℃ for 5s and 51 ℃ for 30 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110925920.4A CN113512607A (en) | 2021-08-12 | 2021-08-12 | Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110925920.4A CN113512607A (en) | 2021-08-12 | 2021-08-12 | Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113512607A true CN113512607A (en) | 2021-10-19 |
Family
ID=78068361
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110925920.4A Pending CN113512607A (en) | 2021-08-12 | 2021-08-12 | Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113512607A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114752695A (en) * | 2022-04-13 | 2022-07-15 | 隆科生物(青岛)有限公司 | Fluorescent detection reagent for detecting enterosporidium hepatica of prawn |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486976A (en) * | 2018-12-10 | 2019-03-19 | 浙江省农业科学院 | A kind of highly sensitive target gene, primer pair, kit and detection method of prawn liver sausage microsporidiosis |
| CN111471776A (en) * | 2020-04-13 | 2020-07-31 | 西南大学 | Shrimp liver enterocytozoon detection kit and detection method thereof |
| CN111485017A (en) * | 2019-01-29 | 2020-08-04 | 广东美格基因科技有限公司 | Fluorescent quantitative PCR method for detecting prawn enterogaster hepatica and corresponding kit |
| CN111635953A (en) * | 2020-06-10 | 2020-09-08 | 广西壮族自治区水产科学研究院 | Fluorescent quantitative PCR (polymerase chain reaction) detection primer group and kit for shrimp liver enterocytozoon based on TaqMan-MGB probe |
-
2021
- 2021-08-12 CN CN202110925920.4A patent/CN113512607A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486976A (en) * | 2018-12-10 | 2019-03-19 | 浙江省农业科学院 | A kind of highly sensitive target gene, primer pair, kit and detection method of prawn liver sausage microsporidiosis |
| CN111485017A (en) * | 2019-01-29 | 2020-08-04 | 广东美格基因科技有限公司 | Fluorescent quantitative PCR method for detecting prawn enterogaster hepatica and corresponding kit |
| CN111471776A (en) * | 2020-04-13 | 2020-07-31 | 西南大学 | Shrimp liver enterocytozoon detection kit and detection method thereof |
| CN111635953A (en) * | 2020-06-10 | 2020-09-08 | 广西壮族自治区水产科学研究院 | Fluorescent quantitative PCR (polymerase chain reaction) detection primer group and kit for shrimp liver enterocytozoon based on TaqMan-MGB probe |
Non-Patent Citations (2)
| Title |
|---|
| NARONG ARUNRUT: "Rapid and sensitive colorimetric detection of microsporidian Enterocytozoon hepatopenaei (EHP) based on spore wall protein (SWP) gene using loop-mediated isothermal amplification combined with DNA functionalized gold nanoparticles as probes", 《AQUACULTURE》, vol. 533, pages 1 - 10 * |
| 汪浩: "基于孢子壁蛋白基因靶点的虾肝肠胞虫实时 荧光定量PCR 体系的构建及应用", 《浙江海洋大学学报(自然科学版)》, vol. 39, no. 6, pages 2 - 2 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114752695A (en) * | 2022-04-13 | 2022-07-15 | 隆科生物(青岛)有限公司 | Fluorescent detection reagent for detecting enterosporidium hepatica of prawn |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN105755169A (en) | Reagent kit for detecting and typing high-risk type human papilloma viruses and application of reagent kit | |
| CN115466800A (en) | Multiplex fluorescence quantitative PCR kit for detecting monkeypox virus and subtype thereof | |
| CN114774565A (en) | Kit and method for visually detecting trichomonas vaginalis based on RPA-CRISPR-Cas12a system | |
| CN113913543B (en) | EHP real-time fluorescence quantitative PCR detection primer probe combination, kit and method | |
| CN113512607A (en) | Primer and method for fluorescence quantitative PCR detection of prawn enterobacter hepatica | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN111485035A (en) | Fluorescent quantitative PCR method for detecting infectious spleen and kidney necrosis viruses of mandarin fish and corresponding kit | |
| CN111485034A (en) | Fluorescent quantitative RT-PCR method for detecting fish viral nervous necrosis and corresponding kit | |
| CN105803110A (en) | Kit capable of carrying out typing and detection on many kinds of human papilloma viruses simultaneously and applications of kit | |
| CN101381767A (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN111485017A (en) | Fluorescent quantitative PCR method for detecting prawn enterogaster hepatica and corresponding kit | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| CN106755518B (en) | Real-time quantitative PCR detection kit for portunus trituberculatus sarcocysticercus | |
| NL2031088B1 (en) | Locked Nucleic Acid-modified One-step Nested PCR Primers Set and Kit for African Swine Fever Virus | |
| CN111118014B (en) | Anti-iridovirus aptamer and construction method and application thereof | |
| CN110616279B (en) | Kit for synchronously and quantitatively detecting 3 important shrimp pathogens | |
| CN102851395B (en) | Liquid-phase chip method used for detecting infectious laryngotracheitis virus | |
| CN111518927A (en) | TaqMan probe quantitative detection method for detecting pseudomonas putida and corresponding kit | |
| CN111676300A (en) | Fluorescent quantitative PCR method for detecting toxigenic chlamydia pneumoniae and corresponding kit | |
| CN111996239A (en) | Primers and probes for detecting acinetobacter baumannii and detection method thereof | |
| CN110257387B (en) | Aptamer for identifying grass carp hemorrhagic disease virus as well as construction method and application thereof | |
| CN117230258B (en) | EB virus detection method of culture amplification combined PCR for improving sensitivity | |
| CN114836581B (en) | Primer combination for detecting pathogens of digestive tract infectious diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |