CN113444812A - Kit and method for identifying Qinling mountain zokor - Google Patents
Kit and method for identifying Qinling mountain zokor Download PDFInfo
- Publication number
- CN113444812A CN113444812A CN202110944093.3A CN202110944093A CN113444812A CN 113444812 A CN113444812 A CN 113444812A CN 202110944093 A CN202110944093 A CN 202110944093A CN 113444812 A CN113444812 A CN 113444812A
- Authority
- CN
- China
- Prior art keywords
- seq
- zokor
- rrna gene
- conserved motif
- reagent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 19
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 59
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 41
- 108020004465 16S ribosomal RNA Proteins 0.000 claims abstract description 32
- 108700036248 MT-RNR1 Proteins 0.000 claims description 32
- 238000012163 sequencing technique Methods 0.000 claims description 18
- 238000012408 PCR amplification Methods 0.000 claims description 11
- 230000003321 amplification Effects 0.000 claims description 8
- 238000001514 detection method Methods 0.000 claims description 8
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 5
- 238000000246 agarose gel electrophoresis Methods 0.000 claims description 3
- 230000002457 bidirectional effect Effects 0.000 claims description 3
- 239000008280 blood Substances 0.000 claims description 3
- 210000004369 blood Anatomy 0.000 claims description 3
- 238000007480 sanger sequencing Methods 0.000 claims description 3
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 claims description 2
- 241000894007 species Species 0.000 description 30
- 108020004414 DNA Proteins 0.000 description 19
- 102000053602 DNA Human genes 0.000 description 19
- 238000003752 polymerase chain reaction Methods 0.000 description 12
- 230000015572 biosynthetic process Effects 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 238000003786 synthesis reaction Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 210000003625 skull Anatomy 0.000 description 4
- 241001312322 Eospalax fontanierii Species 0.000 description 3
- 241001312327 Eospalax fontanierii baileyi Species 0.000 description 3
- 230000004544 DNA amplification Effects 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 210000005228 liver tissue Anatomy 0.000 description 2
- 210000002050 maxilla Anatomy 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 210000001519 tissue Anatomy 0.000 description 2
- 210000000216 zygoma Anatomy 0.000 description 2
- 241001312324 Eospalax Species 0.000 description 1
- 241001312319 Eospalax fontanierii cansus Species 0.000 description 1
- 241001312333 Eospalax rothschildi Species 0.000 description 1
- 241001312330 Eospalax rufescens Species 0.000 description 1
- 241000428833 Eospalax smithii Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241001568482 Myospalax aspalax Species 0.000 description 1
- 241001312335 Myospalax psilurus Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 108091036078 conserved sequence Proteins 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 230000002431 foraging effect Effects 0.000 description 1
- 210000003470 mitochondria Anatomy 0.000 description 1
- 230000002438 mitochondrial effect Effects 0.000 description 1
- 210000004115 mitral valve Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 238000004321 preservation Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012549 training Methods 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for identifying Qinling mountain zokor, which comprises a reagent for detecting the following SNP loci in a 12SrRNA gene of a species to be detected: 5, and/or the following SNP sites in 16S rRNA gene: position 35 of the conserved motif sequence shown in SEQ ID NO 6. The invention provides a kit for simply, conveniently and accurately identifying the species of zokor in Qinling and a method for identifying the zokor in Qinling, solves the problem of identifying the species of zokor through morphology, and has excellent application prospect in the species identification of zokor.
Description
Technical Field
The invention belongs to the technical field of identification, and particularly relates to a kit and a method for identifying Qinling mountain zokor.
Background
Zokor is a collective name for animals of the zokoridae (myospalaceneae) and is mainly distributed in china and the south siberian. Existing zokors include the cranium rat (Eospalax) and the cranium rat (myspaax), and nearly all zokor species are distributed in our country. The cranium zokor includes 2-3 species such as grassland zokor (m.aspalax) and northeast zokor (m.psilurus), and the cranium zokor is distributed only in China, and includes 6 species such as chinese zokor (e.fontanieri), swirski zokor (e.smithi), rochon (e.rothschildi), plateau zokor (e.baileyi), gansu zokor (e.cansus) and qinling zokor (e.rufesens). Zokor lives in a closed underground tunnel system almost for the whole life, and the unique underground life style makes the zokor have particularity in aspects such as foraging, marriage and breeding, and arouse the wide interest of scientists.
Among them, the qinling mountain zokor (e.rufescens) is mainly distributed in the mountains of shanxi (qinling), ningxia (southern portion of the six pan mountain), gansu, etc. of china, and inhabits in comparatively shady mountains, forests, forest meadows, meadow grasslands and farmland habitat above the altitude of 1400 m.
Identification and identification of biological species is the basis for the recognition and preservation of biodiversity, and more fields of research can be developed only after each species of organism can be accurately identified. But because different zokors have similar living environments and converge in forms, accurate species identification through the forms without professional training is very difficult.
Therefore, the research on the method and the reagent capable of rapidly and accurately identifying the species of the Qinling mountain zokor has very important significance.
Disclosure of Invention
The invention aims to provide a kit and a method capable of simply, conveniently and accurately identifying zokor species, and solves the problem of identifying zokor species through morphology.
The invention provides a kit for identifying Qinling mountain zokor, which is characterized by comprising a reagent for detecting the following SNP loci in a 12S rRNA gene of a species to be detected: position 55 of the conserved motif sequence shown in SEQ ID NO. 5,
and/or, reagents for the following SNP sites in the 16S rRNA gene: position 35 of the conserved motif sequence shown in SEQ ID NO 6.
Further, the air conditioner is provided with a fan,
the reagent is a reagent for simultaneously detecting SNP sites in the 12S rRNA gene and SNP sites in the 16S rRNA gene;
or, the bases of the SNP sites are as follows:
the 55 th base of the conserved motif sequence shown in SEQ ID NO. 5 is G; the 35 th base of the conserved motif sequence shown in SEQ ID NO. 6 is C.
Through research of the inventors, the 2 SNP sites in the application usually exist simultaneously, namely when the 55 th base of the conserved motif sequence shown in SEQ ID NO. 5 is G, the 35 th base of the conserved motif sequence shown in SEQ ID NO. 6 is C. Further experiments show that only the genome of the Qinling mountain zokor has the 2 SNP loci, so that whether the species to be detected is the Qinling mountain zokor can be identified by detecting any one or two loci in the 2 SNPs.
Further, the reagent is: a sequencing reagent, a reagent for the KASP method, or a reagent for the restriction fragment length polymorphism method.
Further, the kit also comprises a reagent for amplifying the conserved motif sequence of the 12S rRNA gene and/or a reagent for amplifying the conserved motif sequence of the 16S rRNA gene; the 12S rRNA gene conserved motif sequence is a sequence shown by SEQ ID NO. 5, and the 16S rRNA gene conserved motif sequence is a sequence shown by SEQ ID NO. 6.
Furthermore, the reagent for amplifying the 12S rRNA gene conserved motif sequence comprises a primer pair shown in SEQ ID NO. 1-2, and/or the reagent for amplifying the 16S rRNA gene conserved motif sequence comprises a primer pair shown in SEQ ID NO. 3-4.
The invention also provides a pair of primer pairs, which are primer pairs with sequences shown as SEQ ID NO. 1-2, or primer pairs with sequences shown as SEQ ID NO. 3-4.
The invention also provides application of a reagent for amplifying the conserved motif sequence in a kit for identifying the Qinling mountain zokor, wherein the conserved motif sequence is any one or two sequences shown in SEQ ID NO. 5-6;
preferably, the reagent comprises a primer pair shown in SEQ ID NO. 1-2 and/or a primer pair shown in SEQ ID NO. 3-4.
The invention also provides
A method for identifying a Qin mountain zokor is characterized by comprising the following steps:
(1) extracting total genomic DNA of a zokor sample to be detected;
(2) the reagent for detecting the following SNP sites in the 12S rRNA gene: position 55 of the conserved motif sequence shown in SEQ ID NO. 5; and/or, reagents for the following SNP sites in the 16S rRNA gene: analyzing the 35 th site of the conserved motif sequence shown in SEQ ID NO. 6;
preferably, the sample in step (1) is a tissue sample or a blood sample.
Further, the air conditioner is provided with a fan,
the detection step in the step (2) is as follows:
1) taking the DNA extracted in the step (1) as a template, and carrying out PCR amplification by using an amplification reagent to obtain an amplification product;
2) carrying out agarose gel electrophoresis detection on the PCR amplification product obtained in the step 1);
3) sequencing the PCR amplification product with a bright band of 490bp in the detection result of the step 2) to obtain a 12S rRNA gene sequence; and/or sequencing the PCR amplification product with the 1450bp bright band to obtain a 16S rRNA gene sequence;
4) analyzing the following SNP loci in the 12S rRNA gene obtained in the step 3): position 55 of the conserved motif sequence shown in SEQ ID NO. 5; and/or analyzing the following SNP sites in the 16S rRNA gene obtained in the step 3): position 35 of the conserved motif sequence shown in SEQ ID NO. 6;
preferably, the amplification reagent in the step 1) comprises a primer pair shown in SEQ ID NO 1-2 and/or a primer pair shown in SEQ ID NO 3-4; the annealing temperature of PCR amplification is 52-56 ℃; step 3) the sequencing is bidirectional Sanger sequencing.
Further, the detection in the step (2) is to detect the SNP site in the 12S rRNA gene and the SNP site in the 16S rRNA gene simultaneously;
or, the bases of the SNP loci are as follows, and then the zokor to be detected is the Qinling zokor:
the 55 th base of the conserved motif sequence shown in SEQ ID NO. 5 is G; the 35 th base of the conserved motif sequence shown in SEQ ID NO. 6 is C.
The invention has the beneficial effects that:
firstly, 2 SNP genotypes specific to the zokor in Qinling are simultaneously appeared in a 12S rRNA gene segment and a 16S rRNA gene segment (DNA bar codes), and 1 or two of the SNP genotypes are detected to judge that the zokor to be detected is the zokor in Qinling, so that the requirement on the sequencing length is low. The invention adopts 2 SNP loci with Qinling mountain zokor specific genotype to identify zokor species, the SNP loci can be mutually verified, and the result is more accurate and reliable.
The key point of the invention is that the relation between 2 SNP loci in the conserved motif sequences of zokor 12S rRNA gene fragments and 16S rRNA gene fragments and the species of Qinling zokor is found, and on the basis, any reagent or equipment capable of detecting the bases of any one or two SNP loci can be used for species identification of the Qinling zokor.
Specifically, the embodiments of the present invention provide examples of detecting SNP sites by means of sequencing. The primer pair has good specificity, and does not produce non-specific amplification with DNA fragments except for a target by utilizing the primer pair to carry out PCR; the amplification target gene is a mitochondria single copy gene, does not need cloning, can be directly used for sequencing, and has simple method. The invention also provides 2 segments of the conserved motif sequences of Qinling mountain zokor species, which can assist in determining the position of the specific SNP loci of Qinling mountain zokor species in the 12S rRNA gene segment or the 16S rRNA gene segment (DNA bar code), and is convenient for determining the genotype of the SNP loci.
Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
FIG. 1 and PCR sequencing peak of zokor 12S rRNA gene PCR product (first motif partial sequence) numbered TCX-7 in example 3.
FIG. 2 and PCR product sequencing peak of zokor 16S rRNA gene (second motif sequence) numbered TCX-7 in example 3.
FIG. 3 and PCR product sequencing peak of zokor 12S rRNA gene (partial sequence of the first motif) numbered FFX-5 in example 3.
FIG. 4 and PCR product sequencing peak of zokor 16S rRNA gene (second motif site sequence) numbered FFX-5 in example 3.
Detailed Description
In order that the invention may be more clearly understood, it will now be further described with reference to the following examples and the accompanying drawings. The examples are for illustration only and do not limit the invention in any way.
The experimental methods in the examples, in which specific conditions are not noted, are conventional methods and conventional conditions well known in the art, or conditions as recommended by the manufacturer; the various chemicals used in the examples are commercially available and the primers used are committed to synthesis.
Example 1, the invention relates to a kit for identifying Qinling mountain zokor
The kit comprises the following components:
(1) PCR amplification reagents: comprises primer pairs of SEQ NO 1-2 and primer pairs of SEQ NO 3-4; (2) a sequencing reagent.
Example 2 PCR primer design and validation of SNP sites
The applicant compares mitochondrial genome sequences of 121 zokor individuals in 8 zokor species, finds that 1 Qinling zokor species-specific SNP genotype exists in 12S rRNA genes, 1 Qinling zokor species-specific SNP genotype exists in 16S rRNA genes, and conserved sequences exist at two ends of the 2 SNP loci, so that 12S rRNA gene fragments and/or 16S rRNA gene fragments are determined to be DNA barcodes for Qinling zokor species identification.
8 zokor species 121 zokor individuals: 12 grassland zokors, 10 northeast zokors, 15 Chinese zokors, 18 Sterson zokors, 16 Roche zokors, 14 plateau zokors, 24 Gansu zokors and 12 Qinling mountain zokors.
Primers were designed for the 12S rRNA and the nearby gene sequences in conserved regions as follows:
ME12S-1L：AGCACTGAAAATGCTTAGATGG(SEQ ID NO:1)；
ME12S-1R：CGGCTAAGCATAGTGGGGTA(SEQ ID NO:2)。
the primers for 16S rRNA and the nearby gene sequences in the conserved regions were designed as follows:
ME16S-1L：AGAGGAGATAAGTCGTAACAAGGT(SEQ ID NO:3)
ME16S-1R：TCCTGATCCAACATCGAGGT(SEQ ID NO:4)。
amplifying DNA samples of different zokor species by using the primers, and confirming 1 SNP locus of 12S rRNA gene and 1 SNP locus of 16S rRNA gene for identifying the zokor species in Qinling mountains:
1) the 320 th base (the 55 th base of a conserved motif sequence shown in SEQ ID NO: 5) genotype G of the Qinling zokor 12S rRNA gene amplification product, and the site genotype of other species is A;
2) the gene type C of 389 basic group (the 35 th basic group of conservative motif sequence shown in SEQ ID NO: 6) of Qinling zokor 16S rRNA gene amplification product, and the site gene type of other species is T.
The result proves that the bases of the 2 specific SNP loci are different from other zokors in the Qinling mountain, and the Qinling mountain zokor can be identified by detecting the 6 specific SNP loci.
Example 3 species identification of Qinling mountain zokor
First, a 12S rRNA primer pair and a 16S rRNA primer pair were synthesized:
ME12S-1L：AGCACTGAAAATGCTTAGATGG(SEQ ID NO:1)；
ME12S-1R：CGGCTAAGCATAGTGGGGTA(SEQ ID NO:2)。
ME16S-1L：AGAGGAGATAAGTCGTAACAAGGT(SEQ ID NO:3)
ME16S-1R：TCCTGATCCAACATCGAGGT(SEQ ID NO:4)。
the following method is adopted for identification:
a) respectively extracting total genomic DNA of zokor muscle Tissue with the serial number of TCX-7, total genomic DNA of zokor liver Tissue with the serial number of TBX-4 and total genomic DNA of zokor liver Tissue with the serial number of FFX-5 by using a Qiagen DNeasy Blood & Tissue Kit;
b) taking zokor genome total DNA (deoxyribonucleic acid) numbered TCX-7 and FFX-5 in the step a) as a template, and respectively carrying out PCR (polymerase chain reaction) by utilizing the 12S rRNA primer pair and the 16S rRNA primer pair, wherein the TCX-7 reaction system is 25 mu L, and the annealing temperature is 56 ℃; FFX-5 reaction system 50 μ L, annealing temperature 52 ℃; taking the total genome DNA with the number of TBX-4 in the step a) as a template, and carrying out PCR reaction by using the 12S rRNA primer pair, wherein the reaction system is 50 mu L, and the annealing temperature is 54 ℃;
c) detecting the PCR product obtained in the step b) by 1% agarose gel electrophoresis, and observing a bright band of about 490bp and a bright band of about 1450 bp;
d) performing bidirectional Sanger sequencing on the PCR product obtained in the step c) to obtain 12S rRNA and 16S rRNA gene sequencing peak maps;
e) and finding a conserved motif sequence of SEQ ID NO. 5-6 in the obtained sequencing peak picture, and analyzing the base of the SNP locus.
The results are as follows:
(1) TCX-7 zokor:
5 is G at the 55 th base (FIG. 1);
the 35 th base in the sequence shown in SEQ ID NO. 6 is C (FIG. 2).
Namely, the sample with the number TCX-7 is judged to be the Qinling mountain zokor.
(2) FFX-5 zokor:
the 55 th base in the sequence of SEQ ID NO. 5 is A (FIG. 3);
the 35 th base in the sequence shown in SEQ ID NO. 6 is T (FIG. 4).
Namely, the sample with the judgment number FFX-5 is not Qinling mountain zokor.
(3) TBX-4 zokor:
the 55 th base in the sequence of SEQ ID NO. 5 is G.
Namely, the sample with the number TBX-4 is judged to be the Qinling mountain zokor.
In addition, by the traditional morphological identification mode, zokors numbered TCX-7, TBX-4 and FFX-5 are identified, individuals of TCX-7 and TBX-4 have a mitral valve cushion shape, a dense hair tail, a raised occipital part of skull and skull, an expanded zygomatic arch, frontal and apical ridges which are obviously close to each other, the distance between the apical ridges is larger than that of the frontal ridges, and a incisal orifice is surrounded by the anterior jawbone and the maxilla, and the characteristics are consistent with those of the zokor in the Qinling mountain, so that the zokor is identified.
FFX-5 individuals have oval nasal cushion, bare tail, raised occipital part of skull and skull, expanded zygomatic arch, parallel crest, close to the frontal part by folding, combined with developed supraorbital crest, developed occipital crest, incisal foramen surrounded by anterior jawbone and maxilla, and third upper molars (M)3) The rat does not have a rear-stretching leaf, the characteristics all accord with the morphological identification characteristics of the Gansu zokor, and the FFX-5 zokor is proved to be the Gansu zokor and not the Qinling mountain zokor.
The experimental result shows that the method for identifying the Qinling zokor is accurate and can be practically used for identifying and detecting species of the Qinling zokor.
In conclusion, the invention provides the kit for simply, conveniently and accurately identifying the species of the zokor in the Qinling and the method for identifying the zokor in the Qinling, solves the problem of identifying the species of the zokor through the morphology, and has excellent application prospect in the species identification of the zokor.
SEQUENCE LISTING
<110> institute of biological research on northwest plateau of Chinese academy of sciences
<120> kit and method for identifying Qinling mountain zokor
<130> GY417-2021P0113584CC
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial Synthesis
<400> 1
agcactgaaa atgcttagat gg 22
<210> 2
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 2
cggctaagca tagtggggta 20
<210> 3
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 3
agaggagata agtcgtaaca aggt 24
<210> 4
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 4
tcctgatcca acatcgaggt 20
<210> 5
<211> 57
<212> DNA
<213> zokor
<400> 5
gggttggtaa atttcgtgcc agccaccgcg gtcatacgat tgacccaaac taatgat 57
<210> 6
<211> 40
<212> DNA
<213> zokor
<400> 6
cccgaaacca aacgagctac ctaagaacaa ttttctgaat 40
Claims (10)
1. The kit for identifying the Qinling mountain zokor is characterized by comprising reagents for detecting the following SNP loci in the 12S rRNA gene of a species to be detected: position 55 of the conserved motif sequence shown in SEQ ID NO. 5,
and/or, reagents for the following SNP sites in the 16S rRNA gene: position 35 of the conserved motif sequence shown in SEQ ID NO 6.
2. The kit according to claim 1, wherein the reagent is a reagent for simultaneously detecting the SNP site in the 12S rRNA gene and the SNP site in the 16S rRNA gene;
or, the bases of the SNP sites are as follows:
the 55 th base of the conserved motif sequence shown in SEQ ID NO. 5 is G; the 35 th base of the conserved motif sequence shown in SEQ ID NO. 6 is C.
3. The kit of claim 1 or 2, wherein the reagents are: a sequencing reagent, a reagent for the KASP method, or a reagent for the restriction fragment length polymorphism method.
4. The kit according to claim 1 or 2, further comprising a reagent for amplifying a 12S rRNA gene-conserved motif sequence, and/or a reagent for amplifying a 16S rRNA gene-conserved motif sequence; the 12S rRNA gene conserved motif sequence is a sequence shown by SEQ ID NO. 5, and the 16S rRNA gene conserved motif sequence is a sequence shown by SEQ ID NO. 6.
5. The kit according to claim 4, wherein the reagent for amplifying the 12S rRNA gene conserved motif sequence comprises a primer pair shown in SEQ ID NO. 1-2, and/or the reagent for amplifying the 16S rRNA gene conserved motif sequence comprises a primer pair shown in SEQ ID NO. 3-4.
6. The application of a reagent for amplifying a conserved motif sequence in a kit for identifying Qinling mountain zokor is disclosed, wherein the conserved motif sequence is any one or two sequences shown in SEQ ID NO. 5-6.
7. Use according to claim 6, characterized in that: the reagent comprises a primer pair shown in SEQ ID NO. 1-2 and/or a primer pair shown in SEQ ID NO. 3-4.
8. A method for identifying a Qin mountain zokor is characterized by comprising the following steps:
(1) extracting total genomic DNA of a zokor sample to be detected;
(2) the reagent for detecting the following SNP sites in the 12S rRNA gene: position 55 of the conserved motif sequence shown in SEQ ID NO. 5; and/or, reagents for the following SNP sites in the 16S rRNA gene: analyzing the 35 th site of the conserved motif sequence shown in SEQ ID NO. 6;
preferably, the sample in step (1) is a tissue sample or a blood sample.
9. The method of claim 8, wherein the step of detecting of step (2) is as follows:
1) taking the DNA extracted in the step (1) as a template, and carrying out PCR amplification by using an amplification reagent to obtain an amplification product;
2) carrying out agarose gel electrophoresis detection on the PCR amplification product obtained in the step 1);
3) sequencing the PCR amplification product with a bright band of 490bp in the detection result of the step 2) to obtain a 12S rRNA gene sequence; and/or sequencing the PCR amplification product with the 1450bp bright band to obtain a 16S rRNA gene sequence;
4) analyzing the following SNP loci in the 12S rRNA gene obtained in the step 3): position 55 of the conserved motif sequence shown in SEQ ID NO. 5; and/or analyzing the following SNP sites in the 16S rRNA gene obtained in the step 3): position 35 of the conserved motif sequence shown in SEQ ID NO. 6;
preferably, the amplification reagent in the step 1) comprises a primer pair shown in SEQ ID NO 1-2 and/or a primer pair shown in SEQ ID NO 3-4; the annealing temperature of PCR amplification is 52-56 ℃; step 3) the sequencing is bidirectional Sanger sequencing.
10. The method according to claim 8 or 9, wherein the detection in step (2) is simultaneous detection of the SNP site in the 12S rRNA gene and the SNP site in the 16S rRNA gene;
or, the bases of the SNP loci are as follows, and then the zokor to be detected is the Qinling zokor:
the 55 th base of the conserved motif sequence shown in SEQ ID NO. 5 is G; the 35 th base of the conserved motif sequence shown in SEQ ID NO. 6 is C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110944093.3A CN113444812B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor in Qinling mountain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110944093.3A CN113444812B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor in Qinling mountain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113444812A true CN113444812A (en) | 2021-09-28 |
| CN113444812B CN113444812B (en) | 2024-01-30 |
Family
ID=77818608
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110944093.3A Active CN113444812B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor in Qinling mountain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113444812B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441537A (en) * | 2015-11-05 | 2016-03-30 | 陕西省动物研究所 | Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof |
| CN111154890A (en) * | 2020-01-16 | 2020-05-15 | 甘肃农业大学 | CYP3A2 gene as molecular marker for drug resistance detection of homozokor, primer, preparation method and application thereof |
-
2021
- 2021-08-17 CN CN202110944093.3A patent/CN113444812B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441537A (en) * | 2015-11-05 | 2016-03-30 | 陕西省动物研究所 | Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof |
| CN111154890A (en) * | 2020-01-16 | 2020-05-15 | 甘肃农业大学 | CYP3A2 gene as molecular marker for drug resistance detection of homozokor, primer, preparation method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| CAIQUAN ZHOU等: "Molecular authentication of the animal crude drug Sailonggu (bone of Myospalax baileyi)", BIOL PHARM BULL, vol. 27, no. 11, pages 3 * |
| CAIQUAN ZHOU等: "The validity of different zokor species and the genus Eospalax inferred from mitochondrial gene sequences", INTEGRATIVE ZOOLOGY, vol. 3, no. 4, pages 290, XP055979067, DOI: 10.1111/j.1749-4877.2008.00108.x * |
| 何锴等: "DNA条形码技术在小型兽类鉴定中的探索:以甘肃莲花山为例", 生物多样性, vol. 21, no. 2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113444812B (en) | 2024-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101331740B1 (en) | SSR primer derived from Paeonia lactiflora and use thereof | |
| KR101912192B1 (en) | Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof | |
| CN109371146B (en) | SNP molecular marker, primer pair, detection kit and application of SNP molecular marker and primer pair for sheep multi-thoracic vertebra number character | |
| KR101912196B1 (en) | Molecular marker and primer set for discriminating Paeonia suffruticosa and Paeonia lactiflora and uses thereof | |
| CN113430281B (en) | Kit and method for identifying species of zokor with raised cranium | |
| KR101873303B1 (en) | Age Predicting method using DNA Methylation level in saliva | |
| KR102010279B1 (en) | Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof | |
| KR101778877B1 (en) | Markers for discrimination of Whangkeumbae and Minibae | |
| NL2032311B1 (en) | Kit and method for identifying eospalax rothschildi | |
| NL2032209B1 (en) | Kit and method for identifying eospalax smithi | |
| CN113444812A (en) | Kit and method for identifying Qinling mountain zokor | |
| CN107177698B (en) | Primer, kit and method for paternity test of deer animals | |
| CN113462790B (en) | Kit and method for identifying highland zokor | |
| CN113684301B (en) | SNP (Single nucleotide polymorphism) marker and primer for identifying apricot pericarp Mao Xingzhuang and application of SNP marker and primer | |
| CN105483281B (en) | It is a kind of to be used to identify glutinous No. 1 SNP marker of five firework of waxy corn Shanghai and its identification method | |
| CN113637769B (en) | Kit and method for identifying northeast zokor | |
| CN113444814B (en) | Kit and method for identifying Chinese zokor | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| KR101357497B1 (en) | EST-SSR primer derived from Ophiopogon japonicus and use thereof | |
| KR101954675B1 (en) | Molecular marker for discriminating Angelica gigas cultivars and uses thereof | |
| CN113637770B (en) | Kit and method for identifying grassland zokor | |
| CN113444813B (en) | Kit and method for identifying Gansu zokor | |
| CN116516026B (en) | Molecular marker related to antibody titer of broiler chickens, detection method and application | |
| CN108315438B (en) | SSR primer for diversity analysis of propylaea japonica and application thereof | |
| KR102212518B1 (en) | SSR marker for discriminating cultivars or resources of Atractylodes japonica and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |