CN113462759B - Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection - Google Patents

Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection Download PDF

Info

Publication number
CN113462759B
CN113462759B CN202110882685.7A CN202110882685A CN113462759B CN 113462759 B CN113462759 B CN 113462759B CN 202110882685 A CN202110882685 A CN 202110882685A CN 113462759 B CN113462759 B CN 113462759B
Authority
CN
China
Prior art keywords
artificial sequence
dna
sequencing
sequence
stranded dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110882685.7A
Other languages
Chinese (zh)
Other versions
CN113462759A (en
Inventor
王伟伟
刘萌
刘星宇
张利利
田埂
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Geneis Beijing Co ltd
Original Assignee
Geneis Beijing Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Geneis Beijing Co ltd filed Critical Geneis Beijing Co ltd
Priority to CN202110882685.7A priority Critical patent/CN113462759B/en
Publication of CN113462759A publication Critical patent/CN113462759A/en
Application granted granted Critical
Publication of CN113462759B publication Critical patent/CN113462759B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for enrichment sequencing of a single-stranded DNA sequence based on a combination of multiplex amplification and probe capture and application of the method in mutation detection. The method of the invention firstly carries out single-stranded DNA, and effectively reserves double-stranded DNA and single-stranded DNA into the next experimental link in the subsequent single-stranded library establishment process. On the basis, the capturing and amplifying technology of the target region is integrated and optimized, so that the detection rate and stability of important mutation of the enrichment region can be effectively improved, and the method can be compatible with low-initial-quantity DNA library construction. The method can overcome the problem of single-stranded library construction single-stranded ctDNA missing detection, and provides a technical scheme for greatly improving the library construction effect of low-quality and trace DNA samples.

Description

Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection
Technical Field
The invention relates to gene sequencing, in particular to a sequencing method for enriching single-stranded DNA sequences and application thereof in mutation detection, and especially relates to a sequencing method for enriching and mutating single-stranded DNA sequences based on multiplex amplification and probe hybridization capture and application thereof.
Background
In recent years, liquid biopsy techniques have been widely used clinically, particularly in assisting in diagnosis, treatment, postoperative monitoring, and the like of tumor patients. In contrast to traditional intra-operative sampling, liquid biopsies obtain samples by blood sampling. In healthy humans, cells of tissues of the human body undergo natural apoptosis, and after a series of digestion processes, DNA molecules in the nucleus become fragmented nucleic acid molecules which are released into body fluids such as plasma. When a tissue develops a tumor, a large number of fragmented nucleic acid molecules of specific tissue tumor cells are released into the plasma.
Plasma free DNA also called cfDNA (cell free DNA) refers to DNA free from the outside of cells in the peripheral blood, and the sources of cfDNA include normal cells, abnormal cells (such as tumor cells) or exogenous microorganisms (such as viral DNA), specifically including apoptotic bodies, tumor cell fragments, exosomes, etc. that are metabolized by normal cells themselves. Circulating tumor DNA (Circulating tumor DNA), ctDNA, refers to DNA that breaks down from the new tumor cells formed by the primary tumor, even by metastasis, to the circulating peripheral blood. The ctDNA has important significance in clinical medicine, and the detection of the ctDNA has important clinical value in the aspects of early detection of tumor, targeted treatment of tumor, later disease monitoring and the like. cfDNA detection difficulties are mainly low content, and the population is between 10ng and 50ng.
At present, the common database is built by double chains, and the main problems are as follows: 1. the initial sample amount is 100ng, so that the library cannot be effectively built for single-stranded DNA with low initial amount; 2. cost problems; 3. the low quality of sample DNA, many difficult samples such as FFPE sample, liquid biopsy cfDNA, forensic sample, trace sample because of its own characteristic, single stranded DNA occupies relatively high, double chain library construction can lead to the sequencing coverage deviation great, the effective target area sequencing is incomplete, influence mutation detection, has very big library construction failure risk simultaneously. At present, challenges remain to how to reduce the risk of library construction failure, and especially to improve the capturing efficiency of target fragments and the quality of sequencing data, so as to obtain an effective mutation detection rate.
Disclosure of Invention
Aiming at least part of the technical problems in the prior art, the inventor discovers that ctDNA with part in a single-stranded form exists in blood after intensive research, and the current library construction method often ignores the single-stranded DNA, so that detection is omitted. Based on the above, the inventor proposes a technical scheme capable of greatly improving the effect of constructing libraries of low-quality and trace DNA samples. The target fragment is enriched by multiplex PCR using an upstream primer set INDEX primer with a universal primer binding region on DNA in a single-stranded state, followed by hybridization capture. This combination can greatly enhance the effective enrichment of the target region fragments. The method of the invention not only can effectively improve the detection rate and stability of important mutation in the enrichment region, but also can be compatible with the construction of DNA library with low initial quantity. Specifically, the present invention includes the following.
In a first aspect of the invention, there is provided a method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture, comprising the steps of:
(1) Providing a DNA fragment from a biological sample in a single-stranded state, attaching a linker arm at the end of the DNA fragment, the linker arm being designed to be able to be attached to a linker through a complementary arm of the linker;
(2) The tail end of the DNA fragment is connected with the connector through partial double-chain complementary pairing and connection reaction, and the partial double-chain structure is beneficial to improving the single-chain connection efficiency;
(3) Heating to separate the adaptor from the DNA fragment, thereby forming a first amplified template in a single stranded state;
(4) Performing multiplex PCR by using the first amplification template to obtain a second amplification template, wherein the primers of the multiplex PCR comprise a specific primer and a first INDEX primer;
(5) Performing universal PCR by using the second amplification template to obtain a fragment for hybridization capture, wherein the primers of the universal PCR comprise a universal primer and a second INDEX primer;
(6) Contacting the probe with the hybridization capture fragment to capture the target fragment.
The method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to the present invention preferably further comprises the step of performing post capture PCR, thereby obtaining a sequencing library, wherein the fragment length in the sequencing library is 150-500bp.
According to the method of sequencing single stranded DNA sequence enrichment based on a combination of multiplex amplification and probe capture of the present invention, preferably the first and second INDEX primers are the same primers.
According to the method of sequencing single-stranded DNA sequences enriched based on a combination of multiplex amplification and probe capture of the present invention, preferably, the specific primer comprises a first universal primer binding sequence and a binding sequence capable of specifically complementary binding to a sequence on one side of the target, the first INDEX primer or the second INDEX primer each comprises a second universal primer binding sequence and an INDEX sequence, respectively, and at least a portion of each of the first INDEX primer and the second INDEX primer is capable of complementary binding to at least a portion of a DNA fragment, thereby enabling the INDEX primer to bind to the single-stranded DNA sequence.
According to the method of enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture of the present invention, preferably, the first universal primer binding sequence and the second universal primer binding sequence are identical sequences.
The method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to the present invention, preferably, the biological sample is blood, including whole blood, plasma, serum; the DNA fragment is cfDNA, ctDNA or artificial fragmented DNA fragment.
According to the method of sequencing single stranded DNA sequence enrichment based on a combination of multiplex amplification and probe capture of the present invention, preferably the linker comprises a barcode sequence.
The method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to the present invention preferably further comprises the step of sequencing the sequencing library.
According to the method for enrichment sequencing of single-stranded DNA sequences based on a combination of multiplex amplification and probe capture of the present invention, preferably, the linker arm is poly C, i.e.poly C tail, wherein the number of C is 1-10; the complementary arms are poly G, i.e., poly C-tails, wherein the number of G is 1-10.
In a second aspect of the invention there is provided the use of the method according to the first aspect in the detection of single stranded DNA mutations.
The method of the invention realizes the library establishment of single-stranded DNA in medical samples and the enrichment and sequencing of target gene areas by combining single-stranded library establishment, probe capture and multiplex PCR. Compared with single-strand library establishment (3%), single-probe capture hybridization enrichment (30% -40%) and single-strand multiplex amplification (1% -5%), the method has the advantages that the statistical significance is improved, and the data of the effective target area reaches 80% -90%. In addition, the method of the invention is also significantly superior to other methods of sequencing alone in terms of uniformity of coverage of the target region and the number of sequence coverage layers. The method can effectively improve the capture efficiency of single-stranded nucleic acid and the detection rate of mutation in the tumor screening liquid biopsy sample, so that the detection is more stable and the accuracy is higher.
Drawings
FIG. 1 is a flow chart of an exemplary single-stranded DNA enrichment process of the present invention.
FIG. 2 is a flow chart of an exemplary probe capture process of the present invention.
FIG. 3 shows the result of the product length distribution interval after multiplex PCR amplification.
FIG. 4 shows the result of the product length distribution interval after the universal PCR amplification.
FIG. 5 is a quality test result of an exemplary enrichment-derived sequencing library of the present invention.
Detailed Description
Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present invention, it is understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.
The term "sample" as used herein relates to a material or mixture of materials comprising one or more analytes of interest, typically but not necessarily in liquid form. The sample of the invention contains a nucleic acid sample, which may be a complex sample comprising a plurality of different molecules containing the sequence of interest, such a sample may have more than 10, 50, 100 or 200 different nucleic acid molecules.
Herein, the DNA fragment may originate from any source, such as genomic DNA, cDNA (from RNA), cfDNA, ctDNA or artificial DNA constructs or artificially fragmented DNA fragments. In certain embodiments, the DNA fragment is cfDNA. In further embodiments, the DNA fragment is ctDNA. Any sample containing DNA fragments (e.g., genomic DNA) may be employed herein, including but not limited to blood, tissue samples, or FFPE samples. Preferably, the genomic DNA fragment in the present invention is derived from human genomic DNA.
The term "barcode sequence" as used herein refers to the use of a unique nucleotide sequence to identify and/or track the source of a polynucleotide in a reaction. "barcode sequence" is used interchangeably with "molecular tag" and the barcode sequence may be located at the 5 'end or the 3' end of an oligonucleotide. In some embodiments, the barcode may have a length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides or more.
The term "INDEX" as used herein has its ordinary meaning in the art and refers to an INDEX tag, specifically a stretch of nucleotide sequences that are used to distinguish between different sequencing samples. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length.
The conditions of the various steps of the invention are important to achieve the objects of the invention. The concentrations of the reagents used in the steps (1) to (6) of the present invention, the volume ratio between the primers or the specific amplification procedure are suitable for the method of the present invention. The reagents used in the present invention are all available from known commercial products and kits unless otherwise specified.
[ Step (1) ]
In step (1), a single-stranded DNA fragment from a biological sample is provided, and a single-stranded linker arm is ligated to the end of the DNA fragment, and the linker arm is ligated to the linker through a complementary arm of the linker. The single-stranded DNA fragments may be derived from double-stranded DNA (dsDNA) forms (e.g., genomic DNA fragments, PCR and amplification products, etc.). For example, double stranded DNA molecules can be converted to single stranded DNA using standard techniques well known in the art. The precise sequence of a nucleic acid sample containing a single stranded DNA sequence is generally not important to the disclosure presented herein and may be known or unknown.
Step (1) of the present invention optionally comprises a step of fragmenting the DNA from the biological sample, which may be fragmented in any suitable way, preferably randomly fragmented. Such fragmentation methods are known in the art, and illustrative methods suitable for use in particular embodiments of the methods herein include, but are not limited to, shearing, sonication, enzymatic digestion.
In some embodiments, random fragmentation produces fragments of about 150-500bp in length, preferably about 150-500bp in length, and more preferably 199-451bp in length, by mechanical means, such as nebulization or sonication.
The linker arm in step (1) of the present invention is not particularly limited as long as the linker arm can form a double-stranded structure with the complementary arm, thereby detachably linking the adaptor to the end of the single-stranded DNA molecule, particularly the 3' -end. The linker arm and the complementary arm may be complementary nucleic acid molecules. In an exemplary embodiment, the linker arm is poly C, the number of C being 1-10, preferably 2-8, and still more preferably 3-6. The complementary arms are poly G, the number of G is 1-10, preferably 2-8, and more preferably 3-6. Preferably, the number of C is the same as the number of G to achieve hydrogen bonding complementary locking of the C and G bases in the nucleic acid molecule. It will also be appreciated in the art that the linker arm may also be poly A and the complementary arm may be poly T.
Preferably, the concentration of the single-stranded DNA fragment in step (1) is 1.5-10 ng/. Mu.L, preferably 2.5-8 ng/. Mu.L, and more preferably 3.5-7.5 ng/. Mu.L. The volume of the linker-containing molecule is 0.5-5.5. Mu.l, preferably 1.5-4.5. Mu.l, and more preferably 2.1-3.5. Mu.l.
[ Steps (2) and (3) ]
In the present invention, the ligation arms are ligated to the single-stranded DNA fragments by ligation, and the local double-stranded structure contributes to an improvement in single-stranded ligation efficiency. The composite structure of the complementary arms and adaptors is separated from the single stranded DNA fragments by, for example, heating, to form a first amplified template which is a DNA molecule in single stranded form. The heating temperature is 85-99deg.C, preferably 90-98deg.C.
Preferably, the step (3) is further followed by a step of purifying the ligation product, wherein the purification can be performed using a magnetic bead method, preferably a magnetic bead of 1.2X.
[ Step (4) ]
In step (4), performing multiplex PCR using the first amplification template to obtain a second amplification template, wherein the primers of the multiplex PCR comprise a specific primer and a first INDEX primer. The second amplification template may be a double stranded DNA molecule. The PCR primer is not particularly limited and may be specifically designed according to the sequence of the target fragment. In certain exemplary embodiments, the fragment of interest is selected from BRAF、EGFR、KRAS、NRAS、PIK3CA、PIK3CA、AKT1、CDA、HRAS、PDGFRA、TYMS、CYP19A1、CYP2C19、CYP2C8、CYP2C9、CYP2D6、CYP3A4、DHFR、DPYD、ERCC1、ERCC2、GSTP1、IDH1、IDH2、MDR1(ABCB1)、MTHFR、NOTCH1、NQO1、RRM1、SMAD4、SMAD4、SMO、TSC1、UGT1A1、XRCC1、ESR1 and KIT. The specific primer has a forward primer sequence shown as SEQ ID NO.1-75 and a reverse primer sequence shown as SEQ ID NO. 76-150.
In step (4) of the present invention, the concentrations of the first amplification template and the INDEX primer are not particularly limited and may be freely set by those skilled in the art. Alternatively, the volume ratio of the first amplification template (10 uM) to the INDEX primer (at 10 uM) is 3-12:1, preferably 5-12:1, and more preferably 6-10:1. The volume ratio of specific primer to INDEX primer is 0.5-1.2:1, and preferably 1:1. Wherein the volume of INDEX primer is 0.5-4.5. Mu.l, preferably 0.8-2.5. Mu.l, and more preferably 1.1-2.1. Mu.l.
[ Step (5) ]
In step (5), universal PCR is performed using the second amplification template, the primers of which include universal primer (10 uM) and second INDEX primer (10 uM), to obtain a fragment for hybridization capture. The volume ratio of the second amplification template to the universal primer is 11-25:1, preferably 15-20:1, and more preferably 16-20:1. The volume of the universal primer used is 0.5 to 4.5. Mu.l, preferably 0.8 to 2.5. Mu.l, and more preferably 1.1 to 2.1. Mu.l. The volume ratio of universal primer to second INDEX primer is 0.5-1.2:1, preferably 1:1.
Preferably, the method further comprises a step of purifying the obtained fragment for hybridization capture, and the purification method is not particularly limited, and a magnetic bead method is preferably used, and for example, 0.9×magnetic beads can be used.
[ Step (6) ]
In step (6), the probe and the hybridization capturing fragment are contacted to capture a target fragment. In the present invention, the number of probes in the capture probe is not limited, and may be changed as needed, and may be, for example, a probe set. Generally, the number of probes is 50 or more, preferably 100 or more, more preferably 500 or more, for example 1000, 2000 or the like. In the present invention, the volume of the probe added is 1 to 10. Mu.l, preferably 2 to 8. Mu.l, and more preferably 3 to 7. Mu.l. The fragment for hybridization capture is 200 to 700ng, preferably 300 to 600ng, and more preferably 400 to 550ng. Wherein the concentration of the probe is 0.5 to 1pmol, preferably 0.6 to 0.8pmol.
In the present invention, the probe is contacted with the hybridization capturing fragment for a period of 10 to 20 hours, preferably 12 to 18 hours, and more preferably 13 to 17 hours. In certain embodiments, the probes may further comprise functional groups thereon for isolation, such as biotin and the like. The probe can be bound to or separated from the carrier or the like by such a functional group. For example, probes are immobilized in advance on a carrier such as a magnetic bead or a substrate. In a specific embodiment, the fragment containing the target sequence is hybridized directly to the biotin-labeled probe, and the fragment is anchored to the avidin-bearing magnetic beads by reaction with biotin, and the fragments of non-target sequences are washed away.
In step (6), the volume of the magnetic beads used for hybridization is 80 to 120. Mu.l, preferably 90 to 110. Mu.l, and more preferably 95 to 105. Mu.l. The temperature for the screening of the desired fragment is 60 to 70 ℃, preferably 62 to 68 ℃, and more preferably 63 to 67 ℃. The time for screening the objective fragment is 30-70min, preferably 35-65min, and more preferably 40-50min. The concentration of the magnetic beads used for hybridization is generally 8 to 15mg/ml, preferably 9 to 11mg/ml.
In the present invention, the step (6) is followed by a step of performing post-capture PCR to obtain a sequencing library, wherein the fragment length in the sequencing library is 150-500bp, preferably 150-450bp. Post-capture PCR can be performed using methods known in the art. For example, PCR is performed by using the P5 primer and the P7 primer, and the amount of the primer is not particularly limited, and may be, for example, 1:1.
Preferably, the present invention further comprises a step of purifying the post-capture PCR product, the purification method is not particularly limited, and the magnetic bead method is preferred, and the magnetic beads of the magnetic bead method may be, for example, 0.9X magnetic beads.
The capturing efficiency of the method of the present invention is not less than 86%, preferably not less than 90%, and still preferably not less than 91%. For example, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more.
The percentage of read length of the target region or fragment of interest or target sequence of the method of the invention is not less than 86%, preferably not less than 90%, still preferably not less than 91%. For example 92%, 93%, 94%, 95%, 96%, 97%, 98%.
The repeat sequence in the sequencing data of the method of the invention is not higher than 11%, preferably not higher than 10%, and still preferably not higher than 8%. For example, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less.
The effective target region data in the sequencing data of the method of the present invention is not less than 80%, preferably not less than 85%, more preferably not less than 90%.
It is noted that other steps or operations may be included before, after, or between steps (1) - (6) of the present invention, such as further optimizing and/or improving the methods described herein. It should be noted that, in the method of the present invention, any one of the steps is absent or the order of the steps is changed, for example, step (4) is performed first, then step (5) is performed, or the steps of the present invention are replaced, for example, by using a conventional single-chain library construction, so that the object of the present invention cannot be achieved.
Examples
After multiplex PCR of cfDNA in single-stranded state by using an upstream primer FP MIX combined with an INDEX primer with a universal primer binding region, target fragments are enriched by hybridization capture. The method can greatly improve the effective enrichment of the target region fragments. See fig. 1 and 2 for a specific flow. The following is a detailed description.
1. Materials or apparatus
GDNA fragmentation (Fragmentation of Genomic DNA)
1.1M220 starting up, and filling water by using AFA-GRADE WATER. When the temperature is reduced to below 10 ℃, the water-soluble polyurethane can be used.
1.2 Interrupt parameters: setting corresponding parameters 340s, and breaking to 150bp.
1.3 50. Mu.l of the system (DNA sample +ddH 2 O) were added to a covaris glass tube, which was put into a cell disrupter after a short centrifugation for DNA disruption.
1.4 After the end of the glass tube the fragmented DNA was transferred to a labeled PCR tube. Quality control was performed using Qubit detection concentration.
DNA template pretreatment
The thermal cycler (PCR instrument) is placed at 95 ℃ in advance, the temperature of a thermal cover is set to 105 ℃, and a T7 Tailing & Ligation premix is prepared and placed on ice for standby.
2.1 100Ng of fragmented DNA was placed in a 0.2ml PCR tube and Low-EDTA was added to adjust the total volume to 15ul.
2.2 After the PCR instrument stabilized to 95℃and the PCR tube was placed in the PCR instrument, incubation was performed for 2min at 95 ℃. Immediately, the PCR tube was cooled on ice and allowed to stand for 2min.
3. Single-chain joint connection
The PCR instrument was set at 37℃in advance and the temperature of the hot cap was set at 105 ℃.
3.1 Preparing a T7 Tailing & Ligation premix according to the following table, wherein the premix needs to be prepared in advance and placed on ice for no more than 20min.
TABLE 1T 7 Tailing & Ligation System
Reagent(s) Volume of
T7 Buffer 4μl
T7 Adapter 2.5μl
T7 Enzyme Mix 3μl
Low-EDTA TE 15.5μl
Total 25μl
And 3.2, adding 25ulT7 Tailing&Ligation premix liquid into a pretreatment DNA sample PCR tube placed on ice, blowing and uniformly mixing by using a pipettor, and then performing instantaneous centrifugation to enable the reaction liquid to reach the bottom of the tube.
3.3 The PCR tube was placed in a PCR apparatus (thermal lid temperature 105 ℃) and T7 Tailing & Ligation was performed.
TABLE 2T 7 Tailing & Ligation procedure
Temperature (temperature) Time of
37℃ 15min
95℃ 2min
4℃ hold
3.4 Magnetic bead purification of ligation products
After the reaction is finished, transferring the sample into a centrifuge tube containing 1.2 XXP beads, blowing and mixing uniformly, and standing for 5-10min at room temperature.
A. the magnetic force frame is placed until the liquid becomes clear, and the liquid is sucked from the side far away from the magnetic beads (the magnetic beads are not sucked).
B. 200 μl of 80% freshly prepared ethanol is added from the side far from the magnetic beads, the lid is closed, the magnetic frame is rotated inwards and outwards to wash down the magnetic beads on the wall and the lid, and then the liquid is sucked and discarded. The washing was performed twice.
C. After instantaneous centrifugation, the magnetic rack is put back, and after the 10 mu l of pipettor is used for sucking the redundant liquid, the cover is opened and the magnetic beads are aired until the color of the magnetic beads is changed from shining to matte.
D. Adding 22.5 mu lddH 2 O along one side of the magnetic bead, blowing and mixing uniformly, and standing at room temperature for 5min.
E. After the liquid has clarified, the sample is aspirated from the side remote from the beads onto a new labelled PCR tube (not to the beads).
4. Multiplex PCR amplification
4.1 Taking out the multiplex amplification Buffer from the temperature of minus 20 ℃ in advance, melting and fully mixing the 10uM premixed multiplex primer mixture and the corresponding INDEX primer on ice, wherein the primer has a sequence shown as SEQ ID NO. 1-150.
INDEX Primer(ATCACG)：5'-Spc/C*A*A*GCAGAAGACGGCATACGAGATXXXXXX(XX)GTGACTGGAGTTCAGACGTGTGCTCTTCCGA*T*C*T-3'.
4.2 The reagents of Table 3 were added sequentially on ice according to the following system.
TABLE 3 multiplex PCR amplification System
Component (A) Volume (ul)
The product of the last step 13.5
10uM Primer MIX 1.5
10uM index Primer 1.5
5×MultiPCR Buffer 4
Total 20.5μl
After mixing by blowing, the mixture was centrifuged instantaneously and put into a PCR instrument (the procedure of Table 4 was run in advance).
TABLE 4 multiplex PCR amplification procedure
After completion of the reaction, 20ul of the PCR system was supplemented with 30ul of low TE to 50ul, and the multiplex PCR product was recovered by purification with 1 XP beads (50. Mu.l), and the purification method was referred to in step 3.4. Finally, 25 mu lddH 2 O was used for elution and transferred to a new PCR tube, wherein the concentration of PCR product was 15-45ng/ul.
4.3 1. Mu.l of purified product was detected with 2100 high-sensitivity chip, and the amplified product was quality controlled to determine the presence of product peaks in the expected length interval (150-400 bp). FIG. 3 is a graph schematically showing the quality control results of MultiPCR-2.
Universal PCR reaction
5.1 Remove 2X kapa hifihotstart ready mix, PCR PRIMER P7 and uni VERSAL PRIMER from the kit stored at-20℃and melt on ice and mix thoroughly.
5’-Spc/A*A*T*GATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*T-3’。
5.2 On ice the reagents shown in the following table were added in the following order:
TABLE 5 Universal PCR reagent
Component (A) Volume (ul)
Template 22.5
10uM universal primer 1.25
10uM Primer p7 1.25
2×kapa hifihotstart ready mix 25
Total 50μl
And (5) carrying out instantaneous centrifugation after blowing and mixing uniformly, and putting the mixture into a PCR instrument to operate the following procedure.
5.3PCR reaction procedure:
TABLE 6 Universal PCR amplification procedure
5.4 Purification after completion of the reaction with 0.9XXP beads (45. Mu.l) was performed according to step 3.4. Finally, the solution was eluted with 21 mu lddH 2 O and transferred to a labeled centrifuge tube. The PCR product concentration was 25-45 ng/ul). The tag information includes Index number, sample ID, as shown in table 7.
TABLE 7
Sample numbering index Library Qubit value (ng/ul) Total library volume (ul) Library total amount (ng)
1 Single chain-1 74.6 21 1566.6
2 Single chain-2 77.4 21 1625.4
3 Single chain-3 89 21 1869
5.5 Purified product 1. Mu.l of purified sample was taken and subjected to library fragment length measurement and quality control with Agilent 2100Bioanalyzer system (HIGH SENSITIVITY DNA KIT) to determine that the major product peak was within the expected length interval (200-450 bp), see in particular FIG. 4.
Library structure:
Spc/A*A*T*GATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGA*T*C*TNNNNNNNNNNNPloyCSpc/C*A*A*GCAGAAGACGGCATACGAGATXXXXXX(XX)GTGACTGGAGTTCAGACGTGTGCTCTTCCGA*T*C*T.
6. library probe hybridization
6.1. Reagent and library preparation to be captured
6.1.1 The three libraries described above were hybridized in a mix according to Table 8, mixed in equal amounts at the Qubit concentration.
TABLE 8 library mixing
Hybrid mode Library number Amount per library
Three miscellaneous one 3 170ng
6.1.2 Mixing of blocking oligo, cot-1 and DNA library as above well mixed according to Table 9.
TABLE 9 closed system
Equivalent mixed libraries of linked Barcode/Index 500ng
Cot-1DNA 5ul
blocking oligos 2ul
6.1.3 Shaking and mixing the mixed solution, opening an EP tube cover, concentrating and evaporating to a dry powder state in a vacuum concentrator at 60 ℃.
The vacuum concentrator was set at 60℃for 15min. Checking the evaporating state of the mixture after 15min, and if the liquid is not evaporated, continuing evaporating at 60 ℃ for 15min to avoid excessive drying.
6.2 Library capture with a premix probe combination, wherein the probe set has the sequence as shown in SEQ ID NO. 151-235:
6.2.1 preparation of reagents required for capture reagents:
a) The required reagents (as in table 10 below) were found out from the freezer and thawed at room temperature.
B) The following reagents were added sequentially to the above-described EP tube which had been evaporated to dryness:
TABLE 10 Capture reagent
XGen 2X Hybridization Buffer (blue cover) 8.5ul
XGen Hybridization Buffer Enhancer (Brown) 2.7ul
Nuclease-Free Water 1.8ul
Sum up 13ul
Incubating for 10min at room temperature; the following procedure was set and run on block1 in Proflex PCR: "95 ℃, forever", thermal lid 105 ℃.
C) After the end of 10min, the mixed liquid is fully vibrated, centrifuged, and the mixed liquid is transferred to a 0.2ml PCR tube, and the PCR tube is placed in a block1 for 10min.
D) The following procedure as in table 11 was set up and run in the PCR instrument to prepare capture probes. c at the end of the procedure, transfer the PCR tube to 65℃block and immediately add 4ul of gene probe. Fully oscillating, uniformly mixing and centrifuging: timing 16h.
TABLE 11 Capture procedure
Program Thermal cover state of PCR instrument
65℃，forever Thermal cover 75 ℃ closing cover of PCR instrument
6.2.2.2 Elution of the capture nonspecific fragment and preparation of magnetic beads (preparation of reagents starting 2h before the end of hybridization reaction):
a) Thawing the eluent in the following table from refrigerator (freezing), taking out M270 magnetic beads from 4deg.C, and mixing under shaking
B) Preparing a1 Xeluent (eluent needs to be prepared in situ and can be prepared 2 hours before hybridization reaction is finished):
Table 12 below shows the elution solutions required for 1 elution, and the respective elution solutions were prepared according to the hybridization amounts.
TABLE 12 elution working fluid configuration
Concentrating and eluting buffer Concentrated buffer (ul) Nuclease-free water (ul)
xGen2×Bead Wash Buffer 250 250
xGen 10×Wash Buffer1 30 270
xGen 10×Wash Buffer2 20 180
xGen 10×Wash Buffer3 20 180
xGen 10×Stringent Wash Buffer 40 360
C) For the prepared 1 XWash Buffer1 and STRINGENT WASH Buffer working solutions, working solutions with different temperatures are created according to the following table (namely STRINGENT WASH Buffer working solution is preheated by a metal bath at 65 ℃ for 2 hours, and Wash Buffer1 working solution is divided into working solution preheated at 65 ℃ for 2 hours and working solution at normal temperature). Table 13 below shows the amount of 1 capturing, which is appropriately prepared according to the number of capturing.
TABLE 13 working fluid configuration
D) The M270 beads were again shaken well and 100ulM ml EP tube was filled with the beads. And the EP tube was placed on a magnetic rack.
E) After 2-5min, the supernatant is discarded after the magnetic beads are adsorbed on the magnetic rack. And adding 200ul 1 XBead Wash Buffer, taking the EP tube off the magnetic frame, shaking and mixing for 10s, and placing the EP tube on the magnetic frame again.
F) Step e is repeated once.
G) After 2-5min, the supernatant is discarded after the magnetic beads are adsorbed on the magnetic rack. 100ul of 1 XBead Wash Buffer was added, vortexed, mixed well, and transferred to a 0.2ml PCR tube.
H) After hybridization, a 0.2ml PCR tube was placed on a magnetic rack 5min before hybridization, and after the solution was clarified, the supernatant was discarded.
6.2.3M270 magnetic bead screening of fragments of interest:
a. when hybridization is completed, the M270 magnetic beads prepared in the step h are placed in a block at 65 ℃, hybridization reaction liquid is completely transferred into a PCR tube of the M270 magnetic beads within 1min, and the mixture is rapidly and uniformly oscillated and put back into the block at 65 ℃ for 45min (if a plurality of hybridization reactions exist, the process needs to be operated one by one).
B. in the incubation process at 65 ℃, shaking and uniformly mixing are carried out every 8min, so that M270 magnetic beads are ensured to be in a resuspended state.
6.2.4 Washing of M270 magnetic beads, elution of non-hybridizing fragments (1 Xwashing buffer used):
a. washing at 65 ℃ (fast operation, guaranteed temperature close to 65 ℃): after 45min incubation, 1 XWash Buffer 1 preheated at 65 ℃ in 50ul of metal bath is quickly transferred to corresponding M270 fishing reaction mixed solution, sucked and beaten for 3 to 5 times at a constant speed, all the liquid is quickly transferred to an EP tube corresponding to the 1 XWash Buffer 1 preheated at 65 ℃ in the metal bath, and the mixed solution is temporarily put back into the metal bath at 65 ℃ to finish the steps one by one if a plurality of hybridization reactions exist, then placed on a magnetic frame one by one, and the supernatant is quickly sucked and beaten back into the metal bath at 65 ℃.
B. Washing at 65 ℃ (fast operation, guaranteed temperature close to 65 ℃): 200ul of preheated STRINGENT WASH Buffer working solution is added, mixed well by vortex, centrifuged briefly and incubated at 65℃for 5min. If there are multiple hybridization reactions, after 5min incubation, placing on a magnetic rack one by one, rapidly (within 30 s) absorbing and discarding the supernatant, and placing back into a metal bath at 65deg.C.
C. Repeating b once.
D. Washing at room temperature: and c, adding 200ul of 1 XWash Buffer 1 at room temperature into the beads in the step c, uniformly mixing for 30s by vortex, simply centrifuging, placing the mixture on a magnetic rack, and discarding the supernatant after the solution is clarified.
E. washing at room temperature: 200ul of 1 XWash Buffer 2 is added into the beads, vortex mixing is carried out for 30s, simple centrifugation is carried out, the beads are placed on a magnetic rack, and after the solution is clarified, the supernatant is discarded.
F. Washing at room temperature: 200ul of 1 XWash Buffer 3 is added into the beads, vortex mixing is carried out for 30s, simple centrifugation is carried out, the beads are placed on a magnetic rack, and after the solution is clarified, the supernatant is discarded. Centrifuging and placing back to the magnetic rack, and sucking the supernatant.
G. The beads were resuspended: the EP tube containing the beads was removed from the magnet holder and 22.5ul nuclease free water was added. Vortex vibration mixing, adding into the following PCR reaction solution (with magnetic beads for PCR reaction)
6.2.5 Post capture PCR
A. post-capture PCR reaction solution preparation
TABLE 14 preparation of post-Capture PCR reaction solution
2×KAPA HiFi HotStartReadyMix 25ul
10uM Illumina P5 primer(Illumina Primer A) 1.25ul
10uM Illumina P7 primer(Illumina Primer B) 1.25ul
The product with magnetic beads in the above g 22.5ul
Sum up 50ul
B. After shaking and mixing, the following procedure PCR (Proflex PCR apparatus) was performed:
98 ℃ for 45s;98 ℃ for 15s;60 ℃ for 30s;72 ℃,30s;72 ℃,60s;4 ℃, hold,15 cycles, and the thermal cover of the PCR instrument is closed at 105 ℃.
6.2.6 Purification of PCR product after capture:
a. 45ul XP beads, which had equilibrated at room temperature for 0.5h, were added to the new EP tube.
B. the PCR products were removed from the PCR apparatus and mixed well, added to an EP tube (0.9X) containing 45ul XP beads, mixed well with shaking and incubated at room temperature for 5min.
C. After incubation, the mixed product is placed on a magnetic rack, and the supernatant is discarded after the supernatant is completely separated from the magnetic beads.
D. 200ul of freshly prepared 80% ethanol was added to the tube to wash the beads for 1min and the supernatant (ethanol) was discarded.
E. Repeating step d once.
F. the beads were dried at room temperature or 37 ℃.
G. After the magnetic beads are dried, 23ul of water is added, the mixture is shaken and stirred evenly, and the mixture is kept stand for 5min at room temperature.
H. Placing on a magnetic rack, and sucking 22ul of supernatant into a new EP tube after the magnetic beads are completely separated from the supernatant, and marking information such as sample name, library type, library date, index/barcode and the like.
6.3 Quality control
A. 1 μl of library was quantified using Qubit DSDNA HS ASSAY KIT and library concentrations were recorded;
b. 1ul of the sample was taken and subjected to library fragment length measurement and quality control using Agilent 2100Bioanalyzer system (HIGH SENSITIVITY DNA KIT) to determine that the target main peak fragment was within the expected length region (200-450 bp), see specifically FIG. 5.
C. Sequencing was performed using the NGS sequencing platform.
7. Data analysis and quality control results
7.1 Sequencing data processing
For the sequencing original data of the next machine, fastp software is used for quality control of the data, when the software automatically identifies the primer, processes and filters the sequence with low quality, the sliding window filtering value and the base average homogeneity value are set to be-W4 and-M is Q20. The data obtained through quality control is compared to a human reference genome (hg 19) by using second generation sequencing data comparison software bwa-mem mode, so that the position information and the comparison quality information of each sequence are obtained. The results after alignment were then used picard software to remove the duplicates formed by PCR amplification. The alignment results after the duplication removal are ordered and indexed using software (e.g., samtools).
2. Data results
1. Sequencing data results are shown in table 15:
TABLE 15 sequencing data results
Bamqc results table 16:
Table 16-Bamqc results
Identification of Calling Condition-mutation
And analyzing the obtained second-generation sequencing comparison result of the sample by using freebayes software, identifying mutation in the sample, setting the minimum comparison quality value-m of the parameter as 10, the minimum quality value-q as 20, setting the minimum alternation score-F as 0.01, and setting the minimum observed base number-C as 1. Mutations identified in freebayes were annotated using annovar software.
TABLE 17 analysis of comparison results
4. Different methodology capture efficiency comparison
The invention adopts different methodologies to compare the capturing efficiency, including a multiple enrichment method and single-chain library establishment enrichment. See in particular table 18.
TABLE 18 enrichment efficiency comparison
Note that: ontarget ratio = Ontarget reads/MAPPED READS.
5. Comparison of different methodological coverage and uniformity
The invention adopts different methodologies to compare coverage and uniformity, including single-chain library establishment and enrichment by adopting a multiple enrichment method. See in particular table 19.
TABLE 19 coverage and uniformity comparison
/>
/>
While the invention has been described with reference to exemplary embodiments, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications or changes may be made to the exemplary embodiments of the present disclosure without departing from the scope or spirit of the invention. The scope of the claims is to be accorded the broadest interpretation so as to encompass all modifications and equivalent structures and functions.
Sequence listing
<110> Yuan code Gene technology (Beijing) Co., ltd
<120> Method for sequencing single-stranded DNA sequences based on combination of multiplex amplification and probe capture and use in mutation detection
<130> BH2110311
<141> 2021-08-02
<160> 234
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 1
ctcttgagga tcttgaagga aactg 25
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 2
tgccactttc ccttgtagac tg 22
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 3
ccacactgac gtgcctctcc 20
<210> 4
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 4
tctgcctcac ctccaccg 18
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 5
ccgcagcatg tcaagatcac 20
<210> 6
<211> 33
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 6
gatctgtatt tatttcagtg ttacttacct gtc 33
<210> 7
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 7
ctgaattagc tgtatcgtca aggc 24
<210> 8
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 8
ctcatgtact ggtccctcat tgc 23
<210> 9
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 9
cctgagcctg ttttgtgtct actg 24
<210> 10
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 10
tggttctgga ttagctggat tgtc 24
<210> 11
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 11
cgcctgtcct catgtattgg tc 22
<210> 12
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 12
acagctcaaa gcaatttcta cacg 24
<210> 13
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 13
aactgagcaa gaggctttgg ag 22
<210> 14
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 14
gtgccatcat tcttgaggag g 21
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 15
ccctgaagcc tgagtgtgtc c 21
<210> 16
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 16
ctggatggtc agcgcactc 19
<210> 17
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 17
cgcatgtact ggtcccgc 18
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 18
ttgtgaagat ctgtgacttt ggc 23
<210> 19
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 19
caatgtctca aacatcatca cgg 23
<210> 20
<211> 17
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 20
gccacttggc ctgcctc 17
<210> 21
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 21
tgtagcctgg ttctctggtg tg 22
<210> 22
<211> 28
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 22
tctcttagat atgcaataat tttcccac 28
<210> 23
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 23
tgaatgaaaa catcaggatt gtaagc 26
<210> 24
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 24
cagtgagctt cctcttgaac acg 23
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 25
gctgcggaat tttgggatg 19
<210> 26
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 26
ggagccacat gccctacaca g 21
<210> 27
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 27
agtccacatg cagcaggttg 20
<210> 28
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 28
ccattctagc ggggcacag 19
<210> 29
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 29
ctcttccatt cttcatcctc agc 23
<210> 30
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 30
gatgggtgtg gaatggcag 19
<210> 31
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 31
cattcaccaa cttatgccaa ttctc 25
<210> 32
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 32
ggtcatgtag catttaccac agttg 25
<210> 33
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 33
gcgaaggatt tctgatctgt gg 22
<210> 34
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 34
gctggtggct ggagttgc 18
<210> 35
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 35
caatgtttct tgtctaattt cttggc 26
<210> 36
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 36
ctggcccagc acatagtcg 19
<210> 37
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 37
cagagtctgg ggaggaggc 19
<210> 38
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 38
cagagctgct gagcaatctg c 21
<210> 39
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 39
gggctcaccc tgcagcac 18
<210> 40
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 40
gaatgacggc gtggaggac 19
<210> 41
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 41
gcaaaatcac attattgcca aca 23
<210> 42
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 42
gggctcccgg aagacagtc 19
<210> 43
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 43
cctggcctac ctggtcgc 18
<210> 44
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 44
cgatgaaggc atgtatgttg gc 22
<210> 45
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 45
gcctcaaaga aaagctgcgt g 21
<210> 46
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 46
cccgagaggt aaagaacgaa gac 23
<210> 47
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 47
ggacgagctg gaccactgg 19
<210> 48
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 48
tgtcagagca ttcagaacca tcc 23
<210> 49
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 49
ggcgtctgct ggagtgtgc 19
<210> 50
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 50
tgtagggttt gaagactggg atg 23
<210> 51
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 51
cccatttatt tcctatagct cctgag 26
<210> 52
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 52
catttaaggt tccttcaagc tgc 23
<210> 53
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 53
tgctggattg aaattcactt acacc 25
<210> 54
<211> 16
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 54
gccgctgagc cactgc 16
<210> 55
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 55
tcaacagttc aggccagtgc 20
<210> 56
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 56
gtggtcctca cctatgcctg g 21
<210> 57
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 57
ctggcctttg gctttgtgc 19
<210> 58
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 58
cacttctacg acttcttcaa ccagg 25
<210> 59
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 59
agcccatccc tgactgtgag 20
<210> 60
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 60
cctgtttgcc atgtttggaa c 21
<210> 61
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 61
caggttgact gggcagagtg ac 22
<210> 62
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 62
gttgtctctc ctcctgtcag tgc 23
<210> 63
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 63
ctgtatcagt ctgtccagca cttcc 25
<210> 64
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 64
gtgacacagt caaacattaa cttggtg 27
<210> 65
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 65
cctagcacct gacgcctcg 19
<210> 66
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 66
ccagcacagg ataaggagca g 21
<210> 67
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 67
cgttgtccga gctcacctg 19
<210> 68
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 68
gcttctctct ctcactctct ctctgc 26
<210> 69
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 69
cctacagtaa caaaggcatg gagc 24
<210> 70
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 70
ctagtgcatt caagcacaat ggc 23
<210> 71
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 71
aggtgatcta tttttccctt tctccc 26
<210> 72
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 72
ggaaggttgt tgaggagata aatgg 25
<210> 73
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 73
ccatttgaca gaacgggaag c 21
<210> 74
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 74
gtgattcatt tatttgttca aagcagg 27
<210> 75
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 75
ctccttactc atggtcggat cac 23
<210> 76
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 76
gggaccttac cttatacacc gtgc 24
<210> 77
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 77
gatgggcaga ttacagtggg ac 22
<210> 78
<211> 16
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 78
ccagcaggcg gcacac 16
<210> 79
<211> 17
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 79
caggaggcag ccgaagg 17
<210> 80
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 80
ctccttactt tgcctccttc tgc 23
<210> 81
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 81
gctcaggact tagcaagaag ttatgg 26
<210> 82
<211> 29
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 82
gctgaaaatg actgaatata aacttgtgg 29
<210> 83
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 83
gaaacctgtc tcttggatat tctcg 25
<210> 84
<211> 30
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 84
gagttaagga ctctgaagat gtacctatgg 30
<210> 85
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 85
tggtgtgaaa tgactgagta caaactg 27
<210> 86
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 86
gatggtgaaa cctgtttgtt ggac 24
<210> 87
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 87
ctccatttta gcacttacct gtgactc 27
<210> 88
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 88
agatccaatc catttttgtt gtcc 24
<210> 89
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 89
gggtagagtg tgcgtggctc 20
<210> 90
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 90
aggaaagtga ctgtaggggc ag 22
<210> 91
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 91
cctgaggagc gatgacgg 18
<210> 92
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 92
gtgcctgttg gacatcctgg 20
<210> 93
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 93
ctgcctttcg acacatagtt cg 22
<210> 94
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 94
gccctccacg gtactcctg 19
<210> 95
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 95
acggaggcag gcgaagtg 18
<210> 96
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 96
ctcctatggg ttgtcaccaa gc 22
<210> 97
<211> 28
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 97
caaaatatca ctttccataa aagcaagg 28
<210> 98
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 98
gactgtaagt ggtttctcag gaagc 25
<210> 99
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 99
ctccctcaca accttgcgg 19
<210> 100
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 100
caactcctcc acaaggcagc 20
<210> 101
<211> 26
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 101
ctgaatttaa tgtcacaggt cactgc 26
<210> 102
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 102
gctcctggtg gacctgatgc 20
<210> 103
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 103
ggtgcccact ggacagcc 18
<210> 104
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 104
ctctagcctt ttggtccagt gg 22
<210> 105
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 105
cttctccaag accccaactg ag 22
<210> 106
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 106
ctgcatattg gtgtcaaagt gtcac 25
<210> 107
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 107
tggaacattt ggtgaattga gc 22
<210> 108
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 108
tgacaattga tttccccgta gg 22
<210> 109
<211> 28
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 109
cctattgatc tggtggacat tagtgtag 28
<210> 110
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 110
aatcctcgaa cacaaactca tgc 23
<210> 111
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 111
gcaatcccgt actgaagttc g 21
<210> 112
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 112
gactacacag gctgctgctg c 21
<210> 113
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 113
agcctggagc agctagaatc ag 22
<210> 114
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 114
gagacggacg cccacctg 18
<210> 115
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 115
gcagatgctc acatagttgg tgtag 25
<210> 116
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 116
cttgtgagtg gatgggtaaa acc 23
<210> 117
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 117
gctgaagaag atgtggaaaa gtcc 24
<210> 118
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 118
ctggaccaag cccatcacc 19
<210> 119
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 119
gctgagaaca ttgcctatgg agac 24
<210> 120
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 120
gaggctgacc tgaagcactt g 21
<210> 121
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 121
ggaggagctg ctgaagatgt g 21
<210> 122
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 122
caccagctac aggtgcctga g 21
<210> 123
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 123
agtttgctta cacttacgct gcc 23
<210> 124
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 124
ggcattctgc atttctgtgg c 21
<210> 125
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 125
ctccttattt agagtgaact ggattgg 27
<210> 126
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 126
gaaggaacct taaatgtctc tcctacc 27
<210> 127
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 127
cctgtggaca ttggagagtt gac 23
<210> 128
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 128
tgtgggtctg caatcggc 18
<210> 129
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 129
cccaggcaca cgttgtagc 19
<210> 130
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 130
ctccacgtcc tcgtaccagc 20
<210> 131
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 131
caggtggaag taggaggtct tgc 23
<210> 132
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 132
cacatagtcc cggaagctgc 20
<210> 133
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 133
catgcccctc actcacagc 19
<210> 134
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 134
ccaaacatgg caaacaggtt g 21
<210> 135
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 135
ggtacgcctc cagatgagca g 21
<210> 136
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 136
gccttggcaa tcatcttgct c 21
<210> 137
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 137
ctctgcctca accagccac 19
<210> 138
<211> 27
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 138
gaagactgag gagctgttaa agaaagc 27
<210> 139
<211> 18
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 139
ctcctgccag aggttcgc 18
<210> 140
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 140
ctccctttgg aatggcacag 20
<210> 141
<211> 20
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 141
ggagtgggtg ctggactgtc 20
<210> 142
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 142
tgtgaaggag gaggatgaga gc 22
<210> 143
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 143
ggatatggtc cttctcttcc agag 24
<210> 144
<211> 19
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 144
gtccagcatc tccagcagc 19
<210> 145
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 145
gcagaagtct tgcccacatc g 21
<210> 146
<211> 25
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 146
gatcataagg aagttgtgtt gggtc 25
<210> 147
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 147
aagcccctgt ttcatactga cc 22
<210> 148
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 148
tgcaggctcc aagtagattc ac 22
<210> 149
<211> 24
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 149
ggaagactcc tttgaatgca gaag 24
<210> 150
<211> 23
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 150
caagcagaga atgggtactc acg 23
<210> 151
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 151
acttgtcaca atgtcaccac attacatact taccatgcca ctttcccttg tagactgttc 60
caaatgatcc agatccaatt ctttgtccca ctgtaatctg cccatcagga atctcccaat 120
<210> 152
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 152
ggatccagac aactgttcaa actgatggga cccactccat cgagatttca ctgtagctag 60
accaaaatca cctattttta ctgtgaggtc ttcatgaaga aatatatctg aggtgtagta 120
<210> 153
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 153
ccaaccaagc tctcttgagg atcttgaagg aaactgaatt caaaaagatc aaagtgctgg 60
gctccggtgc gttcggcacg gtgtataagg taaggtccct ggcacaggcc tctgggctgg 120
<210> 154
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 154
cactgacgtg cctctccctc cctccaggaa gcctacgtga tggccagcgt ggacaacccc 60
cacgtgtgcc gcctgctggg catctgcctc acctccaccg tgcagctcat cacgcagctc 120
<210> 155
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 155
atgcccttcg gctgcctcct ggactatgtc cgggaacaca aagacaatat tggctcccag 60
tacctgctca actggtgtgt gcagatcgca aaggtaatca gggaagggag atacggggag 120
<210> 156
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 156
gccaggaacg tactggtgaa aacaccgcag catgtcaaga tcacagattt tgggctggcc 60
aaactgctgg gtgcggaaga gaaagaatac catgcagaag gaggcaaagt aaggaggtgg 120
<210> 157
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 157
atattcgtcc acaaaatgat tctgaattag ctgtatcgtc aaggcactct tgcctacgcc 60
accagctcca actaccacaa gtttatattc agtcattttc agcaggcctt ataataaaaa 120
<210> 158
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 158
acaaagaaag ccctccccag tcctcatgta ctggtccctc attgcactgt actcctcttg 60
acctgctgtg tcgagaatat ccaagagaca ggtttctcca tcaattacta cttgcttcct 120
<210> 159
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 159
atgattttgc agaaaacaga tctgtattta tttcagtgtt acttacctgt cttgtctttg 60
ctgatgtttc aataaaagga attccataac ttcttgctaa gtcctgagcc tgttttgtgt 120
<210> 160
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 160
taacttcttg ctaagtcctg agcctgtttt gtgtctactg ttctagaagg caaatcacat 60
ttatttccta ctaggaccat aggtacatct tcagagtcct taactctttt aatttgttct 120
<210> 161
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 161
atattcatct acaaagtggt tctggattag ctggattgtc agtgcgcttt tcccaacacc 60
acctgctcca accaccacca gtttgtactc agtcatttca caccagcaag aacctgttgg 120
<210> 162
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 162
cacagaggaa gccttcgcct gtcctcatgt attggtctct catggcactg tactcttctt 60
gtccagctgt atccagtatg tccaacaaac aggtttcacc atctataacc acttgttttc 120
<210> 163
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 163
aaatgacaaa gaacagctca aagcaatttc tacacgagat cctctctctg aaatcactga 60
gcaggagaaa gattttctat ggagtcacag gtaagtgcta aaatggagat tctctgtttc 120
<210> 164
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 164
cttagataaa actgagcaag aggctttgga gtatttcatg aaacaaatga atgatgcaca 60
tcatggtggc tggacaacaa aaatggattg gatcttccac acaattaaac agcatgcatt 120
<210> 165
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 165
aatgaaggtg ccatcattct tgaggaggaa gtagcgtggc cgccaggtct tgatgtactc 60
ccctacagac gtgcgggtgg tgagagccac gcacactcta cccgtcagac cctcgccagg 120
<210> 166
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 166
cctgcaccct gaagcctgag tgtgtccagc agctgctggt ttgctcccag gaggccaaga 60
agtcagccta ctgcccctac agtcactttc ctgtgggggc tgccctgctc acccaggagg 120
<210> 167
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 167
gtattcgtcc acaaaatggt tctggatcag ctggatggtc agcgcactct tgcccacacc 60
gccggcgccc accaccacca gcttatattc cgtcatcgct cctcaggggc ctgcggcccg 120
<210> 168
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 168
cacacaggaa gccctccccg gtgcgcatgt actggtcccg catggcgctg tactcctcct 60
ggccggcggt atccaggatg tccaacaggc acgtctcccc atcaatgacc acctgcttcc 120
<210> 169
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 169
tgatgctatt cagctacaga tggcttgatc ctgagtcatt tcttcctttt ccatgcagtg 60
tgtccaccgt gatctggctg ctcgcaacgt cctcctggca caaggaaaaa ttgtgaagat 120
<210> 170
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 170
ctgtgacttt ggcctggcca gagacatcat gcatgattcg aactatgtgt cgaaaggcag 60
tgtacgtcct cacttccctc actggtcagg ctcatcctcc ttcactttaa tctctaaagt 120
<210> 171
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 171
atgaaacttc ctggactatt ttggccaaca atgtctcaaa catcatcacg gagatccact 60
cccgagacag gagtaccgtg gagggccgtg tgactttcgc caaagtggag gagaccatcg 120
<210> 172
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 172
gcgcggaagg ggtcctgcca ccgcgccact tggcctgcct ccgtcccgcc gcgccacttg 60
gcctgcctcc gtcccgccgc gccacttcgc ctgcctccgt cccccgcccg ccgcgccatg 120
<210> 173
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 173
cttggcctct gctttttctc ttgtagcctg gttctctggt gtgaacagga gcagatgaca 60
aatagcacct agcttggtga caacccatag gaggtatgcc tataaaatgc catgggccac 120
<210> 174
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 174
taaattattg ttttctctta gatatgcaat aattttccca ctatcattga ttatttcccg 60
ggaacccata acaaattact taaaaacctt gcttttatgg aaagtgatat tttggagaaa 120
<210> 175
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 175
caatttctta acttgatgga aaaattgaat gaaaacatca ggattgtaag caccccctgg 60
atccaggtaa ggccaagttt tttgcttcct gagaaaccac ttacagtctt tttttctggg 120
<210> 176
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 176
tttttctcaa ctcctccaca aggcagtgag cttcctcttg aacacggtcc tcaatgctcc 60
tcttccccat cccaaaattc cgcaaggttg tgagggagaa acgccggatc tccttccatc 120
<210> 177
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 177
ggcgtttctc cctcatgacg ctgcggaatt ttgggatggg gaagaggagc attgaggacc 60
gtgttcaaga ggaagcccgc tgccttgtgg aggagttgag aaaaaccaag ggtgggtgac 120
<210> 178
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 178
tgcaagacag gagccacatg ccctacacag atgctgtggt gcacgaggtc cagagataca 60
ttgaccttct ccccaccagc ctgccccatg cagtgacctg tgacattaaa ttcagaaact 120
<210> 179
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 179
gttctggaag tccacatgca gcaggttgcc cagcccgggc agtggcaggg ggcctggtgg 60
gtagcgtgca gcccagcgtt ggcgccggtg catcaggtcc accaggagca ggaagatggc 120
<210> 180
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 180
gctggggact aggtacccca ttctagcggg gcacagcaca aagctcatag ggggatgggg 60
tcaccaggaa agcaaagaca ccatggtggc tgggccgggg ctgtccagtg ggcaccgaga 120
<210> 181
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 181
gaaggttgga gacagcaatg atcgtaatct cttccattct tcatcctcag ctatagagat 60
ggcacttttc ataaatccca ctggaccaaa aggctagagt tcaaagcaga aacattttgt 120
<210> 182
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 182
acaatgtcaa ggactggcaa gagtgccaca tgtgatgggt gtggaatggc agctcactgt 60
agcaggtgct ggggactcag ttggggtctt ggagaagcac ttagttatag caagaatgtc 120
<210> 183
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 183
taaataaaca ttcaccaact tatgccaatt ctcttgtttt agatgttaaa tcacacttac 60
gttgtctgga aagtcagcct ttagttcagt gacactttga caccaatatg cagccgtttt 120
<210> 184
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 184
ggtagccaga atcattacag gtcatgtagc atttaccaca gttgatacac atttcttcat 60
caatcatagc cacaacttgc tctacgttgc tcaattcacc aaatgttcca aggtactgca 120
<210> 185
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 185
ggcttcagac attttttctg ggggaggcag cgaaggattt ctgatctgtg ggatactcat 60
tgctttgaat acctacgggg aaatcaattg tcatggttaa aattttgaaa ctagcttaca 120
<210> 186
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 186
tcttcgaatc attgatgtgc tggtggctgg agttgcgcta gcaagaccaa aaggatttat 60
aaacttcaat ccggccattt ctacactaat gtccaccaga tcaataggag tgtaaaagag 120
<210> 187
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 187
gttcttatca ggatttcttt tccaatgttt cttgtctaat ttcttggccg aagtggaacg 60
cagagttgca tgagtttgtg ttcgaggatt taaagccagg atactctaaa gacagcataa 120
<210> 188
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 188
gcacaggtgc tctggcccag cacatagtcg ggaattacgt cgccaaattc ccagggcaca 60
ttgcgcacga acttcagtac gggattgccc ctctggggag ggacgaaggg cagaagccat 120
<210> 189
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 189
cgccactgaa ttcagagtct ggggaggagg ctcccacagg ccgggacaag aagcggaagc 60
agcagcagca gcagcctgtg tagtctgccc ccgggaaact gaggaactaa agaaagctga 120
<210> 190
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 190
aaccgtttat ggccccaccc gccccactca gagctgctga gcaatctgct ctatcctctt 60
cagcgtctcc tctgattcta gctgctccag gctgagcagg gacaggccca gctgatcctc 120
<210> 191
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 191
gaggcgggaa agggactggg gggcagcggg gggtcggggc tcaccctgca gcacttcgtc 60
gggcagcacg gggttggcca ggtgggcgtc cgtctcccgg gcggcgctgg cctcccgcag 120
<210> 192
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 192
aggaggcagc cctggtggac atggtgaatg acggcgtgga ggacctccgc tgcaaataca 60
tctccctcat ctacaccaac tatgtgagca tctgcaccag ggttgggcac tgggggctga 120
<210> 193
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 193
aaaaacatgc aaaatcacat tattgccaac atgacttact tgatccccat aagcatgacg 60
acctatgatg ataggtttta cccatccact cacaagccgg gggatatttt tgcagataat 120
<210> 194
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 194
ggtgcccagg tcagtggatc ccctctccac cctggcctac ctggtcgcca tgggcgtgcc 60
tgccaatggt gatgggcttg gtccagccag ggactaggcg tgggatgttt ttgcagatga 120
<210> 195
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 195
ggcgtgggat gtttttgcag atgatgggct cccggaagac agtccccccc aggatgttcc 60
ggatagttcc attgggactt ttccacatct tcttcagctt gaactctgtg aggacagaga 120
<210> 196
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 196
cttacattag gcagtgactc gatgaaggca tgtatgttgg cctcctttgc tgccctcaca 60
atctcttcct gtgacaccac ccggctgttg tctccatagg caatgttctc agcaatgctg 120
<210> 197
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 197
ccttcacaaa gcggaagaat gtgtcagcct caaagaaaag ctgcgtgatg atgaaatcgg 60
ctcccgcaga caccttctcc ttcaagtgct tcaggtcagc ctcaaagctc cctgcttcgg 120
<210> 198
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 198
tgtgaccatt ccggtttggt tctcccgaga ggtaaagaac gaagacttca aagacacttt 60
cttcactggt cagctcctcc ccccacatct tcagcagctc ctccttgggg gacttgctct 120
<210> 199
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 199
accaccacca ccacagccgc accttggcgt gagctcagca gccagcggcc acctgggccg 60
gagcttcctg agtggagagc cgagccaggc agacgtgcag ccactgggcc ccagcagcct 120
<210> 200
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 200
ggcggtgcac actattctgc cccaggagag ccccgccctg cccacgtcgc tgccatcctc 60
gctggtccca cccgtgaccg cagcccagtt cctgacgccc ccctcgcagc acagctactc 120
<210> 201
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 201
ctcgcctgtg gacaacaccc ccagccacca gctacaggtg cctgagcacc ccttcctcac 60
cccgtcccct gagtcccctg accagtggtc cagctcgtcc ccgcattcca acgtctccga 120
<210> 202
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 202
ctggtccgag ggcgtctcca gccctcccac cagcatgcag tcccagatcg cccgcattcc 60
ggaggccttc aagtaaacgg cgcgccccac gagaccccgg cttcctttcc caagccttcg 120
<210> 203
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 203
ggcgtctgtg tgcgctctgt ggatgccagg gccgaccaga ggagcctttt taaaacacat 60
gtttttatac aaaataagaa cgaggatttt aatttttttt agtatttatt tatgtacttt 120
<210> 204
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 204
tcggaccagt cggagacgtt ggaatgcggg gacgagctgg accactggtc aggggactca 60
ggggacgggg tgaggaaggg gtgctcaggc acctgtagct ggtggctggg ggtgttgtcc 120
<210> 205
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 205
atcaggacag accacccaga agctggctgt cagagcattc agaaccatcc acctacccgg 60
aagggtcctt tgtcatacat ggcagcgtaa gtgtaagcaa actctcctat gaacactcgc 120
<210> 206
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 206
ttccaggatt tgaattcggg cgtctgctgg agtgtgccca atgctatatg tcagttgagg 60
ttctaagact tggaagccac agaaatgcag aatgccactc tgaggataca gaaagcacag 120
<210> 207
<211> 119
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 207
ctaataattg tctttacttt ccttgtaggg tttgaagact gggatgtatt atttaaggac 60
aagaccagcg gctaatccaa tccagttcac tctaaataag gagaagctaa aagataaag 119
<210> 208
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 208
tgttctttcc catttatttc ctatagctcc tgagtattgg tgttccattg cttactttga 60
aatggatgtt caggtaggag agacatttaa ggttccttca agctgcccta ttgttactgt 120
<210> 209
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 209
tcaggtagga gagacattta aggttccttc aagctgccct attgttactg ttgatggata 60
cgtggaccct tctggaggag atcgcttttg tttgggtcaa ctctccaatg tccacaggac 120
<210> 210
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 210
ttccttcaag ctgccctatt gttactgttg atggatacgt ggacccttct ggaggagatc 60
gcttttgttt gggtcaactc tccaatgtcc acaggacaga agccattgag agagcaaggt 120
<210> 211
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 211
gcatcaaaga aacaccttgc tggattgaaa ttcacttaca ccgggccctc cagctcctag 60
acgaagtact tcataccatg ccgattgcag acccacaacc tttagactga ggtcttttac 120
<210> 212
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 212
gaggaggagc gcggcggtga ctggccctcc gccgccgctg agccactgcg gccgggctgc 60
cccctgcgag ccgctgcgct acaacgtgtg cctgggctcg gtgctgccct acggggccac 120
<210> 213
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 213
agaatgaggt gcagaacatc aagttcaaca gttcaggcca gtgcgaagtg cccttggttc 60
ggacagacaa ccccaagagc tggtacgagg acgtggaggg ctgcggcatc cagtgccaga 120
<210> 214
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 214
ggtttggttt gtggtcctca cctatgcctg gcacacttcc ttcaaagccc tgggcaccac 60
ctaccagcct ctctcgggca agacctccta cttccacctg ctcacctggt cactcccctt 120
<210> 215
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 215
cctttggctt tgtgctcatt accttcagct gccacttcta cgacttcttc aaccaggctg 60
agtgggagcg cagcttccgg gactatgtgc tgtgagtgag gggcatggag gcggcagtgc 120
<210> 216
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 216
accatcgggc tgcccaccaa gcagcccatc cctgactgtg agatcaagaa tcgcccgagc 60
cttctggtgg agaagatcaa cctgtttgcc atgtttggaa ctggcatcgc catgagcacc 120
<210> 217
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 217
tctggtggag aagatcaacc tgtttgccat gtttggaact ggcatcgcca tgagcacctg 60
ggtctggacc aaggccacgc tgctcatctg gaggcgtacc tggtgcaggt gggcatggca 120
<210> 218
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 218
ctccttccct atcccttctg ctctcaggtt gactgggcag agtgacgatg agccaaagcg 60
gatcaagaag agcaagatga ttgccaaggc cttctctaag cggcacgagc tcctgcagaa 120
<210> 219
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 219
gagccagggc cccaggctcg tgttgtctct cctcctgtca gtgcccccag aggaacaagc 60
caacctgtgg ctggttgagg cagagatctc cccagagctg cagaagcgcc tgggccggaa 120
<210> 220
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 220
ccctgctgta tcagtctgtc cagcacttcc attggggagg tagagggcac accatcttcc 60
tctgtgtttc cttttgcttt ctttaacagc tcctcagtct tcctgatgac aaaatgatgg 120
<210> 221
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 221
tttttatagt cacgtgacac agtcaaacat taacttggtg tatcgattgg tttttgccat 60
atatatatat ataagtagga gagggcgaac ctctggcagg agcaaaggcg ccatggctgt 120
<210> 222
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 222
agcagagggg acatgaaata gttgtcctag cacctgacgc ctcgttgtac atcagagacg 60
gagcatttta caccttgaag acgtaccctg tgccattcca aagggaggat gtgaaagagt 120
<210> 223
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 223
attcctggca ttgcccagca caggataagg agcagggttg gcgtgtgagg ccttacctct 60
gggagggcag ccgccgacgc atgcggtgac agtccagcac ccactcctta cgcacgatgc 120
<210> 224
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 224
ccctactcac tcaggaccca cgttgtccga gctcacctgg ggatgtcttg ttgatccggc 60
tgaagaagag agcccccggc ctcagagagt tggcgctctc atcctcctcc ttcacacgga 120
<210> 225
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 225
ctctttgagc ttctctctct cactctctct ctgcgcattc aggagtgtac acatttctgt 60
ccagcaccct gaagtctctg gaagagaagg accatatcca ccgagtcctg gacaagatca 120
<210> 226
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 226
ctacagtaac aaaggcatgg agcatctgta cagcatgaag tgcaagaacg tggtgcccct 60
ctatgacctg ctgctggaga tgctggacgc ccaccgccta catgcgccca ctagccgtgg 120
<210> 227
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 227
ggcttttgtt ttcttccctt tagatgctct gcttctgtac tgccagtgga tgtgcagaca 60
ctaaactcat ctgggccacc gtttggaaag ctagtggttc agagttctat agattctagt 120
<210> 228
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 228
gcattcaagc acaatggcac ggttgaatgt aaggcttaca acgatgtggg caagacttct 60
gcctatttta actttgcatt taaaggtaac aacaaaggta tatttctttt taatccaatt 120
<210> 229
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 229
aatgactgag acaataatta ttaaaaggtg atctattttt ccctttctcc ccacagaaac 60
ccatgtatga agtacagtgg aaggttgttg aggagataaa tggaaacaat tatgtttaca 120
<210> 230
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 230
tagacccaac acaacttcct tatgatcaca aatgggagtt tcccagaaac aggctgagtt 60
ttggtcagta tgaaacaggg gctttccatg tcaccttttt gggtacacat aacagtgact 120
<210> 231
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 231
ttagcgagtg cccatttgac agaacgggaa gccctcatgt ctgaactcaa agtcctgagt 60
taccttggta atcacatgaa tattgtgaat ctacttggag cctgcaccat tggaggtaaa 120
<210> 232
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 232
tatatatctc accttctttc taaccttttc ttatgtgctt ttagggccca ccctggtcat 60
tacagaatat tgttgctatg gtgatctttt gaattttttg agaagaaaac gtgattcatt 120
<210> 233
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 233
tatttgttca aagcaggaag atcatgcaga agctgcactt tataagaatc ttctgcattc 60
aaaggagtct tcctggtaag actgatttac ataaatagtt agctgttgac aggcagttca 120
<210> 234
<211> 120
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 234
cactctttac aagttaaaat gaatttaaat ggttttcttt tctcctccaa cctaatagtg 60
tattcacaga gacttggcag ccagaaatat cctccttact catggtcgga tcacaaagat 120

Claims (9)

1. A non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture, comprising the steps of:
(1) Providing a DNA fragment from a biological sample in a single-stranded state, attaching a linker arm at the end of the DNA fragment, the linker arm being designed to be able to be attached to a linker through a complementary arm of the linker;
(2) The tail end of the DNA fragment is connected with the connector through partial double-chain complementary pairing and connection reaction, and the partial double-chain structure is beneficial to improving the single-chain connection efficiency;
(3) Heating to separate the adaptor from the DNA fragment, thereby forming a first amplified template in a single stranded state;
(4) Performing multiplex PCR by using the first amplification template to obtain a second amplification template, wherein the primers of the multiplex PCR comprise a specific primer and a first INDEX primer;
(5) Performing universal PCR by using the second amplification template to obtain a fragment for hybridization capture, wherein the primers of the universal PCR comprise universal primers and second INDEX primers;
(6) Contacting the probe with the hybridization capture fragment to capture a target fragment;
Further comprising the step of performing post-capture PCR to thereby obtain a sequencing library, wherein fragments in the sequencing library are 150-500bp in length;
Wherein the specific primer comprises a first universal primer binding sequence and a binding sequence capable of specifically complementary binding to a sequence on one side of the target sequence, the first or second INDEX primer each comprises a second universal primer binding sequence and an INDEX sequence, respectively, and at least a portion of each of the first and second INDEX primers is identical to at least a portion of the sequence of the adaptor, thereby enabling the INDEX primer to form a double-stranded structure with the DNA fragment.
2. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to claim 1, wherein the first and second INDEX primers are the same primer.
3. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to claim 1, wherein the first universal primer binding sequence and the second universal primer binding sequence are identical sequences.
4. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to claim 1, wherein the biological sample is blood, including whole blood, plasma, serum.
5. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to claim 1, wherein the DNA fragments are cfDNA or ctDNA or artificially fragmented DNA fragments.
6. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture of claim 1, wherein the linker comprises a barcode sequence.
7. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture of claim 1, further comprising the step of sequencing a sequencing library.
8. The non-diagnostic method for enrichment sequencing of single stranded DNA sequences based on a combination of multiplex amplification and probe capture according to claim 1, wherein the linker arm is poly C, the number of C being 1-10; the complementary arms are poly G, and the number of G is 1-10.
9. The method of any one of claims 1-8, wherein the single stranded DNA comprises a mutation.
CN202110882685.7A 2021-08-02 2021-08-02 Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection Active CN113462759B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110882685.7A CN113462759B (en) 2021-08-02 2021-08-02 Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110882685.7A CN113462759B (en) 2021-08-02 2021-08-02 Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection

Publications (2)

Publication Number Publication Date
CN113462759A CN113462759A (en) 2021-10-01
CN113462759B true CN113462759B (en) 2024-06-25

Family

ID=77883789

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110882685.7A Active CN113462759B (en) 2021-08-02 2021-08-02 Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection

Country Status (1)

Country Link
CN (1) CN113462759B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117248003B (en) * 2023-11-13 2024-04-12 元码基因科技（北京）股份有限公司 Compositions, pre-libraries and methods of construction thereof for whole telomere amplicon sequencing

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107586835A (en) * 2017-10-19 2018-01-16 东南大学 A kind of construction method of sequencing library of future generation based on single-stranded joint and its application
CN109706219A (en) * 2018-12-20 2019-05-03 臻和（北京）科技有限公司 Construct the method for splitting of the method for sequencing library, kit, upper machine method and sequencing data
CN110468211A (en) * 2019-10-14 2019-11-19 湖南大地同年生物科技有限公司 Bladder cancer tumor mutant gene specific primer, kit and library constructing method
CN110699426A (en) * 2019-01-02 2020-01-17 上海臻迪基因科技有限公司 Gene target region enrichment method and kit
CN111534858A (en) * 2020-04-29 2020-08-14 杭州瑞普基因科技有限公司 Library construction method for high-throughput sequencing and high-throughput sequencing method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7482443B2 (en) * 2000-03-09 2009-01-27 Genetag Technology, Inc. Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107586835A (en) * 2017-10-19 2018-01-16 东南大学 A kind of construction method of sequencing library of future generation based on single-stranded joint and its application
CN109706219A (en) * 2018-12-20 2019-05-03 臻和（北京）科技有限公司 Construct the method for splitting of the method for sequencing library, kit, upper machine method and sequencing data
CN110699426A (en) * 2019-01-02 2020-01-17 上海臻迪基因科技有限公司 Gene target region enrichment method and kit
CN110468211A (en) * 2019-10-14 2019-11-19 湖南大地同年生物科技有限公司 Bladder cancer tumor mutant gene specific primer, kit and library constructing method
CN111534858A (en) * 2020-04-29 2020-08-14 杭州瑞普基因科技有限公司 Library construction method for high-throughput sequencing and high-throughput sequencing method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ABclonal 单链DNA建库试剂盒——针对困难样本的建库解决方案.https://blog.abclonal.com.cn/2020/03/23/show66/.2020,全文. *

Also Published As

Publication number Publication date
CN113462759A (en) 2021-10-01

Similar Documents

Publication Publication Date Title
JP2019176867A (en) Nucleic acid probes and methods for detecting genomic fragments
US20140080126A1 (en) Quantification of nucleic acids and proteins using oligonucleotide mass tags
WO2020228788A1 (en) Array and method for detecting spatial information of nucleic acids
JP2002525049A (en) Molecular cloning using rolling circle amplification
WO2019144582A1 (en) Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types
EP2844766B1 (en) Targeted dna enrichment and sequencing
CN106399546B (en) Capture probe and kit for detecting human circulating tumor DNA EGFR gene by high-throughput sequencing
WO2023060871A1 (en) Hla gene amplification primer, kit, sequencing library establishment method, and sequencing method
JP2020536525A (en) A method for concentrating the probe and the target region to which it is applied for high-throughput sequencing
JP2015528294A (en) Multiphase nucleic acid amplification
CN109234357B (en) Method, primer combination, kit and application for detecting fusion mutation of target gene
CN110938673A (en) Method for generating single-stranded DNA (deoxyribonucleic acid) by using strand displacement primer mediated asymmetric PCR (polymerase chain reaction)
CN112410331A (en) Linker with molecular label and sample label and single-chain library building method thereof
CN113462759B (en) Method for enrichment sequencing of single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection
CN109337956B (en) Design method and kit for enriching multi-gene stem-loop probe based on NGS technology
CN116790718B (en) Construction method and application of multiplex amplicon library
TW201802244A (en) Methods of constructing circular template and detecting DNA molecules
CN112662761A (en) Probe composition for detecting 3 parenchymal organ tumors
CN111501106A (en) Construction method, device and application of high-throughput sequencing library of exosome RNA
EP4060052A1 (en) Methods for accurate parallel quantification of nucleic acids in dilute or non-purified samples
CN112266963B (en) Detection kit for combined detection of chronic granulocytic leukemia
JP2003093058A (en) IMPROVED METHOD FOR AMPLIFYING RANDOM cDNA
US20210040540A1 (en) Parallel liquid-phase hybrid capture method for simultaneously capturing sense and antisense double strands of genomic target region
CN114085895B (en) Detection primer for rapidly detecting MSI and kit thereof
CN114317737B (en) Composition for lung cancer screening and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant