CN113493785B - High-strength promoter suitable for corynebacterium glutamicum and application - Google Patents
High-strength promoter suitable for corynebacterium glutamicum and application Download PDFInfo
- Publication number
- CN113493785B CN113493785B CN202010263319.9A CN202010263319A CN113493785B CN 113493785 B CN113493785 B CN 113493785B CN 202010263319 A CN202010263319 A CN 202010263319A CN 113493785 B CN113493785 B CN 113493785B
- Authority
- CN
- China
- Prior art keywords
- corynebacterium glutamicum
- promoter
- seq
- recombinant
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y203/00—Acyltransferases (2.3)
- C12Y203/01—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
- C12Y203/01031—Homoserine O-acetyltransferase (2.3.1.31)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a high-strength promoter suitable for corynebacterium glutamicum and application thereof, and belongs to the technical field of bioengineering. The invention screens and obtains 18 promoters which can improve the protein expression intensity from corynebacterium glutamicum. The promoter obtained by screening can be introduced into microorganisms for producing amino acid, and proved by verification, the promoter can strengthen the expression quantity of genes in corynebacterium glutamicum, so that the yield of related target products is improved by 2-10 times or even higher, and the promoter has important industrial application value.
Description
Technical Field
The invention relates to a high-strength promoter suitable for corynebacterium glutamicum and application thereof, belonging to the technical field of bioengineering.
Background
Corynebacterium glutamicum (Corynebacterium glutamicum), an important industrial model microorganism, is able to synthesize many useful compounds using a rough substrate. However, wild type Corynebacterium glutamicum is difficult to use directly and must be modified as necessary. Mutagenesis breeding has achieved fermentative production of many compounds by Corynebacterium glutamicum, but the yield and conversion rate of some compounds are still greatly limited. For this reason, researchers have turned to the use of metabolic engineering and synthetic biology. Overexpression of the relevant gene by plasmid expression or genomic integration of a strong promoter tends to allow more metabolic flux to the target product. For the polygenic pathway, plasmid expression is easy to cause bacterial load, and finally the synthesis of products is influenced, so that the use of genome integration expression has great advantages.
Whether plasmid or genomic integrated, the copy number of the gene has a great effect on the level of up-regulation of the gene. The number of copies of genomic integration expression is generally low, and it is difficult to achieve integration in multiple copies, so the use of a strong promoter is a simpler and more effective means. In previous studies, corynebacterium glutamicum has been provided with some strong promoters (e.g.P sod 、P tuf ) Later supplement P H36 、P 45 Equal strength promoters, however, these promoters are not satisfactory. Therefore, the screening of promoters of higher strength is of great significance for the perfecting the synthetic biological tool package of Corynebacterium glutamicum.
Disclosure of Invention
In order to solve the problems, the invention designs different primers to amplify DNA fragments by taking a corynebacterium glutamicum genome as a template, takes fluorescent protein as a reporter gene, constructs a recombinant plasmid, converts a host to obtain a recombinant strain, compares the fluorescent intensity of the recombinant strain, and screens a strong promoter.
The first object of the present invention is to provide a high-strength promoter, the nucleotide sequence of which is shown as SEQ ID NO. 1.
A second object of the present invention is to provide an expression vector comprising the promoter shown in SEQ ID NO. 1.
In one embodiment, the promoter shown in SEQ ID NO.1 is operably linked to a plasmid to obtain the expression vector; by operably linked is meant that the nucleotides having promoter activity are functionally linked to the gene sequence to initiate and mediate transcription of the target gene, which can be accomplished using gene recombination techniques known in the art, and can be site-specific DNA cleavage and ligation by using restriction and ligase enzymes known in the art.
In one embodiment, the plasmid includes, but is not limited to pEC-XK99E, pXZ10145, pXMJ19, pJYW-4, pJYW-5.
It is a third object of the present invention to provide a microbial cell containing the high-strength promoter or the expression vector.
In one embodiment, the microbial cell is a recombinant corynebacterium glutamicum.
In one embodiment, the recombinant corynebacterium glutamicum hosts corynebacterium glutamicum ATCC13032, and the promoter is introduced into the genome.
In one embodiment, the recombinant corynebacterium glutamicum hosts corynebacterium glutamicum ATCC13032 and the expression vector is transformed into corynebacterium glutamicum ATCC13032 cells.
In one embodiment, the recombinant corynebacterium glutamicum is transformed into corynebacterium glutamicum ATCC13032 by ligation of the promoter shown in SEQ ID NO.1 with the gene encoding homoserine acetyltransferase shown in SEQ ID NO.20 with vector pEC-XK99E.
A fourth object of the present invention is to provide the use of said high-strength promoter for enhancing gene or protein expression.
In one embodiment, the use is to enhance the expression of a gene in C.glutamicum.
In one embodiment, the genes include, but are not limited to, genes involved in microbial growth or metabolism.
In one embodiment, the gene is the red fluorescent protein gene mCherry.
In one embodiment, the protein is an endogenous protein or an exogenous protein.
In one embodiment, the protein is homoserine acetyltransferase and the amino acid sequence comprises the amino acid sequence shown in SEQ ID NO. 21.
A fifth object of the present invention is to provide the use of said high-strength promoter for increasing the production of O-acetyl-L-homoserine by Corynebacterium glutamicum.
In one embodiment, the application is that the promoter shown in SEQ ID NO.1 and the gene coding for homoserine acetyl transferase shown in SEQ ID NO.20 are connected with a vector pEC-XK99E and are transformed into corynebacterium glutamicum producing homoserine to obtain recombinant corynebacterium glutamicum; the recombinant Corynebacterium glutamicum is then cultured at 25-37℃and 150-250rpm for at least 36h.
In one embodiment, the application is that the promoter shown in SEQ ID NO.1 and the gene coding for homoserine acetyl transferase shown in SEQ ID NO.20 are connected with a vector pEC-XK99E and are transformed into corynebacterium glutamicum producing homoserine to obtain recombinant corynebacterium glutamicum; culturing recombinant corynebacterium glutamicum for 2-4d, transferring to CGXII culture medium containing 40-60g/L glucose and 0.1-1.0g/L yeast extract, culturing for 12-24h, transferring to 48-well or 96-well deep-well plate containing 1-2 mL fermentation culture medium with 1-2% inoculum size, and culturing at 25-37deg.C and 150-250rpm for at least 36h.
In one embodiment, the fermentation medium is a medium comprising: 60-120g/L D-glucose, 10-30g/L corn steep liquor, 10-30g/L (NH) 4 ) 2 SO 4 ，0.5-2g/L KH 2 PO 4 ，0.2-0.6g/L MgSO 4 ,，0.05-0.15g/L MnSO 4 ·H 2 O，0.005-0.012g/L FeSO 4 ·7H 2 O,0.5-1.5mg/L vitamin B 1 4-8mg/L vitamin B 6 2-6mg/L vitamin B 12 0.02-0.04mg/L biotin.
The beneficial effects are that: the promoter obtained by screening can be introduced into microorganisms for producing amino acid, and proved by verification, the promoter can strengthen the expression quantity of genes in corynebacterium glutamicum, so that the yield of related target products is improved by 2-10 times or even higher, and the promoter has important industrial application value.
Drawings
Fig. 1: construction flow chart of ptrc-mCherry recombinant plasmid.
Fig. 2: the recombinant bacteria pEC-XK99E (A) and the recombinant bacteria ptrc-mCherry (B) are respectively observed in a flat-plate culture medium, an optical microscope and a fluorescence microscope after being cultured for 72 hours.
Fig. 3: construction flow chart of pX-mCherry library.
Fig. 4: (A) Growth curves for recombinant bacteria containing ptrc-mCherry plasmid constructed for example 2; (B) Fluorescence intensity/OD for recombinant bacteria pX-mCherry containing different promoters 600 The values, wherein the values on the horizontal axis represent the promoter numbers, and the 1 st to 18 th correspond to the promoters of SEQ ID nos. 1 to 18, respectively.
Detailed Description
In order that the above-recited objects of the present invention may be understood in detail, a detailed description of the invention is provided below with reference to specific examples.
Culture medium (I):
LB medium: 10g/L peptone, 5g/L yeast powder and 10g/L sodium chloride. A20 g/L agar bar was added to prepare an LB solid medium.
LBB medium: 10g/L of peptone, 5g/L of yeast powder, 10g/L of sodium chloride and 18.5g/L of brain-heart leaching liquid; adding 20g/L agar strips to obtain LBB solid culture medium.
CGXII medium: urea 5g/L, (NH) 4 ) 2 SO 4 20g/L，KH 2 PO 4 1g/L，K 2 HPO 4 1g/L，MgSO 4 ·7H 2 O 0.25g/L，MOPS 42g/L，CaCl 2 0.01g/L，MnSO 4 0.01g/L, 0.02mg/L sodium citrate, feSO 4 ·7H 2 O 0.01g/L，ZnSO 4 ·7H 2 O 0.01g/L，CuSO 4 ·5H 2 O 0.2mg/L，NiCl 2 ·6H 2 O0.02 mg/L, biotin 25. Mu.g/L.
O-acetyl-L-homoserine fermentation medium: 100g/L D-glucose, 20g/L corn steep liquor, 20g/L (NH) 4 ) 2 SO 4 ，1g/L KH 2 PO 4 ，0.5g/L MgSO 4 ,，0.01g/L MnSO 4 ·H 2 O，0.01g/L FeSO 4 ·7H 2 O,1mg/L vitamin B 1 6mg/L vitamin B 6 4mg/L vitamin B 12 0.025mg/L biotin (pH 7.0 adjusted to aqueous ammonia)
(II) a fluorescence intensity detection method: sampling at intervals of 6-12 hr with switching time of 0 hr, sucking 100-200 μl of bacterial liquid, placing into 96 shallow well plate, and detecting suction at 600nmOptical value (OD) 600 ) The method comprises the steps of carrying out a first treatment on the surface of the Fluorescence values were then detected: excitation wavelength was 587nm, emission wavelength was 610nm, and absorbance (OD 610 )；OD 610 /OD 600 The value is the fluorescence intensity of the recombinant bacteria.
The partial promoter information in the third example is shown in Table 1.
Table 1 promoters and corresponding sequences
EXAMPLE 1 construction of recombinant plasmid ptrc-mCherry
Plasmid pEC-XK99E is used as a template, and a primer P is used trc F (CGGCATGCATTTACGTGTCGACGCGCAACGCAATTAATGTGAGTTAGC) and P trc Amplification of R (TCGCCCTTGCTCACTCTAGACATTACTAGTCTCCTTCTGGATCCCCGGGTACCGAGC) to give P trc Fragment (shown as SEQ ID NO. 19).
Linearizing plasmid pEC-XK99E using primers XK99E-F (ATGGACGAGCTGTACAAGTAACTGCAGGCATGCAAGCTTG) and XK99E-R (GTCGACACGTAAATGCATGCCG) to obtain XK99E-XXH; then using XK99E-XXH as a template, and using a primer mCherry-F (ATGTCTAGAGTGAGCAAGGGCGAGGAG) and a primer mCherry-R (TTACTTGTACAGCTCGTCCATGCCG) to amplify mCherry genes to obtain mCherry gene fragments; connecting P using Gibson assembly trc The fragment, XK99E-XXH and mCherry gene fragment give the recombinant plasmid ptrc-mCherry.
EXAMPLE 2 construction of recombinant bacterium ptrc-mCherry expressing fluorescent protein
The recombinant plasmid ptrc-mCherry was transformed into Corynebacterium glutamicum ATCC13032 by means of electric shock transformation or the like to obtain ptrc-mCherry recombinant.
The recombinant bacteria are streaked on LBB solid culture medium flat plate, transferred to CGXII culture medium containing 40-60g/L glucose after 3d culture, transferred to 48 holes or 96 holes deep hole plate containing 1.5-2mL culture medium with 1-2% inoculum size after 18-24h culture, cultured at 25-37 ℃ and 150-250rpm, and selected for 6-12h timing sampling.
The fluorescence intensity in the cell culture broth for 36 hours was measured, and the result showed that the fluorescence intensity for 36 hours of culture was 81361.82. EXAMPLE 3 construction of recombinant pX-mCherry library containing different promoters
Culturing Corynebacterium glutamicum ATCC13032,2-4 d by streak culture with LBB solid medium at 25-37deg.C, inoculating to LBB liquid medium, culturing for 12-48h, and collecting genome. Designing primers by taking a Corynebacterium glutamicum ATCC13032 genome as a template and amplifying to obtain different promoter fragments pX (pX 1, pX2 and pX3 … … pXn); wherein the nucleotide sequence of part of the promoter is shown in SEQ ID NO. 1-18.
The recombinant plasmid ptrc-mCherry constructed in example 1 was digested with restriction enzymes SalI and XbaI to give linearized fragment p-mCherry-XXH; the recombinant plasmid pX-mCherry was obtained by connecting pX with p-mCherry-XXH using Gibson assembly. The recombinant plasmid is transformed into Corynebacterium glutamicum ATCC13032 by using a shock transformation method and the like, thus obtaining a recombinant pX-mCherry library.
Strains in the recombinant pX-mCherry library were streaked on LBB solid medium plates separately, cultured for 3d, transferred to CGXII medium containing 40g/L glucose and 0.5g/L yeast powder, cultured for 20h, transferred to 48-well or 96-well deep well plates containing 2mL CGXII medium supplemented with 40g/L glucose at 2% inoculum size, cultured at 30℃and 220rpm, and sampled periodically every 6-12 h.
The result of detecting the fluorescence intensity in the cell culture solution for 36h shows that the recombinant bacterium pNCgl1676-mCherry OD constructed by the promoter fragment pNCgl1676 shown in SEQ ID NO.1 610 /OD 600 The highest value is 275880.91, which is about 5 times that of the recombinant strain psod-mCherry.
Example 4
A recombinant plasmid pNCgl1676-metX expressing metX gene with a promoter pNCgl1676 shown in SEQ ID NO.1 was constructed in the same manner as in examples 1 to 3 except that mCherry gene was replaced with metX encoding homoserine acetyltransferase shown in SEQ ID NO.20, and the recombinant plasmid pNCgl1676-metX was transformed into L-homoserine producing Corynebacterium glutamicum to obtain recombinant bacterium pNCgl1676-metX.
The recombinant plasmid psod-metX was obtained by replacing the promoter pNCgl1676 with the SOD promoter (NCgl 2826) shown in SEQ ID NO.9 and replacing the mCherry gene with the metX gene in the same host cell.
Recombinant pEC-XK99E was obtained from the same host cell but transformed with plasmid pEC-XK99E.
The recombinant bacteria psod-metX and pEC-XK99E are used as controls, the recombinant bacteria pNCgl1676-metX and the controls are measured in an O-acetyl-L-homoserine fermentation medium according to a standard amino acid measurement method, and the content of O-acetyl-L-homoserine after 48 hours of culture at 30 ℃ and 220rpm is shown as the results: the recombinant bacteria pNCgl1676-metX, psod-metX and pEC-XK99E have the O-acetyl-L-homoserine yield of 1.57g/L, 0.82g/L and 0.13g/L.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of Jiangnan
<120> a high-strength promoter suitable for Corynebacterium glutamicum and application thereof
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 295
<212> DNA
<213> Corynebacterium glutamicum
<400> 1
atgcgacagt acttttcatt aagcctaaga aaattccttt aattgacact taattgacca 60
ataagagtcg attagattgc attattaggt aatctagtga tttaatggag aataagagca 120
actggtgaag aaaaggcttg atgaaagaag ttttttatct agctagatgt tcaatcacga 180
gctttaagaa agtatgtcaa taactttgac ataacctaaa cacaataaat tatgtagtat 240
tatgtgacac taagttatta catttattat atgattggtt aggactatgg acatg 295
<210> 2
<211> 222
<212> DNA
<213> Corynebacterium glutamicum
<400> 2
tggatctgta tttgacgtgg ttcgagaccc cgcggtgttg cacaaagtgg aagtcagtgg 60
aggaatcctc gagcctgaat gtgctgcctt gatgaccgaa tttttcgaac ttcacaggta 120
acggatttat atcaatttca gggcgtggcg agcttttagt gattcacgct cctacggtgg 180
gtatcacaaa tacctcaact agaagtagga gatgagcacc ac 222
<210> 3
<211> 192
<212> DNA
<213> Corynebacterium glutamicum
<400> 3
gcttgaaccg gcatgaaaat ctcgtaccgg ttttgggctc acaaggccat ataggaactt 60
tgtaattagt tgcaggttcc aattttgggt caatgtagcg taatattgtt caaggcccat 120
gtgcgggctg tggaggacgt gcattcacgt tctggtcaaa tgaaaaacgg tgaaagggat 180
tgaacgcagc ag 192
<210> 4
<211> 219
<212> DNA
<213> Corynebacterium glutamicum
<400> 4
ctcaacgcga taggtttcaa ccataggcct gacctggctg agatgttttt ggtagaaaaa 60
ccgagtgccc gaattgtttt gtgggtgccc ggttttttct gatttaagca cgtcagaggc 120
gtagaacatt gtctgttcac actctgggtc gcaagattca tcgagaatta atggtagtac 180
ctgtggcttg agggggaatg acgtactagg cttatgggc 219
<210> 5
<211> 255
<212> DNA
<213> Corynebacterium glutamicum
<400> 5
ttatgtgtcg aggtgaatct ccggtgaatt cttatagata acttgttttt gcaggtcagg 60
acggggttaa ggggatgggt gttatctgtc agtatgtgag gagatcaagg tgttgggggt 120
tctagttgct aagatggtga aaacccgtga ggccaaaatc caactgggtg aattacccct 180
gcataaatgc atgagggctt tatacttgtc ttattattaa acttttaggg ttttgatgca 240
ggaaggtgcg agaac 255
<210> 6
<211> 206
<212> DNA
<213> Corynebacterium glutamicum
<400> 6
gcgttttcag atcatgattg attgggcgtg cctgcttttg tgttttttag ggaccccaat 60
gcgcgtgatt caactcatgt ttgatatgtg ctcctaaggt gtgtaaccta tatcgatggt 120
gtgcgtacat cttgagtgac gcaaccattt tgaagtggaa aaacttaagg cctcccgcag 180
gggagtgttc tggaaaagcg gaggat 206
<210> 7
<211> 247
<212> DNA
<213> Corynebacterium glutamicum
<400> 7
cttgattcag ggtagttgac taaagagttg ctcgcgaagt agcacctgtc acttttgtct 60
caaatattaa atcgaatatc aatatatggt ctgtttattg gaacgcgtcc cagtggctga 120
gacgcatccg ctaaagcccc aggaaccctg tgcagaaaga aaacactcct ctggctaggt 180
agacacagtt tataaaggta gagttgagcg ggtaactgtc agcacgtaga tcgaaaggtg 240
cacaaag 247
<210> 8
<211> 187
<212> DNA
<213> Corynebacterium glutamicum
<400> 8
ctacacttct ggagcgttac ggtgcttccg aagacacccc agtggtgtcc ttcaactaag 60
cccgaagttt tttaaccgcc gcattcgatc accaaatgtg gcggttttgc gtcgaaaagc 120
gtgctctttc tacacctctt tgaggttcat tttcgcggtt tcctcacaat cgcctattgt 180
taagtac 187
<210> 9
<211> 192
<212> DNA
<213> Corynebacterium glutamicum
<400> 9
tagctgccaa ttattccggg cttgtgaccc gctacccgat aaataggtcg gctgaaaaat 60
ttcgttgcaa tatcaacaaa aaggcctatc attgggaggt gtcgcaccaa gtacttttgc 120
gaagcgccat ctgacggatt ttcaaaagat gtatatgctc ggtgcggaaa cctacgaaag 180
gattttttac cc 192
<210> 10
<211> 292
<212> DNA
<213> Corynebacterium glutamicum
<400> 10
atagcggaca ttttttgacg cagatcacct tactctgaag gataaggatt cttagtgtcg 60
gtgcactttt actgatgttt cactgtggag gtcaacgact caaagtcgag aattggtggc 120
gcgtgtcact ggaattgacg cgtgaatggg gtggaagtgg acgtcgaaaa gcatttttga 180
gacgtttatg tgagcaatgt cccattttcc ctgctcacct gtatgggcac ccgcggcgga 240
agtggaattg catatggagt tttgatgata tttagcgtaa cttaaaggaa ca 292
<210> 11
<211> 161
<212> DNA
<213> Corynebacterium glutamicum
<400> 11
cccccttttg ggtgtccaga atccaaaatt ccgggcacaa aagtgcaaca atagatgacg 60
tgcgggttga tacagcccaa gcgccgatac atttataatg cgcctagata cgtgcaaccc 120
acgtaaccag gtcagatcaa gtgccccagg aggcccttca g 161
<210> 12
<211> 202
<212> DNA
<213> Corynebacterium glutamicum
<400> 12
acctactcct acgaccccga agtcaggttc cgctccatag ctgcacttgg cacggcatgg 60
aattagtgtc aaaagcctca aaaatactgg tactaaccag ctgtgcggat cgggtatccg 120
cgctacactt agaggtgtta gagatcatga gtttccacga actgtaacgc aggattcacc 180
aatcaatgaa aggtcgaccg ac 202
<210> 13
<211> 213
<212> DNA
<213> Corynebacterium glutamicum
<400> 13
atcaccgtgg aacaaggacg attcggcgca atgatgaagg tcacatcggt taacgaaggc 60
cccttcaccg ttttggtcga gtgctagcca gtcaatccta agagcttgaa acgccccaat 120
gtgggggtgt taagaactcc ataaaagcgc ttgggaactt tttgtggaag cagtccgttg 180
aacctcttga accgcgaatt taggaggcca gtt 213
<210> 14
<211> 300
<212> DNA
<213> Corynebacterium glutamicum
<400> 14
cagtgttacc ccctaagact acccctttcc attgcataca aaggaaatac atatagactt 60
ttgggcatta gattacctcg ataaaagttt agggaatcta aattcattga tcaagacttg 120
ctgtcgccta gctctaattc acttgagccc ggctgctaaa ggtcaagatc attgaatgca 180
ctacttgcta gcagtcatct gaaaaaacga cgttggttcg tagtcgctgg aaatttaata 240
attcctccgt ccccttcaac tagggggtgg aaacccgact atttccgaag gactattctc 300
<210> 15
<211> 251
<212> DNA
<213> Corynebacterium glutamicum
<400> 15
tttttgaatg tgtctgtatg attttgcatc tgctgcgaaa tctttgtttc cccgctaaag 60
ttgaggacag gttgacacgg agttgactcg acgaattatc caatgtgagt aggtttggtg 120
cgtgagttgg aaaaattcgc catactcgcc cttgggttct gtcagctcaa gaattcttga 180
gtgaccgatg ctctgattga cctaactgct tgacacattg catttcctac aatctttaga 240
ggagacacaa c 251
<210> 16
<211> 246
<212> DNA
<213> Corynebacterium glutamicum
<400> 16
cagtctatat cgaaccgatg agagcaatcc ccaagtattt cccacccctg tttttaggta 60
cacctaccgc cgaattttgg acgttaaaca agcctgcacc cccacattta ggagtggatt 120
gtgccttatt tctcacactt tctattaccc acctcactct aggggtggac tccagtgttt 180
cgcgacaaca caatgagtaa gcttgtgaca gccgtattta attctcagta agaaatgagt 240
gatttc 246
<210> 17
<211> 233
<212> DNA
<213> Corynebacterium glutamicum
<400> 17
ggactgttgt gcgggtgtgt aaattaattc cagtcagcgc gaccaacaac gccccaacac 60
ataagagatt atgtggacag tgaggcggat ctaggaaaac aaacgctcga caaaccaaca 120
acacttcatc gaagtcaaca aacaccgatt tggtgaaagt aaacaagatg aagtaacgtt 180
gaacaagctg ccaacaagac accaacacaa acaaatgttg atgctcttat ggt 233
<210> 18
<211> 202
<212> DNA
<213> Corynebacterium glutamicum
<400> 18
gcgtggtgct tctgtgaata gagttgtttg agcgactaga gttaaggcca tgactgtcag 60
aaacggcgca cccaagcggg gaagctcacg atcatcggga aagtcgacgg ggccaaaaac 120
caccgcgacg accaggcgaa gcaaaccaac aaccagcacc tctcggggtg gccggtcaga 180
gactgctgcg tttacaacat cg 202
<210> 19
<211> 350
<212> DNA
<213> artificial sequence
<400> 19
gcgcaacgca attaatgtga gttagcgcga attgatctgg tttgacagct tatcatcgac 60
tgcacggtgc accaatgctt ctggcgtcag gcagccatcg gaagctgtgg tatggctgtg 120
caggtcgtaa atcactgcat aattcgtgtc gctcaaggcg cactcccgtt ctggataatg 180
ttttttgcgc cgacatcata acggttctgg caaatattct gaaatgagct gttgacaatt 240
aatcatccgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca cacaggaaac 300
agaccatgga attcgagctc ggtacccggg gatccagaag gagactagta 350
<210> 20
<211> 1134
<212> DNA
<213> Corynebacterium glutamicum
<400> 20
atgcccaccc tcgcgccttc aggtcaactt gaaatccaag cgatcggtga tgtctccacc 60
gaagccggag caatcattac aaacgctgaa atcgcctatc accgctgggg tgaataccgc 120
gtagataaag aaggacgcag caatgtcgtt ctcatcgaac acgccctcac tggagattcc 180
aacgcagccg attggtgggc tgacttgctc ggtcccggca aagccatcaa cactgatatt 240
tactgcgtga tctgtaccaa cgtcatcggt ggttgcaacg gttccaccgg acctggctcc 300
atgcatccag atggaaattt ctggggtaat cgcttccccg ccacgtccat tcgtgatcag 360
gtaaacgccg aaaaacaatt cctcgacgca ctcggcatca ccacggtcgc cgcagtactt 420
ggtggttcca tgggtggtgc ccgcacccta gagtgggccg caatgtaccc agaaactgtt 480
ggcgcagctg ctgttcttgc agtttctgca cgcgccagcg cctggcaaat cggcattcaa 540
tccgcccaaa ttaaggcgat tgaaaacgac caccactggc acgaaggcaa ctactacgaa 600
tccggctgca acccagccac cggactcggc gccgcccgac gcatcgccca cctcacctac 660
cgtggcgaac tagaaatcga cgaacgcttc ggcaccaaag cccaaaagaa cgaaaaccca 720
ctcggtccct accgcaagcc cgaccagcgc ttcgccgtgg aatcctactt ggactaccaa 780
gcagacaagc tagtacagcg tttcgacgcc ggctcctacg tcttgctcac cgacgccctc 840
aaccgccacg acattggtcg cgaccgcgga ggcctcaaca aggcactcga atccatcaaa 900
gttccagtcc ttgtcgcagg cgtagatacc gatattttgt acccctacca ccagcaagaa 960
cacctctcca gaaacctggg aaatctactg gcaatggcaa aaatcgtatc ccctgtcggc 1020
cacgatgctt tcctcaccga aagccgccaa atggatcgca tcgtgaggaa cttcttcagc 1080
ctcatctccc cagacgaaga caacccttcg acctacatcg agttctacat ctaa 1134
<210> 21
<211> 377
<212> PRT
<213> Corynebacterium glutamicum
<400> 21
Met Pro Thr Leu Ala Pro Ser Gly Gln Leu Glu Ile Gln Ala Ile Gly
1 5 10 15
Asp Val Ser Thr Glu Ala Gly Ala Ile Ile Thr Asn Ala Glu Ile Ala
20 25 30
Tyr His Arg Trp Gly Glu Tyr Arg Val Asp Lys Glu Gly Arg Ser Asn
35 40 45
Val Val Leu Ile Glu His Ala Leu Thr Gly Asp Ser Asn Ala Ala Asp
50 55 60
Trp Trp Ala Asp Leu Leu Gly Pro Gly Lys Ala Ile Asn Thr Asp Ile
65 70 75 80
Tyr Cys Val Ile Cys Thr Asn Val Ile Gly Gly Cys Asn Gly Ser Thr
85 90 95
Gly Pro Gly Ser Met His Pro Asp Gly Asn Phe Trp Gly Asn Arg Phe
100 105 110
Pro Ala Thr Ser Ile Arg Asp Gln Val Asn Ala Glu Lys Gln Phe Leu
115 120 125
Asp Ala Leu Gly Ile Thr Thr Val Ala Ala Val Leu Gly Gly Ser Met
130 135 140
Gly Gly Ala Arg Thr Leu Glu Trp Ala Ala Met Tyr Pro Glu Thr Val
145 150 155 160
Gly Ala Ala Ala Val Leu Ala Val Ser Ala Arg Ala Ser Ala Trp Gln
165 170 175
Ile Gly Ile Gln Ser Ala Gln Ile Lys Ala Ile Glu Asn Asp His His
180 185 190
Trp His Glu Gly Asn Tyr Tyr Glu Ser Gly Cys Asn Pro Ala Thr Gly
195 200 205
Leu Gly Ala Ala Arg Arg Ile Ala His Leu Thr Tyr Arg Gly Glu Leu
210 215 220
Glu Ile Asp Glu Arg Phe Gly Thr Lys Ala Gln Lys Asn Glu Asn Pro
225 230 235 240
Leu Gly Pro Tyr Arg Lys Pro Asp Gln Arg Phe Ala Val Glu Ser Tyr
245 250 255
Leu Asp Tyr Gln Ala Asp Lys Leu Val Gln Arg Phe Asp Ala Gly Ser
260 265 270
Tyr Val Leu Leu Thr Asp Ala Leu Asn Arg His Asp Ile Gly Arg Asp
275 280 285
Arg Gly Gly Leu Asn Lys Ala Leu Glu Ser Ile Lys Val Pro Val Leu
290 295 300
Val Ala Gly Val Asp Thr Asp Ile Leu Tyr Pro Tyr His Gln Gln Glu
305 310 315 320
His Leu Ser Arg Asn Leu Gly Asn Leu Leu Ala Met Ala Lys Ile Val
325 330 335
Ser Pro Val Gly His Asp Ala Phe Leu Thr Glu Ser Arg Gln Met Asp
340 345 350
Arg Ile Val Arg Asn Phe Phe Ser Leu Ile Ser Pro Asp Glu Asp Asn
355 360 365
Pro Ser Thr Tyr Ile Glu Phe Tyr Ile
370 375
Claims (9)
1. A promoter is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. An expression vector comprising the promoter of claim 1.
3. The expression vector of claim 2, wherein the promoter shown in SEQ ID No.1 is operably linked to a plasmid to obtain the expression vector; the plasmid includes pEC-XK99E, pXZ10145, pXMJ19, pJYW-4 or pJYW-5.
4. A microbial cell comprising the promoter of claim 1 or the expression vector of any one of claims 2 to 3.
5. A recombinant corynebacterium glutamicum is characterized in thatCorynebacterium glutamicum) A promoter according to claim 1 or an expression vector according to any one of claims 2 to 3 is introduced into a genome.
6. The recombinant corynebacterium glutamicum according to claim 5, wherein the recombinant corynebacterium glutamicum ATCC13032 is used as a host cell, and contains a vector pEC-XK99E in which the promoter shown in SEQ ID No.1 and the homoserine acetyltransferase gene shown in SEQ ID No.20 are linked.
7. Use of the promoter according to claim 1 for enhancing the expression of homoserine acetyltransferase.
8. Use of the promoter according to claim 1 for increasing production of O-acetyl-L-homoserine by Corynebacterium glutamicum.
9. The use according to claim 8, wherein the promoter shown in SEQ ID No.1, the gene encoding homoserine acetyltransferase shown in SEQ ID No.20 is ligated with vector pEC-XK99E and transformed into homoserine producing corynebacterium glutamicum to obtain recombinant corynebacterium glutamicum; the recombinant Corynebacterium glutamicum was then cultured at 25-37℃and 150-250rpm for at least 36h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010263319.9A CN113493785B (en) | 2020-04-07 | 2020-04-07 | High-strength promoter suitable for corynebacterium glutamicum and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010263319.9A CN113493785B (en) | 2020-04-07 | 2020-04-07 | High-strength promoter suitable for corynebacterium glutamicum and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113493785A CN113493785A (en) | 2021-10-12 |
| CN113493785B true CN113493785B (en) | 2023-10-03 |
Family
ID=77995237
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010263319.9A Active CN113493785B (en) | 2020-04-07 | 2020-04-07 | High-strength promoter suitable for corynebacterium glutamicum and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113493785B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672509B (en) * | 2022-02-24 | 2022-12-27 | 江南大学 | Corynebacterium and escherichia coli dual-expression vector with high expression capacity and construction method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108330095A (en) * | 2018-03-01 | 2018-07-27 | 江南大学 | It is a kind of accumulation N-acetyl-neuraminate recombination Corynebacterium glutamicum and its application |
| CN109722401A (en) * | 2017-10-28 | 2019-05-07 | 中国科学院天津工业生物技术研究所 | Produce novel bipseudoindoxyl dye Corynebacterium glutamicum and its construction method and application |
-
2020
- 2020-04-07 CN CN202010263319.9A patent/CN113493785B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109722401A (en) * | 2017-10-28 | 2019-05-07 | 中国科学院天津工业生物技术研究所 | Produce novel bipseudoindoxyl dye Corynebacterium glutamicum and its construction method and application |
| CN108330095A (en) * | 2018-03-01 | 2018-07-27 | 江南大学 | It is a kind of accumulation N-acetyl-neuraminate recombination Corynebacterium glutamicum and its application |
Non-Patent Citations (2)
| Title |
|---|
| O-Acetyl-L-homoserine production enhanced by pathway strengthening and acetate supplementation in Corynebacterium glutamicum;Ning Li等;《Biotechnology for Biofuels and Bioproducts》;第154卷;第1-9页 * |
| Obtaining a series of native gradient promoter-5′-UTR sequences in Corynebacterium glutamicum ATCC 13032;Ning Li等;《Microb Cell Fact》;第19卷;第1-11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113493785A (en) | 2021-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102094875B1 (en) | A Novel Isopropylmalate Synthase Variant and a Method of Producing L-Leucine Using the Same | |
| KR100838035B1 (en) | - - a microorganism of corynebacterium genus having enhanced l-lysine productivity and a method of producing l-lysine using the same | |
| KR101324369B1 (en) | Bacterium capable of producing 2-deoxy-scyllo-inosose(doi), and process for producing 2-deoxy-scyllo-inosose(doi) by using same | |
| CN110241061B (en) | Method for improving synthesis capacity of lactobacillus brevis gamma-aminobutyric acid and application thereof | |
| CN110106206B (en) | Corynebacterium glutamicum construction method for improving yield and stability of L-lysine | |
| US10738332B2 (en) | Genetically modified yeasts and fermentation processes using genetically modified yeasts | |
| CN101617038A (en) | Utilize coryneform bacteria from the carbon source that contains glycerine, to produce the method for leavened prod | |
| JP6646075B2 (en) | Microorganism producing L-lysine and method for producing L-lysine using the same | |
| JP5496356B2 (en) | Xylitol producing strain introduced with arabinose metabolic pathway and xylitol producing method using the same | |
| CN112725210A (en) | Recombinant acid-resistant yeast inhibiting lactic acid metabolism and ethanol production and method for producing lactic acid using same | |
| CN113493785B (en) | High-strength promoter suitable for corynebacterium glutamicum and application | |
| Phaff | Industrial microorganisms | |
| CN101336292B (en) | Method for production of L-glutamine | |
| EP2886642B1 (en) | Transformant of schizosaccharomyces pombe mutant, and cloning vector | |
| CN109929853B (en) | Application of thermophilic bacteria source heat shock protein gene | |
| CN101831397A (en) | Escherichia coli and method for preparing L-cysteine by using same | |
| ES2728970T3 (en) | Microorganisms that have an enhanced L-amino acid productivity and Lamino acid production process in which they are used | |
| KR102450532B1 (en) | Method for preparing violacein or deoxyviolacein using Bdellovibrio bacteriovorus | |
| CN110872595A (en) | Acid-resistant expression cassette and application thereof in organic acid production by fermentation | |
| US7033814B2 (en) | Methods for preparing yeast with improved biotin productivity using integrating plasmids encoding biotin synthase | |
| CN114717250B (en) | Method for improving cordycepin yield by modifying cordycepin based on cofactor metabolic engineering strategy and application | |
| JP5963260B2 (en) | New thermophilic acetic acid producing bacteria | |
| Ting-Ting et al. | Overproduction of glucoamylase by recombinant Aspergillus niger harboring multiple copies of glaA | |
| US6987026B1 (en) | Vector for the transformation of Phaffia rhodozyma and process of transformation thereby | |
| CN117802078A (en) | Farnesene synthase mutant for co-production of beta-farnesene and alpha-bisabolol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |