CN113484475B - Capillary sensor preparation method based on capillary phenomenon and application thereof - Google Patents
Capillary sensor preparation method based on capillary phenomenon and application thereof Download PDFInfo
- Publication number
- CN113484475B CN113484475B CN202110770283.8A CN202110770283A CN113484475B CN 113484475 B CN113484475 B CN 113484475B CN 202110770283 A CN202110770283 A CN 202110770283A CN 113484475 B CN113484475 B CN 113484475B
- Authority
- CN
- China
- Prior art keywords
- capillary
- concentration
- surfactant
- time
- aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/54—Improvements relating to the production of bulk chemicals using solvents, e.g. supercritical solvents or ionic liquids
Abstract
A capillary biosensor based on capillary phenomenon is prepared through loading surface active agent on aminated mesoporous silica sphere with positive surface, covering mesoporous silica sphere with nucleic acid aptamer with a certain base length, and modifying the adsorptivity of the covered silica sphere on the inner wall of capillary tube. When the target object to be detected exists, the aptamer on the mesoporous silica sphere can be specifically combined with the target to be detected to separate from the surface of the mesoporous particles, so that the surfactant loaded in the mesoporous particles is released. The surfactant dispersed in the aqueous solution lowers the surface tension of water, so that the liquid level of water column in the capillary tube is lowered, and the concentration of the target substance can be quantified by utilizing the change of the height of the water column in the capillary tube. The sensor does not need complex instruments, is simple and quick to operate, has low cost and wide adaptive target objects, can be used for detecting toxins, small molecules, ions, proteins and the like, and has commercial application value.
Description
Technical Field
The invention relates to the technical field of biosensors, in particular to a preparation method and application of a biosensor based on capillary phenomenon.
Background
The visual sensor can detect the signal of the analyte without using a complicated external instrument, and quantitatively detect the target molecule through the change amount of color and volume. Simple, quick, no instrument is needed for future detection trend, and visual detection results can be distinguished by naked eyes through reading. Visual sensors are very attractive detection tools that allow for rapid and on-demand monitoring of specific samples, avoiding expensive and complex instrumentation.
Capillary phenomenon is a common natural phenomenon. The movement of the water column in the capillary can be described by Jurin's law. The surface tension of a liquid is a property of the liquid itself and is primarily determined by the liquid itself. The surfactant reduces the surface tension of water by adsorbing at the gas-liquid two-phase interface, and also reduces the oil-water interface tension by adsorbing between liquid interfaces. In general, we can measure and represent the surface tension of a liquid by the elevation of the capillary tube above the liquid surface.
Mesoporous Silica Nanoparticles (MSNs) have the characteristics of stability, biocompatibility, large specific surface area and high pore volume, and are widely used in gating systems, which can retain payloads and release upon preset stimuli. Mesoporous silica nanoparticles have been used to load small or large molecular substances such as fluorescent agents, electron transfer media, nanoclusters, enzymes, etc., which can be effectively encapsulated and released under certain conditions. However, to date, no document or patent has been reported on the use of mesoporous silica as a carrier for surfactants.
Disclosure of Invention
The invention aims to provide a simple, effective, low-cost and visual detection method.
In order to achieve the above purpose, the invention adopts the technical scheme that: a capillary biosensor based on capillary phenomenon is prepared as adsorbing mesoporous silica sphere with surface active agent encapsulated by nucleic acid aptamer on inner wall of capillary, utilizing specific binding of target to be detected to nucleic acid aptamer solution Feng Jiekong, releasing surface active agent in hole to change surface tension of liquid to cause liquid level rising through capillary phenomenon to change so as to achieve visual detection purpose.
The preparation method of capillary biosensor based on capillary phenomenon utilizes an aminated mesoporous silica, and specifically comprises the following steps:
(1) Loading of surfactant:
aminated mesoporous silica MSN-NH 2 Dispersing the ultrasonic wave into a surfactant with a certain concentration, oscillating and loading for a period of time, and centrifuging;
(2) Sealing cover of nucleic acid aptamer:
taking mesoporous silica spheres loaded with the surfactant in the step (1), adding a certain concentration of nucleic acid aptamer with proper base length, carrying out ultrasonic treatment, carrying out constant-temperature water bath, adding a proper amount of organic solvent to enhance the adhesion between the aptamer and the surface of the silica spheres, centrifuging, cleaning and carrying out vacuum drying;
(3) Modification of the inner wall of the capillary:
will be cleanThe dried capillary tube is obliquely absorbed with cationic polymer water solution with certain concentration, and is kept stand for a period of time at room temperature, the capillary tube is soaked and cleaned by ultrapure water, and then the capillary tube is dried by high-purity nitrogen; MSN-NH capped in (2) the capillary having a certain height 2 Standing and adsorbing the dispersion liquid for a period of time, and then drying the inner tube by nitrogen;
(4) Drawing a standard curve and detecting a target object:
vertically placing the modified capillary tube in the step (3) into standard solution or solution to be detected containing different target object concentrations, and recording the liquid level at the moment; reacting the capillary tube at constant temperature for a period of time, and recording the liquid level at the moment again; drawing a standard curve according to the change of the liquid level height corresponding to different concentrations; and similarly, calculating the concentration of the target in the liquid to be measured according to the standard curve.
The surfactant in the step (1) is nonionic aqueous solvent fluorocarbon surfactant FS-31, FS-300 and FSN-100, and the concentration of the surfactant is preferably 0.1-2%.
The loading time of the surfactant in the step (1) is 10-30 hours.
The number of the aptamer bases in the step (2) is 20-40, and the concentration of the aptamer used for covering the silicon ball is 0.5-5.0 mu mol/L.
The temperature of the constant-temperature water bath in the step (2) is 30-50 ℃, preferably 35-45 ℃; the water bath time is 1-10 h, preferably 3-5 h; the organic solvent is ethanol, methanol or a mixed solution of the methanol and the ethanol, and the concentration is 20-50%; the temperature of vacuum drying is 30-60 ℃ and the drying time is 5-30 min.
The cationic polymer in the step (3) is polydiallyl dimethyl ammonium chloride PDDA or polydiallyl dimethyl ammonium chloride PDADMAC; the concentration of the cationic polymer is 0.1-10%, preferably 0.5-3%; the adsorption time is 20-40 min.
Adsorbing the aptamer-capped MSN-NH described in step (3) 2 The adsorption time of the solution is 20-120 min, preferably 30-60 min; MSN-NH 2 The concentration of the solution is 0.1-10.0 mug/mL, preferably 0.5-3.0 mug/mL; the adsorption height is 5-40 mm is preferably 10 to 20. 20 mm.
The constant temperature reaction temperature of the capillary tube in the step (4) is 30-40 ℃, and the constant temperature reaction time is 20-90 min, preferably 30-60 min.
The detection object of the method can be suitable for toxins, small molecules, ions and proteins, and nucleic acid aptamers with high binding capacity and high binding specificity are needed to exist in the detection objects.
In the invention, the modified capillary can be vacuum sealed and packaged, and can be stored for 6 months at the temperature of 4 ℃.
In the present invention, the aminated mesoporous silica (MSN-NH) 2 ) Reference is made to the synthesis method of (2): controlled Delivery Using Oligonucleotide-Capped Mesoporous SilicaNanoparticles Angew chem Int. Ed. 49 (2010) 7281-7283.
Compared with the existing method, the invention provides a brand-new visual quantitative detection method. The method does not need complex instruments, is simple and quick to operate, low in cost and wide in adaptive target objects, and has potential commercial application value.
Detailed Description
The following are specific examples of the present invention, which are intended to illustrate the invention in further detail, but not to limit the invention.
Example 1
(1) Aminated mesoporous silica (MSN-NH) 2 ) Loading FS-31
MSN-NH 2 Dispersing in FS-31 with concentration of 0.1% by ultrasonic, oscillating 24 h to obtain MSN-NH loaded with FS-31 2 ；
(2) Sealing cover of nucleic acid aptamer
To achieve detection of mercury ions, we selected a nucleic acid-adapted DNA strand corresponding to mercury ions: TTTTTTTTTTTT TTTTTTTT, 20T bases in length; taking 10.0 mug/mL MSN-NH loaded with FS-31 in (1) 2 Adding 2.5 mu mol/L DNA water solution, at this time, the total volume is 500 mu L, after ultrasonic treatment for 5min, carrying out constant-temperature water bath 3 h at 37 ℃, then adding 200 mu L ethanol, after full shaking, centrifuging, washing with ethanol, and finally drying in a vacuum drying oven at 37 ℃ for 20 min;
(3) Modification of capillaries
Obliquely sucking the clean capillary tube with 1% PDDA water solution, sealing with a preservative film, standing at room temperature for adsorption for 30 min, and drying with high-purity nitrogen to obtain a PDDA modified capillary tube; MSN-NH encapsulating FS-31 in step (2) with capillary suction height of 20 mm 2 Sealing the solution (5.0 mug/mL) with a preservative film, standing at room temperature for adsorption for 30 min, and drying with high-purity nitrogen;
(4) Drawing standard curve and detecting mercury ions
Sucking standard solution or solution to be measured containing different mercury ion concentrations by using modified capillary, and recording the liquid level h at the moment 1 . Placing the capillary in a constant temperature bath, reacting at 37deg.C for 50 min, and measuring liquid level h again 2 According to the change delta H=h of the liquid level height corresponding to the standard concentration 1 - h 2 Drawing a standard curve of mercury ions; and similarly, calculating the concentration of mercury ions in the liquid to be measured according to the standard curve.
Example 2
(1) Aminated mesoporous silica (MSN-NH) 2 ) Loading FS-300
MSN-NH 2 Dispersing in FS-300 with concentration of 0.3% by ultrasonic wave, oscillating 30 h to obtain MSN-NH loaded with FS-300 2 ；
(2) Sealing cover of nucleic acid aptamer
To achieve detection of ATP, we selected aptamer DNA strands corresponding to ATP: ACCTGGGGGAGTATTGCGGAGGAAGGT, 27 bases in length; taking 5.0 mug/mL MSN-NH loaded with FS-300 in (1) 2 Adding 4.0 mu mol/L DNA water solution, at this time, the total volume is 500 mu L, after ultrasonic treatment for 5min, carrying out constant-temperature water bath 3 h at 37 ℃, then adding 500 mu L ethanol, after full shaking, centrifuging, washing with ethanol, and finally drying in a vacuum drying oven at 40 ℃ for 10 min;
(3) Modification of capillaries
Obliquely sucking the clean capillary tube with 0.1% PDADMAC aqueous solution, standing at room temperature for adsorption for 30 min, and drying with high-purity nitrogen to obtain a PDADMAC modified capillary tube; sucking the capillary tubeTaking MSN-NH with height of 30 mm and packaging FS-300 in the step (2) 2 Sealing the solution (2.5 mug/mL) with a preservative film, standing at room temperature for adsorption for 30 min, and drying with high-purity nitrogen;
(4) Drawing standard curve and detecting ATP
Sucking standard solution or solution to be detected containing different ATP concentrations by modified capillary, and recording liquid level h 3 . Placing the capillary in a constant temperature bath, reacting at 37deg.C for 50 min, and measuring liquid level h again 4 According to the change delta H=h of the liquid level height corresponding to the standard concentration 3 - h 4 Drawing a standard curve of ATP; similarly, the concentration of ATP in the test solution is calculated according to the standard curve.
Example 3
(1) Aminated mesoporous silica (MSN-NH) 2 ) Loading FS-31
MSN-NH 2 Dispersing in FS-31 with concentration of 0.3% by ultrasonic, oscillating 24 h to obtain MSN-NH loaded with FS-31 2 ；
(2) Sealing cover of nucleic acid aptamer
To achieve detection of Prostate Specific Antigen (PSA), we selected a nucleic acid aptamer DNA strand corresponding to PSA: TTTTTAATTAAAGCTCGCCATCAAATAGCTTT, 32 bases in length; taking 10.0 mug/mL MSN-NH loaded with FS-31 in (1) 2 Adding 2.5 mu mol/L aqueous DNA solution, at this time, ultrasonic treating for 10 min at 45deg.C in constant temperature water bath 1.5. 1.5 h, adding 500 mu L40% methanol solution, centrifuging, and drying in vacuum drying oven at 45deg.C for 10 min to obtain MSN-NH of DNA cover FS-31 2 ；
(3) Modification of capillaries
Obliquely sucking the clean capillary tube with 0.3% PDADMAC aqueous solution, standing at room temperature for adsorption for 30 min, and drying with high-purity nitrogen to obtain a PDADMAC modified capillary tube; MSN-NH of FS-31 packaged in step (2) with capillary suction height of 30 mm 2 Sealing the solution (5 mug/mL) with a preservative film, standing at room temperature for adsorption for 40 min, and drying with high-purity nitrogen;
(4) Drawing standard curve and detecting PSA
Sucking standard solution or solution to be tested containing different PSA concentrations by modified capillary, and recording the liquid level h 5 . Placing the capillary in a constant temperature bath, reacting at 45deg.C for 30 min, and measuring liquid level h again 6 According to the change delta H=h of the liquid level height corresponding to the standard concentration 5 - h 6 Drawing a standard curve of the PSA; and similarly, calculating the concentration of the PSA in the liquid to be measured according to the standard curve.
Example 4
(1) Loading of surfactant:
aminated mesoporous silica MSN-NH 2 Dispersing the ultrasonic wave into a surfactant with a certain concentration, oscillating and loading for a period of time, and centrifuging; the surfactant is nonionic aqueous solvent fluorocarbon surfactant FS-31, FS-300 and FSN-100, and the concentration of the surfactant is 0.1%. The loading time of the surfactant is 10 h.
(2) Sealing cover of nucleic acid aptamer:
taking mesoporous silica spheres loaded with the surfactant in the step (1), adding a certain concentration of nucleic acid aptamer with proper base length, carrying out ultrasonic treatment, carrying out constant-temperature water bath, adding a proper amount of organic solvent to enhance the adhesion between the aptamer and the surface of the silica spheres, centrifuging, cleaning and carrying out vacuum drying; the number of the aptamer bases is 20, and the concentration of the aptamer used for sealing the silicon ball is 0.5 mu mol/L. The temperature of the constant-temperature water bath is 35 ℃; the water bath time is 3 h; the organic solvent is ethanol solution with concentration of 20%; the temperature of vacuum drying is 30 ℃ and the drying time is 5 min.
(3) Modification of the inner wall of the capillary:
obliquely sucking the clean and dry capillary tube with a cationic polymer aqueous solution with a certain concentration, standing for a period of time at room temperature, soaking and cleaning the capillary tube with ultrapure water, and drying with high-purity nitrogen; MSN-NH capped in (2) the capillary having a certain height 2 Standing and adsorbing the dispersion liquid for a period of time, and then drying the inner tube by nitrogen; the cationic polymer is polydiallyl dimethyl ammonium chloride PDDA and polydiene dimethyl ammonium chloride PDAA DMAC; the concentration of cationic polymer was 0.1%; the adsorption time was 20 min. The MSN-NH adsorbed and capped by the aptamer 2 The adsorption time of the solution is 30 min; MSN-NH 2 The concentration of the solution was 0.5. Mu.g/mL; the adsorption height was 10 mm.
(4) Drawing a standard curve and detecting a target object:
vertically placing the modified capillary tube in the step (3) into standard solution or solution to be detected containing different target object concentrations, and recording the liquid level at the moment; reacting the capillary tube at constant temperature for a period of time, and recording the liquid level at the moment again; drawing a standard curve according to the change of the liquid level height corresponding to different concentrations; and similarly, calculating the concentration of the target in the liquid to be measured according to the standard curve. The constant temperature reaction temperature of the capillary tube is 30 ℃, and the constant temperature reaction time is 30 min.
Example 5
(1) Loading of surfactant:
aminated mesoporous silica MSN-NH 2 Dispersing the ultrasonic wave into a surfactant with a certain concentration, oscillating and loading for a period of time, and centrifuging; the surfactant is nonionic aqueous solvent fluorocarbon surfactant FS-31, FS-300 and FSN-100, and the concentration of the surfactant is 1%. The loading time of the surfactant is 20 h.
(2) Sealing cover of nucleic acid aptamer:
taking mesoporous silica spheres loaded with the surfactant in the step (1), adding a certain concentration of nucleic acid aptamer with proper base length, carrying out ultrasonic treatment, carrying out constant-temperature water bath, adding a proper amount of organic solvent to enhance the adhesion between the aptamer and the surface of the silica spheres, centrifuging, cleaning and carrying out vacuum drying; the number of the aptamer bases is 30, and the concentration of the aptamer used for sealing the silicon ball is 2.5 mu mol/L. The temperature of the constant-temperature water bath is 40 ℃; the water bath time was 4 h; the organic solvent is methanol solution with the concentration of 35 percent; the temperature of vacuum drying is 45 ℃ and the drying time is 20 min.
(3) Modification of the inner wall of the capillary:
the clean and dry capillary is inclined to be filled with a cationic polymer aqueous solution with a certain concentrationStanding at room temperature for a period of time, soaking and cleaning the capillary tube by using ultrapure water, and drying by using high-purity nitrogen; MSN-NH capped in (2) the capillary having a certain height 2 Standing and adsorbing the dispersion liquid for a period of time, and then drying the inner tube by nitrogen; the cationic polymer is polydiallyl dimethyl ammonium chloride PDDA or polydiallyl dimethyl ammonium chloride PDADMAC; the concentration of cationic polymer was 3%; the adsorption time was 30 min. The MSN-NH adsorbed and capped by the aptamer 2 The adsorption time of the solution is 60 min; MSN-NH 2 The concentration of the solution was 3.0. Mu.g/mL; the adsorption height was 20 mm.
(4) Drawing a standard curve and detecting a target object:
vertically placing the modified capillary tube in the step (3) into standard solution or solution to be detected containing different target object concentrations, and recording the liquid level at the moment; reacting the capillary tube at constant temperature for a period of time, and recording the liquid level at the moment again; drawing a standard curve according to the change of the liquid level height corresponding to different concentrations; and similarly, calculating the concentration of the target in the liquid to be measured according to the standard curve. The constant temperature reaction temperature of the capillary tube is 35 ℃, and the constant temperature reaction time is 60 min.
Example 6
(1) Loading of surfactant:
aminated mesoporous silica MSN-NH 2 Dispersing the ultrasonic wave into a surfactant with a certain concentration, oscillating and loading for a period of time, and centrifuging; the surfactant is nonionic aqueous solvent fluorocarbon surfactant FS-31, FS-300 and FSN-100, and the concentration of the surfactant is 2%. The loading time of the surfactant is 30 h.
(2) Sealing cover of nucleic acid aptamer:
taking mesoporous silica spheres loaded with the surfactant in the step (1), adding a certain concentration of nucleic acid aptamer with proper base length, carrying out ultrasonic treatment, carrying out constant-temperature water bath, adding a proper amount of organic solvent to enhance the adhesion between the aptamer and the surface of the silica spheres, centrifuging, cleaning and carrying out vacuum drying; the number of the aptamer bases is 40, and the concentration of the aptamer used for covering the silicon ball is 5.0 mu mol/L. The temperature of the constant-temperature water bath is 50 ℃; the water bath time is 10 h; the organic solvent is a mixed solution of methanol and ethanol, and the concentration is 50%; the temperature of vacuum drying is 60 ℃ and the drying time is 30 min.
(3) Modification of the inner wall of the capillary:
obliquely sucking the clean and dry capillary tube with a cationic polymer aqueous solution with a certain concentration, standing for a period of time at room temperature, soaking and cleaning the capillary tube with ultrapure water, and drying with high-purity nitrogen; MSN-NH capped in (2) the capillary having a certain height 2 Standing and adsorbing the dispersion liquid for a period of time, and then drying the inner tube by nitrogen; the cationic polymer is polydiallyl dimethyl ammonium chloride PDDA or polydiallyl dimethyl ammonium chloride PDADMAC; the concentration of cationic polymer is 10%, preferably 3%; the adsorption time was 40 min. The MSN-NH adsorbed and capped by the aptamer 2 The adsorption time of the solution is 120 min; MSN-NH 2 The concentration of the solution was 10.0. Mu.g/mL; the adsorption height was 40 mm.
(4) Drawing a standard curve and detecting a target object:
vertically placing the modified capillary tube in the step (3) into standard solution or solution to be detected containing different target object concentrations, and recording the liquid level at the moment; reacting the capillary tube at constant temperature for a period of time, and recording the liquid level at the moment again; drawing a standard curve according to the change of the liquid level height corresponding to different concentrations; and similarly, calculating the concentration of the target in the liquid to be measured according to the standard curve. The constant temperature reaction temperature of the capillary tube is 40 ℃, and the constant temperature reaction time is 90 min.
Claims (9)
1. A detection method of capillary biosensor based on capillary phenomenon is characterized in that mesoporous silica spheres with surface active agent encapsulated by nucleic acid aptamer are adsorbed on the inner wall of capillary, target specificity to be detected is utilized to bind nucleic acid aptamer solution Feng Jiekong, surface active agent in holes is released to change the surface tension of liquid, and the liquid level rising through capillary phenomenon in capillary is caused to change, so that the purpose of visual detection is achieved; the surfactant is nonionic aqueous solvent fluorocarbon surfactant FS-31, FS-300 and FSN-100, and the concentration of the surfactant is 0.1-2%.
2. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 1, wherein an aminated mesoporous silica is used, comprising the steps of:
(1) Loading of surfactant:
aminated mesoporous silica MSN-NH 2 Dispersing the ultrasonic wave into a surfactant with a certain concentration, oscillating and loading for a period of time, and centrifuging;
(2) Sealing cover of nucleic acid aptamer:
taking mesoporous silica spheres loaded with the surfactant in the step (1), adding a certain concentration of nucleic acid aptamer with proper base length, performing ultrasonic treatment, performing constant-temperature water bath, adding a proper amount of organic solvent to enhance the adhesion between the aptamer and the surface of the silica spheres, centrifuging, cleaning and performing vacuum drying;
(3) Modification of the inner wall of the capillary:
obliquely sucking the clean and dry capillary tube with a cationic polymer aqueous solution with a certain concentration, standing for a period of time at room temperature, soaking and cleaning the capillary tube with ultrapure water, and drying with high-purity nitrogen; MSN-NH capped in step (2) of elevating the capillary tube 2 Standing and adsorbing the dispersion liquid for a period of time, and then drying the inner tube by nitrogen;
(4) Drawing a standard curve and detecting a target object:
vertically placing the modified capillary tube in the step (3) into standard solution or solution to be detected containing different target object concentrations, and recording the liquid level at the moment; reacting the capillary tube at constant temperature for a period of time, and recording the liquid level at the moment again; drawing a standard curve according to the change of the liquid level height corresponding to different concentrations; and similarly, calculating the concentration of the target in the liquid to be measured according to the standard curve.
3. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 2, wherein: the loading time of the surfactant in the step (1) is 10-30 hours.
4. A method of detecting a capillary biosensor based on capillary phenomenon according to any one of claims 2-3, wherein: the number of the aptamer bases in the step (2) is 20-40, and the concentration of the aptamer used for covering the silicon ball is 0.5-5.0 mu mol/L.
5. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 4, wherein: the temperature of the constant-temperature water bath in the step (2) is 30-50 ℃, the water bath time is 1-10 h, the organic solvent is ethanol, methanol or a mixed solution of the methanol and the ethanol, and the concentration is 20-50%; the temperature of vacuum drying is 30-60 ℃ and the drying time is 5-30 min.
6. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 5, wherein: the cationic polymer in the step (3) is polydiallyl dimethyl ammonium chloride PDDA or polydiallyl dimethyl ammonium chloride PDADMAC; the concentration of the cationic polymer is 0.1-10%, and the adsorption time is 20-40 min.
7. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 6, wherein: adsorbing the aptamer-capped MSN-NH described in step (3) 2 The adsorption time of the solution is 20-120 min, and MSN-NH is used 2 The concentration of the solution is 0.1-10.0 mug/mL, and the adsorption height is 5-40 mm.
8. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 7, wherein: the constant temperature reaction temperature of the capillary tube in the step (4) is 30-40 ℃, and the constant temperature reaction time is 20-90 min.
9. The method for detecting a capillary biosensor based on capillary phenomenon according to claim 8, wherein: the detection object of the method is suitable for toxins, small molecules, ions or proteins, and the detection object needs to have nucleic acid aptamer with high binding capacity and high binding specificity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110770283.8A CN113484475B (en) | 2021-07-08 | 2021-07-08 | Capillary sensor preparation method based on capillary phenomenon and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110770283.8A CN113484475B (en) | 2021-07-08 | 2021-07-08 | Capillary sensor preparation method based on capillary phenomenon and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113484475A CN113484475A (en) | 2021-10-08 |
| CN113484475B true CN113484475B (en) | 2023-08-29 |
Family
ID=77937397
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110770283.8A Active CN113484475B (en) | 2021-07-08 | 2021-07-08 | Capillary sensor preparation method based on capillary phenomenon and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113484475B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104698093A (en) * | 2015-03-30 | 2015-06-10 | 王桦 | Polyhydroxy compound rapid detection method based on capillary tube siphonic effect and phenylboronic acid recognition principle |
| CN108152258A (en) * | 2017-12-13 | 2018-06-12 | 清华大学 | A kind of method for detecting the content of aminoglycoside antibiotics in solution to be measured |
| CN112304889A (en) * | 2020-10-25 | 2021-02-02 | 湖南科技大学 | Method for detecting reductive glutathione in blood based on click reaction of inner wall of capillary tube |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016145335A1 (en) * | 2015-03-11 | 2016-09-15 | Stc.Unm | Generation of mesoporous materials using multiphase surfactant systems |
-
2021
- 2021-07-08 CN CN202110770283.8A patent/CN113484475B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104698093A (en) * | 2015-03-30 | 2015-06-10 | 王桦 | Polyhydroxy compound rapid detection method based on capillary tube siphonic effect and phenylboronic acid recognition principle |
| CN108152258A (en) * | 2017-12-13 | 2018-06-12 | 清华大学 | A kind of method for detecting the content of aminoglycoside antibiotics in solution to be measured |
| CN112304889A (en) * | 2020-10-25 | 2021-02-02 | 湖南科技大学 | Method for detecting reductive glutathione in blood based on click reaction of inner wall of capillary tube |
Non-Patent Citations (1)
| Title |
|---|
| 徐群博 等.基于特异性适配体封盖介孔纳米材料的T-2毒素快速检测技术.《食品科学》.2020,第41卷(第22期),第324-329页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113484475A (en) | 2021-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chung et al. | Measurement of dissolved oxygen in water using glass-encapsulated myoglobin | |
| Zhou et al. | Porous fiber-optic sensor for high-sensitivity humidity measurements | |
| Gholivand et al. | Polypyrrole/hexagonally ordered silica nanocomposite as a novel fiber coating for solid-phase microextraction | |
| Liang et al. | A novel amperometric immunosensor based on three-dimensional sol–gel network and nanoparticle self-assemble technique | |
| Sungkaew et al. | A new polyethylene glycol fiber prepared by coating porous zinc electrodeposited onto silver for solid-phase microextraction of styrene | |
| CN101832965B (en) | Laccase biosensor based on magnetic carbon nano tube and chitosan/silicon dioxide gel and preparation method and application thereof | |
| CN103816877A (en) | Solid-phase microextraction probe, and preparation method and application thereof | |
| Wang et al. | Development of immunoaffinity solid phase microextraction rods for analysis of three estrogens in environmental water samples | |
| CN100373156C (en) | Nano biologic enzyme electrode | |
| Tsai et al. | Preparation of imprinted poly (tetraethoxysilanol) sol–gel for the specific uptake of creatinine | |
| Jeronimo et al. | Direct determination of copper in urine using a sol–gel optical sensor coupled to a multicommutated flow system | |
| CN113484475B (en) | Capillary sensor preparation method based on capillary phenomenon and application thereof | |
| Liu et al. | Studies on a potentiometric urea biosensor based on an ammonia electrode and urease, immobilized on a γ-aluminum oxide matrix | |
| CN110187039B (en) | Tryptophan ionic liquid loaded magnetic graphene oxide nanocomposite and tebuconazole extraction detection method thereof | |
| Huang et al. | Cytochrome c-multiwalled carbon nanotube and cobalt metal organic framework/gold nanoparticle immobilized electrochemical biosensor for nitrite detection | |
| CN109239041A (en) | A kind of carbon dots for detecting tyrasamine-molecularly imprinted polymer test strips and its preparation method and application | |
| CN111175358B (en) | Preparation method of cyfluthrin molecular imprinting electrochemiluminescence sensor and method for detecting cyfluthrin | |
| Han et al. | Detection of hidden drugs with a molecularly imprinted electrochemiluminescence sensor | |
| Desimone et al. | Effects of relative humidity on enzyme activity immobilized in sol–gel-derived silica nanocomposites | |
| CN113092453A (en) | Dipterex electrochemiluminescence molecularly imprinted sensor, and preparation method and application thereof | |
| Gan et al. | An electrochemical biosensor for nitric oxide based on silver nanoparticles and hemoglobin | |
| CN110455897B (en) | Based on SiO2Sensitive detection of Hg by carrier2+Construction of the Release electrochemical aptamer sensor | |
| CN108163802A (en) | A kind of antigen detection material and its preparation method and application | |
| CN116242821A (en) | Preparation method of colorimetric chip for detecting food spoilage marker gas | |
| Loussala et al. | Mesoporous silica hybridized by ordered mesoporous carbon for in‐tube solid‐phase microextraction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |