CN113481171A

CN113481171A - Recombinant influenza virus strain carrying HIV-1 gene and preparation method and application thereof

Info

Publication number: CN113481171A
Application number: CN202110685039.1A
Authority: CN
Inventors: 朱应; 马采娇; 刘实; 佘应龙
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2021-06-21
Filing date: 2021-06-21
Publication date: 2021-10-08
Anticipated expiration: 2041-06-21
Also published as: CN113481171B

Abstract

The invention provides a recombinant influenza virus strain carrying HIV-1 gene and a preparation method and application thereof, wherein the recombinant influenza virus strain is a recombinant influenza virus rescued from cells by an influenza virus vector carrying HIV-1 gene through a reverse genetic system; the HIV-1 gene is positioned in an open reading frame of a modified influenza A virus NS segment; the splicing site of the modified influenza A virus NS segment mutates 525-CCAGGA-530 into 525-CCCGGG-530; the 5 'end of the HIV-1 gene segment is connected with the 3' end of the influenza A virus NS1 segment through a linker; the 3 'end of the HIV-1 gene fragment is connected with the 5' end of the NEP fragment through a linker. The recombinant influenza virus can be stably passaged in host cells or chick embryos, and can be used for development of HIV-1 vaccines and medicines and production of HIV proteins by using the cells or the chick embryos as bioreactors.

Description

Recombinant influenza virus strain carrying HIV-1 gene and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a recombinant influenza virus strain carrying HIV-1 gene, and a preparation method and application thereof.

Background

Influenza a virus (influenza a virus), belonging to the orthomyxoviridae family, has a genome consisting of 8 negative polarity RNA segments (vRNA). In influenza virus 8 RNA fragments of its genome are combined with three polymerase proteins (PB2, PB1, PA) and Nucleoprotein (NP) to form active ribonucleoprotein aggregates (RNPs). When influenza a viruses infect host cells, Hemagglutinin (HA) mediates binding of the viral particles to sialic acid receptors on the host cells. After influenza viruses enter cells in a membrane fusion mode, the viruses release RNPs, the replication and transcription of viral genomes are started after the RNPs enter cell nuclei, 8 RNA fragments are respectively transcribed into messenger RNA (mRNA) and complementary RNA (cRNA), the mRNA is translated into viral proteins, the cRNA is replicated to generate vRNA, and then the vRNA is assembled to generate progeny influenza viruses.

The genome of influenza a virus comprises 8 segments. Wherein the mRNA of viral fragment polymerase (PB2), Haemagglutinin (HA), Nucleoprotein (NP) and Neuraminidase (NA) is monocistronic. Many studies have found that polymerase PB1 contains multiple translation initiation sites. Polymerase (PA) can then encode a variety of proteins through ribosome frameshifting and multiple translation initiation sites. The matrix protein (M) and the nonstructural protein (NS) are spliced by RNA to generate multiple mRNAs. The corresponding protein can also be expressed by mutating RNA splice sites in M and NS and connecting open reading frames of the M and the NS through connecting peptide, and the rescued recombinant influenza virus can normally replicate under appropriate conditions.

The reverse genetic system of influenza virus currently mainly comprises an 8-plasmid system and a 12-plasmid system. The 8 plasmid system is currently used internationally because the 12 plasmid system requires more plasmids and has higher requirements on transfection efficiency. A bidirectional expression system was formed by inserting cDNA of 8 vRNAs of the influenza virus genome in a forward direction by cloning between the pol II promoter (derived from the human cytomegalovirus CMV promoter) and the termination sequence (bovine growth hormone poly (A) signal bGH), and also inserting the human pol I promoter and the murine pol I termination sequence in reverse direction between the expression cassettes. The plasmid of the system is transfected into eukaryotic cells, so that negative strand vRNA is synthesized under the control of pol I on the same template, positive strand mRNA is synthesized and protein is expressed under the control of pol II, and influenza virus is generated through assembly, so that the rescue of the influenza virus is completed. Due to the development of the reverse genetic system of the influenza virus, the recombinant influenza virus carrying the exogenous segment can be rescued by modifying the genome of the influenza virus.

In recent years, multigenic vector construction strategies for 2A peptides from multiple sources have received much attention. The strategy overcomes the defects of low protein activity or low downstream gene expression level and the like in the process of multi-gene expression, has obvious advantages, and is an ideal multi-gene expression strategy at present. It is also increasingly common to utilize 2A polypeptides in influenza virus engineering.

Human Immunodeficiency Virus (HIV), an HIV virus, is a lentivirus that infects cells of the human immune system and belongs to the field of retroviruses. According to the report of the united states aids planning agency (uneds), nearly 3800 million people infected with HIV and 69 million people died of aids worldwide in 2019. Human immunodeficiency virus seriously affects the health of people in all countries of the world, and the death rate caused by AIDS is obviously higher than that of other sexually transmitted diseases. The world health organization therefore defines HIV type I as a class of carcinogens and HIV type II as a class 2B carcinogen. Pre-exposure prophylaxis (PrEP) and antiretroviral therapy (ART) are currently used internationally and widely to prevent or treat HIV infections. Despite the potential for decreased morbidity of ART and prap, both of these approaches require consistent medication and a continuous drug supply. Therefore, the preparation of protective and therapeutic HIV vaccines has become a focus of human immunodeficiency virus research in many countries.

Disclosure of Invention

In order to solve the technical problem, the invention provides a recombinant influenza virus strain carrying HIV-1 gene and a preparation method and application thereof, the invention takes influenza virus as a carrier to carry HIV-1 gene for the first time, and has high broad-spectrum property and low cost.

In a first aspect of the invention, there is provided a recombinant influenza virus strain carrying the HIV-1 gene,

the recombinant influenza virus strain is a recombinant influenza virus which carries an HIV-1 gene and is rescued in cells by an influenza virus vector carrying the HIV-1 gene through a reverse genetic system; wherein the influenza virus vector comprises one of influenza A virus A/WSN/33 or A/PR/8/34;

the HIV-1 gene is positioned in an open reading frame of an improved influenza A virus NS segment;

the splice sites of the modified influenza A virus NS segment are subjected to synonymous mutation: mutating 525-CCAGGA-530 to 525-CCCGGG-530;

the HIV-1 gene source is HIV-1B subtype or CRF01_ AE recombinant form; the 5 'end of the HIV-1 gene segment is connected with the 3' end of the influenza A virus NS1 segment through a linker; the 3 'end of the HIV-1 gene segment is connected with the 5' end of the NEP segment of the influenza A virus through a linker.

Further, the HIV-1 gene is a combined dominant epitope of V3 and MPER of subtype B, and the sequence of the HIV-1 gene is shown as SEQ ID NO: 1, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: V202145, and the influenza virus vector is A type influenza virus A/WSN/33.

Furthermore, the HIV-1 gene is a combined dominant epitope of a recombinant D loop, a recombinant V3 loop and a recombinant CD4 binding site of CRF01_ AE, and the nucleotide sequence of the HIV-1 gene is shown as SEQ ID NO: 2, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: v202146, influenza virus vector is A type influenza virus A/WSN/33.

Further, the HIV-1 gene is a V5 ring, a beta 20/21 chain and a beta 23/24 chain combined dominant epitope of a CRF01_ AE recombinant form, and the nucleotide sequence of the HIV-1 gene is shown as SEQ ID NO: 3, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: v202147, influenza Virus vector is influenza A virus A/WSN/33.

In other embodiments, the HIV-1 gene may also be the complete gene or dominant epitope of the binding site of CD4 (CD4bs), or the complete gene or dominant epitope of the third hypervariable region of gp120 protein (V3), or the complete gene or dominant epitope of the fifth hypervariable region of gp120 protein (V5), or the complete gene or dominant epitope of the membrane proximal outer region of gp41 protein (MPER); or may be dominant epitopes of a plurality of the above proteins.

The recombinant influenza virus can be passaged and amplified in MDCK cells, A549 cells, VERO cells or chicken embryos;

in the second aspect of the invention, the recombinant influenza virus strain carrying HIV-1 gene is applied to preparing HIV-1 vaccine and the application of producing HIV protein by using chick embryo or cell as bioreactor.

Further, the vaccine comprises a virus vector vaccine of the recombinant influenza virus strain carrying the HIV-1 gene or a subunit vaccine prepared by using chicken embryos or cells as HIV proteins expressed by a bioreactor.

The HIV-1 vaccine is a monogene and multivalent chimeric vaccine; the recombinant influenza virus can be processed into a preparation for clinical use by using a general technology, and the preparation comprises any one of a liquid preparation, a freeze-dried preparation, a capsule preparation, a tablet or a pill. The vaccination routes of the vaccine comprise intramuscular injection, subcutaneous injection and oral administration, and also comprise nasal cavity, oral cavity, anus and vaginal mucosa routes.

In a third aspect of the invention, there is provided a method of producing a recombinant influenza virus strain carrying an HIV-1 gene, the method comprising:

performing synonymous mutation on a splice site of an NS segment in the WSN of the influenza A virus, and mutating 525-CCAGGA-530 into 525-CCCGGG-530;

obtaining HIV-1 gene segments;

connecting the HIV-1 gene segment between the NS1 segment and the NEP segment by a Linker to obtain recombinant NS plasmids with NS1, self-splicing peptide segment, HIV-1 gene, self-splicing peptide segment and NS2 in the 5 '-3' direction respectively;

the recombinant NS plasmid and the other seven plasmids of WSN were co-transfected into host cells to obtain recombinant influenza virus strains carrying HIV-1 gene.

In the technical scheme, the 6 bases CCAGGA at the 525-position and 530-position of the NS segment is synonymously mutated into CCCGGG, so that the splicing acceptor site on the NS segment is damaged, and the NS cannot naturally generate alternative splicing.

In the fourth aspect of the invention, the HIV-1 protein is provided, and the nucleotide sequence for coding the HIV-1 protein is SEQ ID NO: 1-3.

In a fifth aspect of the invention, there is provided a nucleic acid molecule encoding said HIV protein.

In a sixth aspect of the present invention, there is provided a biological material, which comprises an expression vector containing the nucleic acid molecule, a cell line or a recombinant bacterium containing the expression vector, wherein the cell line comprises one of 293T, COS cells, 293T, MDCK, COS and MDCK.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

1. the invention provides a recombinant influenza virus strain carrying HIV-1 gene and a preparation method and application thereof, and no effective HIV-1 vaccine exists at home and abroad at present, the invention takes influenza virus as a vector to express HIV-1 antigen, and is expected to be a potential candidate vaccine of HIV-1;

2. the recombinant influenza virus carrying HIV-1 gene can generate antibodies aiming at the influenza virus and the HIV-1 simultaneously after being inoculated to a human body, and has the function of a dual vaccine;

3. the recombinant influenza virus carrying the HIV-1 gene can be used for large-scale production, purification and functional research of HIV protein, and can also be used for development of HSV-2 subunit vaccines or protein vaccines; the recombinant influenza virus carrying the HIV-1 gene can be immunized through the nasal cavity and the oral cavity in a spraying mode, and is more convenient and quicker compared with the traditional vaccination mode;

4. the recombinant influenza virus carrying the HIV-1 gene can be used for (1) preparation of an HIV-1 vaccine; (2) functional studies of HIV proteins; (3) HIV protein is produced by using chick embryo as bioreactor.

The preservation date of the recombinant influenza virus strain carrying the HIV-1 gene is 2021, 5 months and 25 days, the preservation number is CCTCC NO: V202145, and the name is recombinant influenza A virus IAV-1A. The name of the preservation unit is China center for type culture Collection, and the address is Wuhan university in Wuhan city, Hubei province, China, and the postal code is as follows: 430072.

the preservation date of the recombinant influenza virus strain carrying the HIV-1 gene is 2021, 5 months and 25 days, the preservation number is CCTCC NO: V202146, and the name is recombinant influenza A virus IAV-CD 4. The name of the preservation unit is China center for type culture Collection, and the address is Wuhan university in Wuhan city, Hubei province, China, and the postal code is as follows: 430072.

the preservation date of the recombinant influenza virus strain carrying the HIV-1 gene is 5 months and 25 days in 2021, the preservation number is CCTCC NO: V202147, and the name is recombinant influenza A virus IAV-V5. The name of the preservation unit is China center for type culture Collection, and the address is Wuhan university in Wuhan city, Hubei province, China, and the postal code is as follows: 430072.

drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a schematic diagram of the influenza A virus genome at the left; right panel is a schematic representation of the recombinant viral genome after engineering the NS fragment;

FIG. 2 shows that alternative splicing of NS occurs in the influenza A virus genome to produce two mRNAs, NS1 and NEP, respectively;

FIG. 3 shows the construction of a novel influenza NS fragment carrying the HIV-1 gene by engineering the NS fragment, inserting two self-splicing polypeptides into the open reading frames of NS1 and NS2, followed by insertion of an exogenous fragment into the two self-splicing polypeptide fragments;

FIG. 4 is a specific embodiment of the retrofit of an NS; SD is a splice donor site, SA is a splice acceptor site; the 6 bases CCAGGA at the 525-19 bit of the NS segment is synonymously mutated into CCCGGG, so that the splicing acceptor site on the NS segment is damaged, and the NS cannot naturally generate alternative splicing; ligating the self-splicing polypeptide fragment after the open reading frame of NS1, introducing the P2A fragment before the NEP fragment and inserting the foreign fragment between the self-splicing polypeptides such that NS1, self-splicing polypeptide 1, foreign fragment, self-splicing polypeptide 2 are in the same open reading frame;

FIG. 5 is an electrophoresis diagram of influenza NP detected by RT-PCR of RNA extracted after MDCK is infected by recombinant influenza virus containing HIV-1 fragment and wild type virus;

FIG. 6 is an electrophoresis diagram of recombinant influenza virus containing HIV-1 fragment and wild type virus after MDCK infection, RNA extraction and influenza virus NS detection by RT-PCR;

FIG. 7 is an electrophoresis diagram of HIV-1 gene in influenza virus detected by RT-PCR of RNA extracted after MDCK is infected with recombinant influenza virus containing HIV-1 fragment and wild type virus;

FIG. 8 shows the IgA content in serum after 2 weeks of secondary immunization of mice in the control group and the experimental group;

FIG. 9 shows the IgG content in serum of mice of control and experimental groups after 2 weeks of secondary immunization;

FIG. 10 shows the virus titer in ovaries of control and experimental mice injected with vPE16 virus for 1 week;

fig. 11 is an explanatory view of a recombinant influenza virus-immunized mouse.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

The effects of the present application will be described in detail below with reference to examples and experimental data. If not specifically mentioned, the molecular cloning method, the protein expression and purification method, the cell culture method, various detection methods and the like mentioned in the following schemes are all traditional experimental methods and can be obtained by inquiring documents; the relevant reagents used may be purchased from corresponding reagent suppliers.

Example 1 construction of recombinant NS fragments

1. The RNA splice sites in the NS fragment were subjected to the synonymous mutation, 525-CCAGGA-530 to 525-CCCGGG-530. The conventional molecular biology method is adopted to carry out mutation by a cloning means or a strategy of directly synthesizing the mutated NS, and two primers are cloned and designed to carry out homologous recombination through homologous recombinase.

When constructing recombinant plasmid, 6 bases CCAGGA at 525-530 position of NS segment is synonymously mutated into CCCGGG, thereby destroying the splice acceptor site on NS segment and making NS unable to naturally generate alternative splicing.

2. HIV protein gene fragments are respectively synthesized by a gene synthesis method:

(1) the HIV-1 gene is a combined dominant epitope of V3 and MPER of a B subtype, and the sequence of the HIV-1 gene is shown as SEQ ID NO: 1, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: V202145;

(2) the HIV-1 gene is a combined dominant epitope of a CRF01_ AE recombinant D loop, a V3 loop and a CD4 binding site, and the nucleotide sequence of the HIV-1 gene is shown as SEQ ID NO: 2 is shown in the specification;

(3) the HIV-1 gene is a combined dominant epitope of a V5 ring, a beta 20/21 chain and a beta 23/24 chain of a CRF01_ AE recombinant form, and the nucleotide sequence of the HIV-1 gene is shown as SEQ ID NO: 3 is shown in the specification;

3. connecting the mutated NS segment with exogenous HIV protein gene by self-splicing polypeptide according to open reading frames of NS1 and NEP to obtain recombinant NS segment, and obtaining recombinant NS plasmids of NS1, P2Alinker, HIV-1 gene, T2Alinker and NEP in 5 '-3' direction as shown in figure 4;

in particular, we chose to insert a synthetic gene expressing the HIV-1 protein between NS1 and the NEP fragment, the two segments being joined by two self-splicing linkers, T2A and P2A. Therefore, when the recombinant gene fragment is expressed in cells, splicing phenomenon also occurs, thereby expressing proteins of different sizes (NS1, HIV-1, NEP, NS1-HIV-1, HIV-1-NEP, NS 1-HIV-1-NEP).

The method comprises the following specific steps: cloning T2Alinker, P2Alinker, NS and PHW2000 plasmid to obtain linear primer:

1A-NEP-F: attggctgtggtatataaaagctactaacttcagcctgct (shown in SEQ ID NO: 4);

NS 1-1A-R: ggtcttgtacaattagggccgggattctcctc (shown in SEQ ID NO: 5);

annealing at 65 deg.C, extending for 50s, running glue, and recovering glue.

CD 4-NEP-F: tgtaatgcacagttttaatgctactaacttcagcctgctgaag (shown in SEQ ID NO: 6);

NS1-CD 4-R: cgtgaaattgtcagacatagggccgggattctcctc (shown in SEQ ID NO: 7);

annealing at 66 deg.C, extending for 50s, running glue, and recovering glue.

V5-NEP-F: ggtgcaaagagaaaaagctactaacttcagcctgctgaag (shown in SEQ ID NO: 8);

NS 1-V5-R: ttcctacttcctgcatagggccgggattctcctc (shown in SEQ ID NO: 9);

annealing at 66 deg.C, extending for 50s, running glue, and recovering glue.

The HIV-1 gene (the whole fragment is synthesized by adopting a gene synthesis method) is cloned. The primers are as follows:

1A-F: aattgtacaagacccaacaacaatacaa (shown in SEQ ID NO: 10);

1A-R: ttttatataccacagccaatttgttatgt (shown in SEQ ID NO: 11);

annealing at 55 deg.C, extending for 10s, running glue, and recovering glue.

CD 4-F: atgtctgacaatttcacgaacaatgct (shown in SEQ ID NO: 12);

CD 4-R: attaaaactgtgcattacaatttctgggtc (shown in SEQ ID NO: 13);

annealing at 58 deg.C, extending for 10s, running glue, and recovering glue.

V5-F: atgcaggaagtaggaaaagcaatgtatg (shown in SEQ ID NO: 14);

V5-R: tttttctctttgcaccactcttctctttg (shown in SEQ ID NO: 15);

annealing at 59 deg.C, extending for 10s, running glue, and recovering glue.

And carrying out homologous recombination on the two recovered fragments by using a homologous recombinase, transforming and extracting plasmids.

4. The 3 constructed recombinant plasmids are identified by sequencing, the fragment size is completely consistent with the expected size, and no gene mutation exists.

Example 2 rescue of recombinant influenza Virus

Influenza virus wild type PB2, PB1, PA, HA, NP, NA, M and recombinant plasmid were co-transfected into 293T or COS cells, or 293T or COS and MDCK co-cultured cell lines were transfected, and after 6h, they were replaced with DMEM medium containing TPCK pancreatin. The final concentration of TPCK pancreatin is 1 ug/ml. At 37 ℃ 5% CO₂Culturing for 48h under the environment, and collecting the supernatant. The collected supernatant was clarified to infect MDCK cells. Collecting the supernatant after 48-72h for plaque purification, amplifying the virus in MDCK after three rounds of plaque purification, and finally obtaining the influenza virus vaccine strain carrying HIV-1 genes.

Example 3 plaque purification of influenza Virus

Before virus adsorption, MDCK cells were digested and plated in 6-well plates with 10 cells per well⁶. After MDCK attachment to the wall and growth of monolayer cells, the medium was aspirated and washed twice with PBS. The collected fractions were then pooled in PBS containing 0.3% BSAViral supernatants were diluted 10 fold and added to six well plates at 400ul per well, with appropriate secondary wells for each gradient. The adsorption time was 1h, and after the adsorption was complete, the residual supernatant was washed off with PBS. 2 × DMEM was mixed with the melted low melting agarose 1:1 and TPCK pancreatin was added to a final concentration of 1 ug/ml. 2ml of the mixture was added to each well, and after it was cooled and solidified, it was cultured in an incubator at 37 ℃. Plaque growth began to be observed the next day later. After the plaque grows out, picking the plaque by using a gun head, infecting a new MDCK cell in a manner of adsorption infection, extracting cell RNA after 24-48h, and detecting NP, NS and exogenous fragments by RT-PCR.

Example 4 identification of recombinant influenza viruses

Cell supernatants were aspirated with a pipette and washed twice with PBS. Appropriate quantities of rnaasso Plus were added to the six-well plates to lyse the cells. Extraction of RNA from cells was performed according to the instructions. The extracted RNA is subjected to reverse transcription by using a universal primer and a random primer as primers. The obtained cDNA was subjected to PCR identification. Different primers are used to identify the NP, NS and foreign fragments of the recombinant virus. The results are shown in FIGS. 5, 6 and 7.

As can be seen from FIGS. 5-7, the recombinant virus packaging of the present example was successful.

Example 5 use of recombinant viruses as HIV-1 vaccines

8 week old SPF grade BALB/c mice were divided into four groups: control group, experimental group 1, experimental group 2,

experimental group

3, 5 mice per group. The mice were immunized first with WSN (H1N1) recombinant influenza virus by nasal drip infection and six weeks later boosted with X31(H3N 2). Two weeks after the second immunization, the mice were bled and IgA and IgG in the mouse serum were measured by ELISA, and the results are shown in fig. 8 and 9.

From FIGS. 8-9, specific IgA and IgG antibodies were detected in all mice vaccinated with recombinant virus, indicating that all three recombinant viruses elicited HIV-specific IgA and IgG responses.

Four weeks after the second immunization, mice were injected intraperitoneally with recombinant vaccinia virus vPE16 expressing HIV-1 full-length gp160 protein, and six days later, ovaries of the mice were taken to detect the vPE16 virus titer, and the results are shown in FIG. 10. The whole experimental scheme is shown in fig. 11.

As can be seen in FIG. 10, the HIV-1 viral load in the ovaries of mice previously inoculated with recombinant influenza virus was significantly lower than that of the blank group, indicating that the mice immunized with recombinant virus were completely protective against the challenge with vPE 16.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Wuhan university

<120> recombinant influenza virus strain carrying HIV-1 gene, preparation method and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 231

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aattgtacaa gacccaacaa caatacaaga aaaagaatcc gtatccagag aggaccaggg 60

agagcatttg ttacaatagg aaaaatagga aatatgagac aagcacattg taacattagt 120

ggcggcagcg gcggcggcgg cagcggcggc ggcggcagcg gcggcgaatt agataaatgg 180

gcaagtttgt ggaattggtt taacataaca aattggctgt ggtatataaa a 231

<210> 2

<211> 309

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgtctgaca atttcacgaa caatgctaaa accataatag tacagctgaa agaatctgta 60

gaaattaatt gtacaagacc caacaacaat acaagaaaaa gtatacatat aggaccaggg 120

agagcatttt atactacagg agaaataata ggagatataa gacaagcaca ttgtaacatt 180

agtagagcaa aatggaatga cactttaaaa cagatagtta taaaattaag agaacaattt 240

gagaataaaa caatagtctt taatcactcc tcaggagggg acccagaaat tgtaatgcac 300

agttttaat 309

<210> 3

<211> 252

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgcaggaag taggaaaagc aatgtatgcc cctcccatca gaggacaaat tagatgttca 60

tcaaatatta cagggctgct attaacaaga gatggtggta ttaatgagaa tgggaccgag 120

atcttcagac ctggaggagg agatatgagg gacaattgga gaagtgaatt atataaatat 180

aaagtagtaa aaattgaacc attaggagta gcacccacca aggcaaagag aagagtggtg 240

caaagagaaa aa 252

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

attggctgtg gtatataaaa gctactaact tcagcctgct 40

<210> 5

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggtcttgtac aattagggcc gggattctcc tc 32

<210> 6

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgtaatgcac agttttaatg ctactaactt cagcctgctg aag 43

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgtgaaattg tcagacatag ggccgggatt ctcctc 36

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggtgcaaaga gaaaaagcta ctaacttcag cctgctgaag 40

<210> 9

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttcctacttc ctgcataggg ccgggattct cctc 34

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aattgtacaa gacccaacaa caatacaa 28

<210> 11

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttttatatac cacagccaat ttgttatgt 29

<210> 12

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atgtctgaca atttcacgaa caatgct 27

<210> 13

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

attaaaactg tgcattacaa tttctgggtc 30

<210> 14

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

atgcaggaag taggaaaagc aatgtatg 28

<210> 15

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tttttctctt tgcaccactc ttctctttg 29

Claims

1. A recombinant influenza virus strain carrying an HIV-1 gene,

2. The recombinant influenza strain of claim 1, wherein the HIV-1 gene is a combined dominant epitope of subtype B V3 and MPER, and the sequence of the HIV-1 gene is as shown in SEQ ID NO: 1, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: v202145.

3. The recombinant influenza virus strain carrying the HIV-1 gene as claimed in claim 1, wherein the HIV-1 gene is a combined dominant epitope of a D loop, a V3 loop and a CD4 binding site of a recombinant form of CRF01_ AE, and the nucleotide sequence of the HIV-1 gene is as shown in SEQ ID NO: 2, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: and V202146.

4. The recombinant influenza virus strain carrying the HIV-1 gene as claimed in claim 1, wherein the HIV-1 gene is a V5 loop, beta 20/21 chain and beta 23/24 chain combined dominant epitope of a recombinant form of CRF01_ AE, and the nucleotide sequence of the HIV-1 gene is as shown in SEQ ID NO: 3, the preservation number of the recombinant influenza virus strain carrying the HIV-1 gene is CCTCC NO: v202147.

5. Use of the recombinant influenza strain carrying an HIV-1 gene as claimed in any one of claims 1 to 4 in the preparation of an HIV-1 vaccine and in the production of HIV proteins using chicken embryos or cells as bioreactors.

6. The use according to claim 5, wherein the vaccine comprises a viral vector vaccine of the recombinant influenza strain carrying the HIV-1 gene according to any one of claims 1 to 3 or a subunit vaccine of the recombinant influenza strain carrying the HIV-1 gene according to any one of claims 1 to 3 prepared using chicken embryos or cells as HIV proteins expressed in a bioreactor.

7. A method of producing a recombinant influenza virus strain carrying an HIV-1 gene, the method comprising:

obtaining HIV-1 gene segments;

8. An HIV-1 protein, wherein the nucleotide sequence encoding the HIV-1 protein is SEQ ID NO: 1-3.

9. A nucleic acid molecule encoding the HIV protein of claim 8.

10. A biological material comprising an expression vector comprising the nucleic acid molecule of claim 8, a cell line comprising one of 293T, COS cells and MDCK, or a recombinant bacterium comprising the expression vector.