CN113502231B - Rhizopus delemar Lut-8-53 and application thereof in preparation of luteolin by biotransformation method - Google Patents

Abstract

The invention discloses a Rhizopus delemar Lut-8-53 and application thereof in preparing luteolin by a biotransformation method, wherein fermentation liquor obtained by fermenting and culturing the Rhizopus delemar Lut-8-53 is used as a biocatalyst, luteolin is used as a substrate, methanol is used as a cosolvent to form a transformation system, transformation reaction is carried out at the temperature of 30-35 ℃ under the constant-temperature oscillation condition of 150-200r/min, and the luteolin is obtained from the transformation liquor by separation and purification after the transformation reaction is finished. The invention uses the Rhizopus delemar Lut-8-53 as the biocatalyst, and has the advantages of low preparation cost, good specificity, high conversion rate, few reaction byproducts and the like. The invention is an optional production method of luteolin, and the process has the advantages of low production cost, high production efficiency, small environmental pollution and the like.

Description

Rhizopus delemar Lut-8-53 and application thereof in preparation of luteolin by biotransformation method

(I) the technical field

The invention belongs to the technical field of biochemical engineering, and particularly relates to a method for preparing luteolin by taking luteolin as a raw material through microbial transformation.

(II) background of the invention

Luteolin (luteolin) with chemical name of 3',4',5, 7-tetrahydroxyflavone, CAS number 491-70-3, molecular formula C ₁₅ H ₁₀ O ₆ The molecular weight is 286.24, and the flavonoid compound is a natural flavonoid compound, and the structure of the flavonoid compound is shown in figure 1. Originally isolated from Melilotus officinalis (Reseda odorata Linn., oleaceae). Modern pharmacological research shows that luteolin has various pharmacological activities, such as anti-inflammation, anti-allergy, uric acid reduction, anti-tumor, anti-bacteria, anti-virus and the like, and can be clinically used for relieving cough, eliminating phlegm, diminishing inflammation, reducing uric acid, treating cardiovascular diseases and the like.

Luteolin is naturally present in various plants such as honeysuckle, flowers of Chinese iridescent, herba Dracocephali, calyx seu fructus physalis, herb of pilose antler, radix Scutellariae, herba Scutellariae Barbatae, perilla frutescens and radix Lamiophlomidis Rotatae, and can be separated from these plants, but its content is relatively low, for example, luteolin content in honeysuckle is only 0.05-0.08% [ xu Xiuing, zheng Yi Min, fu Li, etc.. High performance liquid chromatography is used for determining luteolin content in honeysuckle. Food science, 2006,27 (5): 221-222](ii) a Wood in different parts of dracocephalum heterophyllum plantThe average content of luteolin is 0.31% [ the contents of luteolin in different parts of the national medicinal material, i.e. Dracocephalum heterophyllum Benth. Measured by HPLC method, 2015,21 (2): 55-56](ii) a The content of luteolin in herba Scutellariae Barbatae is 0.052% [ Chengdidi, liu Cao hong ] and the content of luteolin and apiolin in herba Scutellariae Barbatae are determined by HPLC method, proceedings of Taishan medical college, 2016,37 (12): 1340-1341]. In plants, luteolin is more often combined with glucose to form glycoside, i.e. luteolin-7-O-beta-D glucoside, also called luteolin (Cynaroside, CAS number 5373-11-5, molecular formula C) ₂₁ H ₂₀ O ₁₁ Molecular weight 448.4). In some plants, the content of luteolin is significantly higher than that of luteolin, for example, the content of luteolin in honeysuckle leaves is 0.0266%, while the content of luteolin is 0.323%, and the content of luteolin is 12.1 times of that of the former [ Lithocarpus, lithogalus, zhaoyao, etc.. HPLC method is used for measuring the content of luteolin and its glycosides in different parts of honeysuckle flower](ii) a The yield of the luteolin extracted from the traditional Chinese medicine physalis persistent calyx can reach 1.28% [ Dengyia, royal jelly, qulimna, the extraction process of the luteolin in the physalis persistent calyx is optimized, the food safety quality detection report, 2021,12 (4): 1332-1337]. The luteolin has similar physiological activity to luteolin, but some activities are far less than that of luteolin, and researches such as Lihuixiang and the like show that the anti-inflammatory activity of the luteolin is remarkably superior to that of the luteolin [ Lihuixiang, zhang Qian, liuyao, and the like]。

The application prospect of the luteolin as a medicine or a health-care food is wide, but the yield of the luteolin extracted from plant materials is low, so that the luteolin is high in price. Although a semi-synthesis method is reported, a semi-synthesis precursor is hesperidin of a plant source, and the raw material cost is high. As described above, some plant materials have a high content of luteolin and a relatively low production cost, and if the luteolin is used as a raw material and is converted into luteolin by hydrolysis and removal of glucose residues, the production routes can be widened. The acid hydrolysis method is adopted, so that the problems that the aglycone structure is easy to damage, more byproducts are generated, the product yield is low and the like exist, and in contrast, the enzymatic hydrolysis method has the advantages of no damage to the aglycone structure, high conversion rate and few byproducts. At present, research reports that enzymatic conversion is applied to luteolin extraction are available, for example, the yield of luteolin extracted from peony seed coats by pectinase-assisted ethanol extraction method such as Mengqing is improved by 4.3 times [ Mengqing, zumanyang, wanghua, etc.. Enzymolysis-assisted ethanol extraction of luteolin from peony seed coats, university of northeast forestry, 2015,43 (6): 133-135,138]; the yield of luteolin extracted from peanut shells by cellulase-assisted ethanol extraction method of Xiongqingping is improved by 2.15 times compared with direct ethanol extraction method [ Xiongqingping, zhanqiang, shiyingying, etc.. The process research of enzyme-assisted extraction of luteolin from peanut shells, brewing in China 2012,31 (1): 46-49]. The method for converting the luteolin into the luteolin by using the pure enzyme has the advantage of high efficiency, but the cost of the enzyme is higher, so that the industrial application of the method is limited.

In order to develop an economic and effective production method of luteolin, the invention adopts fermentation liquor prepared by microbial fermentation to convert luteolin into luteolin (the reaction formula is shown in figure 1). Firstly, a microbial strain with good conversion capability and specificity is obtained through screening, a high-conversion-rate strain is obtained through mutation breeding, fermentation liquor is obtained through culture, the fermentation liquor containing thalli is used as a biocatalyst to convert the luteoloside into the luteolin, and when the substrate concentration is 5g/L, the conversion yield can reach more than 85%.

Disclosure of the invention

The invention aims to provide a novel microbial strain for producing beta-glucosidase, rhizopus delemar Lut-8-53 and application thereof in preparation of luteolin by converting luteolin. The process has the advantages of low cost, simple process, good specificity and high conversion yield.

The technical scheme adopted by the invention is as follows:

the invention provides a new strain Rhizopus delemar (Rhizopus delemar) Lut-8-53, which is preserved in Guangdong province culture collection center with the preservation number: GDMCC No. 61727, preservation date 2021, 6 months and 21 days, address: building No. 59, building No. 5 of Jie No. 100 of the first Lianzhou city, guangdong province; and E, postcode: 510075.

the Rhizopus delemar Lut-8-53 is an excellent strain obtained by separating from a microorganism enrichment culture of peanut shells, screening and mutagenizing. The morphological characteristics of the Rhizopus delemar Lut-8-53 are as follows: inoculating on potato agar plate culture medium, culturing at 28 deg.C for 2d to form colony spread on all culture dishes, wherein the mycelium is dense, gray-white at the initial stage of growth, and gradually turned into gray-brown; the surface sporangium is rich, and creeping hypha and rhizoid are more; the cyst stalks are upright or curved and have branches; the sporangia is spherical, and is grayish brown or brown; the sporangium spores are spherical or elliptical and have diameters of 6-10 μm. A photograph of the colony of Rhizopus delemar Lut-8-53 is shown in FIG. 2.

The nucleotide sequence of rDNA ribose in-vivo transcribed spacer (rDNA-ITS) of the Rhizopus delemar Lut-8-53 is shown as SEQ ID NO. 1.

The invention also provides an application of the Rhizopus delemar Lut-8-53 in preparing luteolin by bioconversion of luteolin, wherein fermentation liquor obtained by fermenting and culturing the Rhizopus delemar Lut-8-53 is used as a biocatalyst, the luteolin is used as a substrate, methanol is used as a cosolvent to form a conversion system, a conversion reaction is carried out under the constant-temperature oscillation condition of 30-35 ℃ and 150-200r/min, and after the conversion reaction is finished, the conversion solution is separated and purified, so that the luteolin is obtained from the conversion solution.

Further, in the conversion system, the final concentration of the substrate luteolin is 3-5g/L, the final concentration of the cosolvent methanol is 1-2% (preferably, methanol is used for dissolving the luteolin, and then the mixture is mixed with a biocatalyst), and the dry thallus concentration of the fermentation liquor is 1-5g/L, preferably 3-4g/L.

Further, the conversion reaction conditions are as follows: the transformation is carried out for 8 to 12 hours under the conditions of 30 to 35 ℃ and constant temperature oscillation at 150 to 200 r/min.

Further, the fermentation liquor is prepared by the following method: inoculating Rhizopus delemar Lut-8-53 to an enzyme production culture medium, and culturing for 2-3d at 30 ℃ under the constant temperature oscillation condition of 200-250r/min to obtain a fermentation broth; the final concentration of the enzyme production culture medium comprises the following components: 10-15g/L of sucrose, 5-10g/L of peptone and 3-g of yeast extract5g/L，NaCl 5g/L，MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L solvent is tap water, and the initial pH is 6.0-6.5.

Before fermentation, the rhizopus delemar Lut-8-53 strain generally needs to be activated and cultured by a plate culture medium to prepare a spore suspension, or prepare a seed solution by seed culture medium expansion culture, and then the spore suspension or the seed solution is inoculated into an enzyme production culture medium for enzyme production culture in an amount (preferably 5%) with the volume concentration of 5% -10%, wherein the fermentation culture method of the rhizopus delemar Lut-8-53 comprises the following steps:

(1) Activation culture: inoculating Rhizopus delemar Lut-8-53 in potato plate culture medium (PDA), culturing at 28-30 deg.C for 1-2d to obtain Rhizopus delemar Lut-8-53 spore, and adding sterile normal saline to prepare spore suspension; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of glucose, 20g/L of agar, and natural pH (actually measured 6.5) with the solvent being tap water;

(2) Seed amplification culture: selecting the Rhizopus delemar Lut-8-53 spores after the activation culture in the step (1), adding a spore suspension prepared by sterile normal saline into a potato liquid culture medium (PDB) according to the volume concentration of 5-10% (preferably 5%), and culturing for 1-2d under the constant temperature oscillation condition of 200-250r/min at 30 ℃ to obtain a seed solution; the final concentration of the PDB liquid culture medium comprises the following components: 200g/L of potato, 20g/L of glucose and MgSO ₄ ·7H ₂ O1 g/L, a solvent is tap water, and the pH is natural (actually measured to be 6.5);

(3) Fermentation culture: inoculating the Rhizopus delemar Lut-8-53 spore suspension activated and cultured in the step (1) or the seed solution prepared in the step (2) into an enzyme production culture medium according to the inoculum size of 5-10% of the volume concentration, and culturing for 2-3d under the constant temperature shaking condition of 200-250r/min at 30 ℃ to obtain a fermentation liquid (preferably the dry thallus concentration is 3.26-3.82 g/L). The final concentration of the enzyme production culture medium comprises the following components: 10-15g/L of sucrose, 5-10g/L of peptone, 3-5g/L of yeast extract, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L solvent is tap water, and the initial pH is 6.0-6.5.

Further, it is preferable that the enzyme production medium has a final concentration composition of: 15g/L of sucrose, 10g/L of peptone and yeast extract powder5g/L，NaCl 5g/L，MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L, solvent tap water, initial pH 6.0.

The method for separating and purifying luteolin provided by the invention comprises the following steps: after the biotransformation reaction is finished, extracting the transformation system for 1-2 times by using ethyl acetate with the same volume, combining extract liquor in a round-bottom flask, evaporating ethyl acetate to dryness under reduced pressure at 45 ℃, and adding methanol with 1/10-1/5 of the volume of the original transformation system to dissolve residues; filtering the methanol solution with filter paper, drying the filtrate under reduced pressure at 45 deg.C (preferably transferring the filtrate into another clean round-bottom flask, evaporating methanol under reduced pressure at 45 deg.C, adding small amount of methanol to dissolve residue, transferring the methanol solution into a clean culture dish, and drying under reduced pressure) to obtain luteolin crude product.

Compared with the prior art, the invention has the following beneficial effects: the invention provides a biocatalyst obtained by fermentation of Rhizopus delemar Lut-8-53, which takes luteolin as a substrate, and the conversion yield of luteolin is 85.2% when the substrate concentration is 5g/L. The invention has the technical advantages that: (1) Compared with the conversion by an acid hydrolysis method, the method has the advantages of good conversion specificity, high conversion efficiency and few byproducts. (2) Compared with pure enzyme conversion, the preparation cost of the biocatalyst is low, the feeding concentration of the substrate is high, and the product yield is high. The invention and the luteolin with lower price are used as raw materials, and the luteolin is obtained by microbial transformation, so that the method is an optional production method of the luteolin, and the process has the advantages of low production cost, high production efficiency, small environmental pollution and the like.

(IV) description of the drawings

FIG. 1 chemical reaction formula for the conversion of luteolin to luteolin.

FIG. 2 photograph of colonies of Rhizopus delemar Lut-8-53.

FIG. 3 shows a standard curve of HPLC analysis of luteolin concentration.

FIG. 4 is an HPLC analysis chromatogram of a transformed sample, A is an HPLC chromatogram of standard luteolin and luteolin; b is the HPLC profile of 0h of luteolin conversion of example 6; c is the HPLC profile of luteolin of example 6 after 8h of biotransformation.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of protection of the invention is not limited thereto:

example 1 isolation and selection of transformed strains

And crushing the dried peanut shells and sieving the crushed peanut shells through a 40-mesh sieve to obtain the peanut shell powder. Placing 25g peanut shell powder in a triangular flask, adding 25mL sterile water for wetting (maintaining loose state), culturing at 28 deg.C for 5 days, adding 100mL sterile water to obtain suspension, and diluting with sterile water to 1 × 10 ^-6 、1×10 ^-7 、1×10 ^-8 After doubling, respectively absorbing 0.1mL of diluent, coating the diluent on a potato glucose agar plate medium (PDA), culturing for 2d at the constant temperature of 28 ℃, picking mould colonies with different colors and morphologies, transferring the mould colonies to a fresh PDA plate, culturing for 2d at the constant temperature of 28 ℃ to obtain 13 strains with rich spores (the strain numbers are shown in table 1), and storing in a refrigerator at 4 ℃ for later use.

Inoculating loop spore 3 loops on the plate culture medium of each strain are respectively picked, inoculated into 50mL initial enzyme-producing culture medium (250 mL triangular bottle), shake-cultured at 30 ℃ for 2d at 200r/min, and added with luteolin methanol solution (namely, 1mg of luteolin is dissolved in 0.5mL of methanol) to ensure that the concentration of the luteolin in the conversion system is 20mg/L. The transformation system is shaken at constant temperature of 30 ℃ and 150r/min for 12h. After the conversion reaction, the conversion solution was filtered through a buchner funnel to remove the cells, extracted 1 time with 50mL ethyl acetate, the ethyl acetate was separated in a round-bottomed flask, evaporated to dryness under reduced pressure, the residue was dissolved in 1mL methanol, filtered through a 0.45 μm microporous membrane, and the sample was analyzed for the concentration of luteolin by HPLC.

HPLC analysis of the luteolin concentration in the fermentation broth conversion samples of different strains, and calculation of the luteolin conversion yield (Table 1), thereby comparing the ability of different strains to enzymatically convert luteolin to luteolin. Of the 13 strains, the strain numbered Lut-8 transformed luteolin has the highest yield, the concentration of luteolin in the transformed solution is 7.96mg/L, and the transformation yield is 62.4%.

TABLE 1 concentration and yield of luteolin produced by conversion of luteolin to luteolin by different strains

The PDA plate culture medium is prepared according to the following components and methods: cleaning potato, peeling, cutting into small blocks with side length of about 1cm, weighing 200g, adding 1000mL of tap water, boiling for 20min, filtering with 4 layers of gauze to remove residues, adding 1000mL of filtrate, adding 20g of glucose and 20g of agar, adjusting pH to natural (actually measured to be 6.5), heating until the agar is dissolved, subpackaging in triangular flasks, sterilizing at 121 ℃ for 20min by high-pressure steam, pouring into sterile culture dishes with diameter of 9cm before solidification, wherein each dish is 15-20mL.

The initial enzyme-producing culture medium is prepared by the following components and methods: 10g/L of sucrose, 5g/L of peptone, 3g/L of yeast extract, 5g/L of NaCl and MgSO ₄ ·7H ₂ O1 g/L, the solvent is tap water, and the initial pH is 6.0.

The HPLC analysis method comprises the following steps: LC-20AD high performance liquid chromatograph (Shimadzu instruments, japan), the chromatographic column is Phenomenex Luna C18 column (5 μm,250mm × 4.6 mm), and the column temperature is room temperature; a mixed solution of acetonitrile and double distilled water (glacial acetic acid with the volume concentration of 0.5 percent) in the volume ratio of 20: 80 is used as a mobile phase, the flow rate is 1.0mL/min, the detection wavelength is 350nm, and the sample injection amount is 20 mu L. The concentration of luteolin in the test sample was calculated from the standard luteolin concentration-peak area standard curve (FIG. 3) under the same analysis conditions.

The luteolin conversion yield is calculated according to the following formula:

wherein 286.2 is the molecular weight of luteolin, and 448.4 is the molecular weight of luteolin.

Example 2: mutation breeding of transformed strains

Ultraviolet irradiation mutagenesis is carried out on the strain Lut-8, and the luteolin is screened and converted into a mutant strain with high luteolin yield, and the specific method comprises the following steps:

(1) Preparation of spore liquid: inoculating strain Lut-8 into PDA plate, culturing at 28 deg.C for 2d, and placing in plate5mL of sterile physiological saline was added, the spores were suspended by using an inoculating loop under agitation, and the whole spore suspension was transferred to a flask containing 45mL of sterile physiological saline and shaken at room temperature for 15min. Filtering spore suspension to remove mycelium (filtering with 2-layer lens wiping paper on triangular funnel pad), counting spores in suspension with blood counting plate under microscope, diluting with sterile physiological saline by appropriate times, and adjusting spore number to 1 × 10 ⁸ one/mL.

(2) Mutagenesis: mutagenesis was performed under red light. 2.0mL of the spore suspension and a sterile clip were placed in a sterile petri dish with a diameter of 6cm (5 dishes in total), the petri dish was placed on a magnetic stirrer, and the mixture was irradiated for 1, 2,3, 4, and 5min under a 15W ultraviolet lamp preheated for 30min at a distance of 30 cm. 0.5mL of the irradiated spore solution was diluted with sterile water by an appropriate ratio, and 0.1mL of the thus-diluted solution was transferred to a PDA-coated plate. In the same manner, dilution of the spore liquid without ultraviolet irradiation was plated as a control to calculate the lethality. The inoculated PDA plates were wrapped with black cloth, incubated at 28 ℃ for 1 day, and colonies on the plates were counted to calculate the lethality.

(3) Screening: colonies with a mortality rate of more than 90% on PDA plates were picked and transferred to fresh PDA plates, and the mutant strains were screened as described in example 1. After 2 rounds of screening, a strain with the number of Lut-8-53 is obtained by screening 85 strains. Inoculating strain Lut-8-53 spore into 50mL initial enzyme-producing culture medium (250 mL triangular bottle, composition same as example 1), and shake culturing at 30 deg.C and 200r/min for 2d to obtain fermentation liquid containing thallus. To 50mL of the fermentation broth containing the bacterial cells, solutions of luteolin in methanol (1 mg of luteolin dissolved in 0.5mL of methanol, respectively, to give a concentration of 20mg/L, 0.15g of luteolin dissolved in 1.0mL of methanol to give a concentration of 3g/L, 0.25g of luteolin dissolved in 1.0mL of methanol, to give a concentration of 5 g/L) at different concentrations were added, and the transformation system was shaken at 30 ℃ and 150r/min for 12 hours, and the transformation yield of luteolin was calculated in the same manner as in example 1. When the concentration of the luteolin is 20mg/L, the transformation lasts for 12 hours, the transformation yield of the luteolin reaches 97.3 percent, which is 1.56 times of the transformation yield of the original strain of 62.4 percent; when the concentration of the luteolin is 3g/L, the transformation is carried out for 12h, and the transformation yield of the luteolin reaches 82.2 percent, which is 2.21 times of the transformation yield of 37.2 percent of the original strain. When the concentration of the luteolin is 5g/L, the conversion is carried out for 12h, the conversion yield of the luteolin reaches 68.1 percent, which is 2.56 times of the conversion yield of the original strain, namely 26.6 percent, and it can be seen that the activity of the screened strain Lut-8-53 for producing the enzyme to convert the luteolin into the luteolin is greatly improved.

The strain Lut-8-53 is subjected to transfer passage for 5 times, fermentation liquor prepared by fermenting the strain in each generation is converted into luteolin, the conversion yield fluctuation range of the luteolin is less than 10%, and the strain is proved to have good genetic stability.

Example 3: classification and identification of transformed strains

Inoculating the strain Lut-8-53 on a potato agar plate culture medium, and culturing at 28 ℃ for 2d to form a colony which is paved on all culture dishes, wherein hyphae are dense, are grayish white at the initial growth stage, and then gradually become grayish brown; the surface sporangium is rich, and creeping hypha and rhizoid are more; the cyst stalks are upright or curved and have branches; the sporangia is spherical, and is grayish brown or brown; the sporangium spores are spherical or elliptical and have diameters of 6-10 μm. A photograph of the colony of Rhizopus delemar Lut-8-53 is shown in FIG. 2.

The strain Lut-8-53 is handed over to the Biotechnology engineering (Shanghai) Co., ltd. To measure the nucleotide sequence of rDNA ribose in vivo transcribed spacer (rDNA-ITS) as shown in SEQ ID No. 1. The sequence was BLAST aligned at NCBI (National Center for Biotechnology Information, https:// www.ncbi.nlm.nih.gov) and has more than 99% homology with 31 known strains of Rhizopus delemar (Rhizopus delemar). According to the colony characteristics of the strain Lut-8-53 and the comparison result of rDNA-ITS nucleotide sequences, the biological classification position of the strain Lut-8-53 can be determined as (refer to Mycobank, http:// www. Mycobank. Org): kingdom Fungi (Fungi), phylum mucor (mucomycata), class Mucorales (mucomycetes), order Mucorales (Mucorales), family Mucorales (Mucoraceae), genus Rhizopus (Rhizopus), rhizopus delemar.

The rDNA-ITS sequence is:

GTGGAAGTAAAAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGTTTTTCTATAGAGTACGCCTGCTGCAGTATCATCACAAACCCACACATAACATTTGTTTATGTGGTAATGGGTCGCATCGCTGTTTTATTACAGTGAGCACCTAAAATGTGTGTGATTTTCTGTCTGGCTTGCTAGGCAGGAATATTACGCTGGTCTCAGGATCTTTTTCTTTGGTTCGCCCAGGAAGTAAAGTACAAGAGTATAATCCAGCAACTTTCAAACTATGATCTGAAGTCAGGTGGGATTACCCGCTGAACTTAAGCATATCAATAGGCCGGAGGA。

in conclusion, after the strain Lut-8 separated from the microbial enrichment of the peanut shell powder is subjected to ultraviolet mutagenesis, the strain Lut-8-53, namely Rhizopus delemar Lut-8-53, is obtained by screening, and is preserved in Guangdong province microbial strain preservation center with the preservation number: GDMCC No. 61727, preservation date 2021, 6 months and 21 days, address: building No. 59, building No. 5 of Jie No. 100 of the first Lianzhou city, guangdong province; zip code 510070.

Example 4: transformation Process 1

The preparation method comprises the following steps of preparing a fermentation liquor containing thalli by using rhizopus delemar Lut-8-53 as a transformation strain and transforming luteolin into luteolin, wherein the preferable process comprises the following steps:

(1) Inoculating Rhizopus delemar Lut-8-53 plate strain stored in a refrigerator at 4 ℃ to a fresh PDA plate, and culturing at the constant temperature of 28 ℃ for 2d, wherein the composition and the preparation method of the PDA plate culture medium are the same as those in example 1;

(2) Adding 5mL of sterile normal saline into the Lut-8-53 plate culture prepared in the step (1), stirring hyphae by using an inoculating loop to suspend spores into the normal saline, sucking 2.5mL of spore suspension, inoculating into 50mL of enzyme production culture medium, and culturing for 3d under the condition of constant temperature oscillation at 30 ℃ and 250r/min to obtain fermentation liquor with the dry thallus concentration of 3.37 g/L. The final concentration of the enzyme production culture medium comprises: 15g/L of sucrose, 10g/L of peptone, 5g/L of yeast extract powder, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L, solvent tap water, initial pH 6.0. A250 mL triangular flask is filled with 50mL enzyme production medium, the opening of the triangular flask is sealed by 8 layers of gauze, and the triangular flask is sterilized for 20min by high-pressure steam at 121 ℃.

(3) Dissolving 0.25g of luteolin in 1mL of methanol, and adding into 50mL of the fermentation liquid prepared in step (2) to form a conversion system, wherein the concentration of luteolin in the conversion system is 5g/L (the volume of the conversion system is 50 mL). The transformation system is shaken at constant temperature of 30 ℃ and 150r/min for 12h.

(4) After the conversion reaction is finished, the conversion solution is filtered by a Buchner funnel to remove thalli, the filtrate is extracted by 50mL ethyl acetate for 2 times, the ethyl acetate is separated in a round-bottom flask, after the ethyl acetate is evaporated by decompression, 5mL methanol is used for dissolving the residue, the residue is filtered by a 0.45 mu m microporous membrane, and the filtrate is taken and analyzed by HPLC for the concentration of luteolin in the sample.

HPLC analysis shows that, according to the method of the embodiment, the fermentation liquid containing the Rhizopus delemar Lut-8-53 thalli is used for converting the luteolin, when the concentration of the luteolin is 5g/L, after the conversion is finished, the concentration of the luteolin in the conversion system is 2.83g/L, and the conversion yield is 88.7 percent.

Example 5: transformation Process 2

The preparation method comprises the following steps of preparing a fermentation liquor containing thalli by using rhizopus delemar Lut-8-53 as a transformation strain and transforming luteolin into luteolin, wherein the preferable process comprises the following steps:

(1) Inoculating Rhizopus delemar Lut-8-53 plate strain stored in a refrigerator at 4 ℃ to a fresh PDA plate culture medium, and culturing the plate at the constant temperature of 30 ℃ for 2 days, wherein the composition and the preparation method of the PDA plate culture medium are the same as those of the example 1;

(2) Adding 5mL of sterile normal saline into the Lut-8-53 plate culture prepared in the step (1), stirring hyphae by using an inoculating loop to suspend spores into the normal saline, sucking 5.0mL of spore suspension, inoculating into 100mL of enzyme production culture medium, and culturing for 3 days under the conditions of 30 ℃ and constant temperature shaking of 250r/min to obtain fermentation liquor with the dry thallus concentration of 3.26 g/L. The final concentration of the enzyme production culture medium comprises: 15g/L of sucrose, 10g/L of peptone, 5g/L of yeast extract powder, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L, solvent tap water, initial pH 6.0. A250 mL triangular bottle is filled with 100mL enzyme production culture medium, the opening of 8 layers of gauze is sealed, and the high-pressure steam is sterilized for 20min at 121 ℃.

(3) Dissolving 0.5g of luteolin in 2mL of methanol, adding into 100mL of the fermentation liquid prepared in step (2) to form a conversion system, and making the concentration of luteolin in the conversion system be 5g/L (the volume of the conversion system is calculated by 100 mL). The transformation system is shaken for 8h at constant temperature of 35 ℃ and 200 r/min.

(4) After the conversion reaction is finished, the conversion solution is filtered by a Buchner funnel to remove thalli, the filtrate is extracted by 100mL ethyl acetate for 2 times, the ethyl acetate is separated in a round-bottom flask, after the ethyl acetate is evaporated by decompression, 10mL methanol is used for dissolving the residue, the residue is filtered by a 0.45 mu m microporous membrane, and the filtrate is taken and analyzed by HPLC for the concentration of luteolin in the sample.

HPLC analysis shows that, according to the method of the embodiment, the fermentation liquid prepared by fermentation of Lut-8-53 containing Rhizopus delemar is used for converting luteolin, when the concentration of the luteolin is 5g/L, after the conversion is finished, the concentration of the luteolin in the conversion system is 2.77g/L, and the conversion yield is 86.8%.

Example 6: transformation and amplification and separation of luteolin

On the basis of example 5, a step of seed scale-up culture of Rhizopus delemar Lut-8-53 is added, a fermentation and transformation system is enlarged to 500mL, and the specific process steps are as follows:

(1) Inoculating Rhizopus delemar Lut-8-53 plate strain stored in a refrigerator at 4 ℃ to a fresh PDA plate culture medium, and culturing the plate at the constant temperature of 30 ℃ for 1d, wherein the composition and the preparation method of the PDA plate culture medium are the same as those of the example 1;

(2) Adding 5mL of sterile normal saline into the Lut-8-53 plate culture prepared in the step (1), stirring hyphae by using an inoculating loop to suspend spores into the normal saline, sucking 2.5mL of spore suspension, inoculating into 50mL of potato liquid culture medium (PDB), and culturing for 1d under the constant temperature shaking condition of 30 ℃ and 200r/min to obtain seed liquid with the dry thallus concentration of 1.27 g/L. The preparation method of the PDB comprises the following steps: cleaning potato, peeling, cutting into small blocks with side length of about 1cm, weighing 200g, adding 1000mL tap water, boiling for 20min, filtering with 4 layers of gauze to remove residue, adding filtrate to 1000mL, adding glucose 20g, and MgSO ₄ ·7H ₂ O1g, pH is natural (found to be 6.5). A250 mL triangular flask was filled with 50mL PDB medium, the opening of the 8-layer gauze was sealed, and the medium was sterilized by autoclaving at 121 ℃ for 20min.

(3) The seed liquid in the step (2) is concentrated by volumeInoculating 10% (50 mL) of inoculum size into 500mL of enzyme production culture medium, and culturing at 30 deg.C under constant temperature shaking at 200r/min for 2d to obtain fermentation broth with dry thallus concentration of 3.82 g/L. The final concentration of the enzyme production culture medium comprises: 15g/L of sucrose, 10g/L of peptone, 5g/L of yeast extract, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L, solvent tap water, initial pH 6.0.2L triangular bottles are filled with 500mL enzyme production culture medium, 8 layers of gauze are tied, and the mixture is sterilized by high-pressure steam at 121 ℃ for 20min.

(4) Dissolving 2.5g of luteolin in 10mL of methanol, adding into 500mL of the fermentation liquid prepared in step (2) to form a conversion system, and making the concentration of luteolin in the conversion system be 5g/L (the volume of the conversion system is 500 mL). The transformation system is shaken at constant temperature of 35 ℃ and 200r/min for 8h.

(5) After the conversion reaction is finished, the conversion solution is filtered by a Buchner funnel to remove thalli, the filtrate is extracted by 500mL ethyl acetate for 2 times, the extract liquor is combined in a round-bottom flask, the ethyl acetate is evaporated by distillation under reduced pressure at 45 ℃, and then 100mL methanol is added to dissolve residues; the methanol solution was filtered with filter paper, transferred to another clean round-bottom flask, and after evaporating the methanol to dryness under reduced pressure at 45 ℃, 10mL of methanol was added to dissolve the residue, and the methanol solution was transferred to a clean petri dish and dried under reduced pressure to obtain 2.71g of a dried product.

Weighing 1mg of the luteolin sample prepared in the step (5), dissolving the sample in 5mL of methanol, filtering the solution through a 0.45-micron microporous membrane, and analyzing the concentration of the luteolin in the sample by HPLC (high performance liquid chromatography), wherein the result shows that the purity of the prepared luteolin is 50.1% and the conversion yield is 85.2% according to the method in the embodiment. The HPLC analysis patterns of luteolin standard, untransformed sample and transformed sample are shown in FIG. 4.

Sequence listing

<110> Anhui science and technology institute

<120> Rhizopus delemar Lut-8-53 and application thereof in preparation of luteolin by biotransformation method

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 656

<212> DNA

<213> Rhizopus delemar (Rhizopus delemar)

<400> 1

gtggaagtaa aaatcgtaac aaggtttccg taggtgaacc tgcggaagga tcattaatta 60

tgttaaagcg ccttacctct tagggtttcc tctggggtaa gtgattgctt ctacactgtg 120

aaaatttggc tgagagactc agactggtca tgggtagacc tatctggggt ttgatcgatg 180

ccactcctgg tttcaggagc acccttcata ataaacctag aaattcagta ttataaagtt 240

taataaaaaa caacttttaa caatggatct cttggttctc gcatcgatga agaacgtagc 300

aaagtgcgat aactagtgtg aattgcatat tcagtgaatc atcgagtctt tgaacgcagc 360

ttgcactcta tggtttttct atagagtacg cctgctgcag tatcatcaca aacccacaca 420

taacatttgt ttatgtggta atgggtcgca tcgctgtttt attacagtga gcacctaaaa 480

tgtgtgtgat tttctgtctg gcttgctagg caggaatatt acgctggtct caggatcttt 540

ttctttggtt cgcccaggaa gtaaagtaca agagtataat ccagcaactt tcaaactatg 600

atctgaagtc aggtgggatt acccgctgaa cttaagcata tcaataggcc ggagga 656

Claims (8)

1. Rhizopus delemar Lut-8-53, deposited in the Guangdong province center for culture Collection of microorganisms with the deposit number: GDMCC No. 61727, preservation date 2021, 6 months and 21 days, address: building No. 59, building No. 5 of Jie No. 100 of the first Lianzhou city, guangdong province; and E, postcode: 510075.

2. an application of the Rhizopus delemar Lut-8-53 in preparing luteolin from the bioconversion luteolin in the claim 1 is characterized in that fermentation liquor obtained after the Rhizopus delemar Lut-8-53 is subjected to fermentation culture is used as a biocatalyst, the luteolin is used as a substrate, methanol is used as a cosolvent to form a conversion system, the conversion reaction is carried out under the constant temperature oscillation condition of 30-35 ℃ and 150-200r/min, and after the conversion reaction is finished, the luteolin is obtained from the conversion liquor through separation and purification.

3. The use as claimed in claim 2, wherein in the conversion system, the substrate luteolin is added to a final concentration of 3-5g/L, and the cosolvent methanol is added to a final concentration of 1-2% by volume; the concentration of the dry thalli of the fermentation liquor is 1-5g/L.

4. Use according to claim 2, characterized in that the conversion reaction conditions are: the transformation is carried out for 8 to 12 hours under the conditions of 30 to 35 ℃ and constant temperature oscillation at 150 to 200 r/min.

5. Use according to claim 2, characterized in that the fermentation broth is prepared as follows: inoculating Rhizopus delemar Lut-8-53 to an enzyme production culture medium, and culturing for 2-3d at 30 ℃ under the constant temperature oscillation condition of 200-250r/min to obtain a fermentation broth; the final concentration of the enzyme production culture medium comprises the following components: 10-15g/L of sucrose, 5-10g/L of peptone, 3-5g/L of yeast extract, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L solvent is tap water, and the initial pH is 6.0-6.5.

6. The use of claim 5, wherein the rhizopus delemar Lut-8-53 strain is prepared by activating and culturing a plate culture medium to prepare a spore suspension or expanding and culturing a seed solution through a seed culture medium before fermentation, and inoculating the spore suspension or the seed solution into an enzyme production culture medium at a volume concentration of 5-10% for enzyme production culture, wherein the fermentation culture method of the rhizopus delemar Lut-8-53 comprises the following steps:

(1) Activation culture: inoculating Rhizopus delemar Lut-8-53 into PDA plate culture medium, culturing at constant temperature of 28-30 deg.C for 1-2d to obtain Rhizopus delemar Lut-8-53 spore, and adding sterile physiological saline to prepare spore suspension; the final concentration composition of the PDA plate culture medium is as follows: 200g/L of potato, 20g/L of glucose, 20g/L of agar and a natural pH value, wherein the solvent is tap water;

(2) Seed amplification culture: selecting the Rhizopus delemar Lut-8-53 spores subjected to activation culture in the step (1), and adding sterile normal saline to prepareInoculating the prepared spore suspension into a PDB liquid culture medium in an amount of 5-10% of volume concentration, and culturing for 1-2d under the constant temperature oscillation condition of 200-250r/min at 30 ℃ to obtain a seed solution; the final concentration of the PDB liquid culture medium comprises the following components: 200g/L of potato, 20g/L of glucose and MgSO ₄ ·7H ₂ O1 g/L, wherein the solvent is tap water, and the pH value is natural;

(3) Fermentation culture: inoculating the Rhizopus delemar Lut-8-53 spore suspension activated and cultured in the step (1) or the seed solution prepared in the step (2) into an enzyme production culture medium according to the inoculum concentration of 5-10% by volume, and culturing for 2-3d under the constant temperature shaking condition of 200-250r/min at 30 ℃ to obtain fermentation liquor.

7. Use according to claim 5, characterized in that the final concentration of the enzyme production medium consists of: 15g/L of sucrose, 10g/L of peptone, 5g/L of yeast extract powder, 5g/L of NaCl and MgSO ₄ ·7H ₂ O 1g/L，CaCl ₂ 0.5g/L, solvent tap water, initial pH 6.0.

8. The use according to claim 2, wherein the separation and purification method comprises: after the biotransformation reaction is finished, extracting the transformation system for 1-2 times by using ethyl acetate with the same volume, combining extract liquor, evaporating ethyl acetate to dryness under reduced pressure at 45 ℃, and adding methanol with the volume of 1/10-1/5 of the volume of the original transformation system to dissolve residues; filtering the methanol solution with filter paper, and drying the filtrate at 45 deg.C under reduced pressure to obtain luteolin crude product.

Images