CN113444724A - Promoter, recombinant vector and application - Google Patents
Promoter, recombinant vector and application Download PDFInfo
- Publication number
- CN113444724A CN113444724A CN202110505406.5A CN202110505406A CN113444724A CN 113444724 A CN113444724 A CN 113444724A CN 202110505406 A CN202110505406 A CN 202110505406A CN 113444724 A CN113444724 A CN 113444724A
- Authority
- CN
- China
- Prior art keywords
- streptomyces
- seq
- cel
- sequence
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/76—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Actinomyces; for Streptomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/165—Heterorings having nitrogen atoms as the only ring heteroatoms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a promoter, a recombinant vector and application. The gene with promoter function is characterized in that the sequence is shown as SEQ ID NO. 3 or SEQ ID NO. 8. The promoter has the function of a promoter, and simultaneously, the streptomyces can be improved to generate natural blue pigment by introducing a recombinant vector constructed by a DNA sequence shown by the promoter into the streptomyces and adding cellobiose.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a promoter, a recombinant vector and application.
Background
Gene expression regulation is a major link in the functioning of genes, and promoters are important regulatory elements for controlling the level of gene expression. The streptomycete has the capability of producing abundant secondary metabolites and can produce secondary metabolites with various chemical structures and various physiological activities. At present, a large number of streptomyces genetic manipulation tools are developed, and some inducible expression regulation systems are available. However, these inducible expression systems have limitations such as high levels of leaky expression, inducer instability, susceptibility to degradation or toxicity, etc. (Rodri i guez-Garca i a et al, 2005; Wang et al, 2013; Li et al, 2015). Therefore, an inducible expression system capable of precisely regulating gene expression in streptomyces is lacking at present.
Disclosure of Invention
The invention aims to provide a promoter, and an inducible expression system capable of accurately regulating and controlling gene expression in streptomycete.
In order to achieve the purpose, the invention provides a gene with a promoter function, which is characterized in that the sequence is shown as SEQ ID NO. 3 or SEQ ID NO. 8.
The invention also protects the gene or the application containing the gene and having the promoter function.
Furthermore, the sequence containing the gene is shown as SEQ ID NO. 7 or SEQ ID NO. 9.
The invention also provides a recombinant vector, which is characterized by containing the gene.
Furthermore, the recombinant vector contains the gene as a sequence shown by SEQ ID NO. 3 or SEQ ID NO. 8, or a sequence shown by SEQ ID NO. 7 or SEQ ID NO. 9.
The invention also provides a recombinant cell, which is characterized by containing the recombinant vector.
The invention also provides a method for improving the natural blue pigment production of streptomyces, which is characterized in that the recombinant vector of claim 4 or 5 is transferred into streptomyces, and cellobiose is added.
Further, the streptomyces is streptomyces albidoflavus, streptomyces lividans or streptomyces coelicolor.
Further, the streptomyces is streptomyces albidoflavus J1074, streptomyces lividans TK24, streptomyces coelicolor M1146 or streptomyces coelicolor M145.
The invention relates to a CebR protein, a cebO sequence and PkasO*And combining, and screening by taking a kanamycin resistance gene (neo) as a reporter gene to construct an inducible expression regulation system which has no leakage and accurately controls the expression of a target gene.
The invention provides a cellobiose inducible expression system in streptomyces, which mainly comprises a promoter PkasO*、CebRRepressor protein and cebO binding sequence. The system combines a regulation system Cel-RS1 or Cel-RS2 by splicing three biological elements to form a promoter DNA fragment with cellobiose induction function. Analysis of neo resistance gene expression levels in streptomyces coelicolor M1146, streptomyces albidoflavus J1074 and streptomyces lividans TK24 shows that the DNA fragment has strong cellobiose induced expression activity and does not express in the absence of an inducer; adding cellobiose with proper concentration to express efficiently. And the expression level trends of neo resistance genes in the three strains are consistent, Cel-RS2 is slightly superior to Cel-RS1, and Cel-RS2 is selected as an optimal induced expression system for application in subsequent experiments. Thus, Cel-RS2 was integrated into a recombinant vector and the desired genes (indC, actII-ORF4 and dCas9) were ligated, and the recombinant plasmid was further transferred into Streptomyces to obtain the corresponding recombinant strain. The DNA fragment is integrated on a recombinant vector and connected with target genes (indC, actII-ORF4 and dCas9) to be transferred into streptomyces to obtain recombinant bacteria, the growth of the streptomyces is not influenced, and a large amount of target metabolites (natural blue pigment and actinorubin) can be generated and the expression of a CRISPR system can be induced after cellobiose is added.
Drawings
FIG. 1 is a schematic diagram of the construction of recombinant plasmid pSET152-Cel-RS 1-neo.
FIG. 2 is a schematic diagram of the construction of recombinant plasmid pSET152-Cel-RS 2-neo.
FIG. 3 is a schematic diagram of the construction of the recombinant plasmid pSET152-Cel-RS 2-indC.
FIG. 4 is a sequence diagram of cellobiose-inducible promoter and a diagram showing the alignment results of homologous sequences of each Streptomyces CebR protein.
FIG. 5 is a graph showing the results of evaluation of the cellobiose-inducing module in Streptomyces albus J1074.
FIG. 6 is a graph showing the results of evaluation of the cellobiose-inducing module synthesized by Streptomyces coelicolor M1146 and Streptomyces lividans TK 24.
FIG. 7 is a graph showing the results of measurement of the induction intensity of Cel-RS2 for inducing the synthesis of natural blue pigment.
FIG. 8 is a graph showing the results of cellobiose-induced CRISPII-mediated gene expression regulation.
Detailed Description
Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.
PCR reaction system (50. mu.L) of the following example: ddH2O: 17 mu L of the solution; 2X Phanta Max Buffer (containing 2mM Mg)2+): 25 mu L of the solution; dNTP Mix (10mM each): 1 mu L of the solution; upstream primer (10 μ M): 2 mu L of the solution; downstream primer (10 μ M): 2 mu L of the solution; phanta Max Super-Fidelity DNA Polymerase: 1 mu L of the solution; template DNA: 2 μ L (20-400 ng).
PCR reaction procedure: pre-denaturation at 95 ℃ for 3 min; (denaturation at 95 ℃ for 15 s; annealing at 56 ℃ for 15 s; extension at 72 ℃ (1min for 1 kb); 30 cycles); extension was complete for 5min at 72 ℃.
Enzyme digestion system: 10X buffer: 2 mu L of the solution; DNA fragment or vector: 1-17 μ L (less than 1 μ g); restriction enzymes: 1 mu L of the solution; ddH 2O: make up 20 μ L; the reaction was carried out at 37 ℃ for 1 hour.
A connection system: 10X T4 DNA ligase buffer: 2 mu L of the solution; 50% PEG4000 solution: 2 mu L of the solution; linear vector DNA: 20-100 ng; insert DNA: 1-5 times of vector DNA amount; ddH 2O: make up 20 μ L; t4 DNA ligase: 0.2 mu L; ligation was carried out overnight at 16 ℃.
Homologous recombination system: a linearized vector: 0.03 pM; each insert: 0.03 pM; 5 × CE MultiS Buffer: 4 mu L of the solution; exnase MultiS: 2 mu L of the solution; ddH 2O: make up 20 μ L; ligation was carried out at 37 ℃ for 30 minutes.
R5MS medium: 10.12g of mannitol; 5g of yeast extract; 0.1g of casein hydrolysate; 0.25g of K2SO4(ii) a 10.12g of MgCl2.6H2O; 21g of MOPS; 2g ofSodium hydroxide; 100g of sucrose; 1L of H2O; after sterilization, 2mL of Trace element solution was added. Solid media was prepared with the addition of 1.5% agar.
Trace element solution: 40mg of ZnCl2(ii) a 200mg of FeCl3·6H2O; 10mg of CuCl2·2H2O; 10mg of MnCl2·4H2O; 10mg of Na2B4O7·10H2O; 10mg of (NH)4)6Mo7O24·4H2O。
R5A medium: 10.12g of mannitol; 5g yeast extract; 0.1g casein hydrolysate; 0.25g of K2SO4(ii) a 10.12g of MgCl2.6H2O; 5.73g TES Buffer; 1L of H2O; after sterilization, 2mL of 2mL Trace element solution (same as R5 MS) was added; pH 7.2. The liquid culture medium does not need to be added with agar additionally, and the solid culture medium is added with 1.5 percent of agar.
Minimal Medium (MM) (Kieser et al, 2000): 0.2g of MgSO4·7H2O; 0.5g of L-asparagine; 0.5g of K2HPO4(ii) a 0.01g of FeSO4·7H2O; 1L of H2O; 10g of agar. Sterile 50mL of 10% mannitol was added before use.
Example 1 construction of cellobiose-inducible promoter recombinant vectors pSET152-Cel-RS1-neo and pSET152-Cel-RS2-neo
The construction scheme is shown in FIGS. 1 and 2.
The t0 sequence (Genebank Accession Number: CP055251.1Range: 1418196to 1418384), PhrdBSequences (Genebank access Number: AL939125.1Range:78237to 78664) and cebR sequences (Genebank access Number: FN554889.1Range: 6431608to 6432666); taking the mixture of the three artificially synthesized sequences with the same molecular number as a template, and taking a primer pair T0-R (T-152)/PhrdBF (T-tfd) (shown in SEQ ID NO:1 and SEQ ID NO: 2) was PCR ligated to obtain T0, PhrdBConnecting with the cebR fragment, and recovering to obtain the target fragment t0-PhrdB-cebR；
SEQ ID NO:1：TTGGGCTGCAGGTCGACTCTAGACTCAGCAGGTGGAAGAGGGAC。
SEQ ID NO:2：GACGACAAAACTTTAGATCTCCGCCTTCCGCCGGAACG。
Artificially synthesized tfd sequence (Genebank Accession Number: AJ414669.1Range 1:4389to 4763), PkasO*The sequence of OS1 (shown as SEQ ID NO: 3) and the sequence of neo (shown as SEQ ID NO: 4); taking the mixture of the three artificially synthesized sequences with the same molecular number as a template, and taking a primer pair tfd-R (T-P)hrdB) the/neo-R (T-152) (shown in SEQ ID NO:5 and SEQ ID NO: 6) was PCR ligated to introduce tfd, PkasO*OS1 and neo fragment are respectively connected, and the target fragment tfd-P is recoveredkasO*OS1-neo；
The neo sequence is shown as SEQ ID NO: 4:
ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCACATACCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA。
SEQ ID NO:5：AGATCTAAAGTTTTGTCGTCTTTCCAGACG。
SEQ ID NO:6：CAGCTATGACATGATTACGAATTCTCAGAAGAACTCGTCAAGAAGGC。
the integrated vector of Streptomyces pSET152 (available from Biovector plasmid vector strain cell gene Collection) was digested simultaneously with XbaI/EcoRI, and then digested with t0-P obtained as described abovehrdB-cebR fragment and tfd-PkasO*Carrying out homologous recombination on the OS1-neo fragment to obtain a recombinant plasmid
pSET152-Cel-RS1-neo, wherein Cel-RS1 is shown as SEQ ID NO: 7.
SEQ ID NO 7 is shown below: wherein the single underline "" is the t0 sequence, dotted underline
Is BamHI enzyme cutting site, and is doubly and directly underlined
As the sequence of cebR, simple dotted line
Is PhrdBSequence, single wave underline
Bgl II site, double wave underline
For the tfd sequence, bold dashed underline
Is the Afl II sequence, underlined is PkasO*The OS1 sequence is SEQ ID NO 3.
Will PkasOThe sequence of OS1 (shown as SEQ ID NO: 3) was changed to PkasOThe sequence of OS2 (shown as SEQ ID NO: 8) and the rest are the same as the above steps to obtain the recombinant plasmid pSET152-Cel-RS2-neo, wherein Cel-RS2 is shown as SEQ ID NO: 9.
SEQ ID NO 9 is shown below: wherein the single underline "" is the t0 sequence, dotted underline
Is BamHI enzyme cutting site, and is doubly and directly underlined
As the sequence of cebR, simple dotted line
Is PhrdBSequence, single wave underline
Bgl II site, double wave underline
For the tfd sequence, bold dashed underline
Is the Afl II sequence, underlined is PkasOThe sequence of OS2 is SEQ ID NO 8.
Example 2 construction of recombinant plasmid pSET152-Cel-RS2-indC
The construction flow is shown in FIG. 3.
Carrying out double enzyme digestion on the recombinant plasmid pSET152-Cel-RS2-neo prepared by the method by NdeI and EcoRI;
artificially synthesizing an indC (Genebank Accession Number: CP004370.1, Range:6357231to 6359275) sequence, and performing double enzyme digestion by NdeI and EcoRI;
and carrying out T4 connection on the vector pSET152-Cel-RS2-neo subjected to double digestion and the indC sequence to obtain the recombinant plasmid pSET152-Cel-RS 2-indC.
Example 3: Cel-RS1 and Cel-RS2 promoter cellobiose induction activity assay
The heterologous expression host for natural cyanine synthesis is Streptomyces albus J1074 (such as from CGMCC 4.7233), the heterologous expression host for actinorhodin synthesis is Streptomyces coelicolor M1146, and the heterologous expression host for the CRISPR system application is Streptomyces coelicolor M145 (such as from ATCC BAA-471).
Bioinformatics analysis shows that homologous genes of the CebR protein exist in common streptomycete expression hosts such as Streptomyces albus J1074, Streptomyces coelicolor M1146, Streptomyces lividans TK24 and the like. Multiple alignments of the amino acid sequences of the CebR proteins using DNAMAN 9.0 revealed that streptomyces scabies ATCC 49173 had 79% similarity to the CebR protein in streptomyces albus J1074, 87% similarity to streptomyces coelicolor M1146, and 87% similarity to streptomyces lividans TK24 (fig. 4B). Based on this, the present invention first selects the insertion of the cebO sequence (shown as SEQ ID NO: 10) into PkasO*In (A in FIG. 4), a cellobiose-inducible promoter expression system was constructed using the kanamycin resistance gene (neo) as a reporter gene.
SEQ ID NO:10：TGGGAGCGCTCCCA。
1) Analysis of Induction Activity in Streptomyces albus J1074
The recombinant plasmids pSET152-Cel-RS1-neo and pSET152-Cel-RS2-neo obtained in example 1 were respectively introduced into Streptomyces albus J1074 by means of conjugative transfer to obtain recombinant strains J1074:pSET152-Cel-RS 1-neo and J1074:pSET152-Cel-RS 2-neo. Furthermore, P is constitutivekasO*As a control, a recombinant plasmid pSET152-P was constructedkasO*-neo。
Artificially synthesized tfd sequence (supra), PkasO*(as shown in SEQ ID NO: 11); the mixture of the two artificially synthesized sequences with the same number of molecules is used as a template, and a primer pair tfd-F (XbaI)/P is usedkasO*-R (P) (shown as SEQ ID NO:12 and SEQ ID NO: 13) is connected by PCR (P)kasO*-R (P) primer needs to be phosphorylated, thereby tfd and PkasO*The fragments are ligated together and the desired fragment tfd-P is recoveredkasO*(ii) a The neo sequence (supra) was artificially synthesized, and the vector for integration of pSET152 into Streptomyces was digested with XbaI/EcoRI, followed by reaction with tfd-P obtained as described abovekasO*The fragment and the neo fragment are subjected to T4 ligation to obtain a recombinant plasmid pSET152-PkasO*-neo。
SEQ ID NO:11：
TGTTCACATTCGAACGGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT。
SEQ ID NO:12：TCTAGACCCGGGAACCCGGC。
SEQ ID NO:13：AACTCCCCCAGTCCTGCACG。
The kanamycin resistance gene neo is taken as a reporter gene, the strength of the promoters can be directly reflected by detecting the resistance level of the recombinant strain to kanamycin, the efficiency of the two promoters is evaluated by observing the growth condition of the recombinant strain, and the construction result of the recombinant strain is shown in A in figure 5. In this experiment, spores of the recombinant strains were collected separately and subjected to gradient dilution (10)-3、10-4、10-5And 10-6Double), inoculated onto solid basal medium (MM) containing different concentrations of kanamycin (2.5, 5.0, 10, 25 and 50. mu.g/mL), and the results are shown in FIG. 5. As can be seen from B and C of FIG. 5, in the absence of cellobiose, at all kanamycin concentrations, growth of Streptomyces was not observed for both J1074:: pSET152-Cel-RS1-neo and J1074:: pSET152-Cel-RS2-neo, and for the control (see B of FIG. 5); when 0.3mM cellobiose is added, Cel-RS1 and Cel-RS2 are obviously induced, and recombinant strains can normally grow under the concentration gradient of the 5 kanamycin screening methods. In contrast, Cel-RS2 was slightly more active than Cel-RS1 under the induction of cellobiose (see C in FIG. 5).
2) Analysis of Induction Activity in Streptomyces coelicolor M1146 and Streptomyces lividans TK24
To determine the characterization of the optimized inducible expression system in other Streptomyces species, the plasmids pSET152-Cel-RS1-neo and pSET152-Cel-RS2-neo obtained in example 1 were transferred into Streptomyces modelicus M1146 and Streptomyces lividans TK24, respectively, by the conjugative transfer method, and the expression activity of the promoters was analyzed, and the results are shown in FIG. 6. Wherein A1 is not added with cellobiose, and Streptomyces is M1146; a2 is added cellobiose, and Streptomyces is M1146; b1 is not added with cellobiose, and the streptomyces is TK 24; b2 is added cellobiose, and the streptomyces is TK 24; from A1, A2 and B1, B2 of FIG. 6, it can be seen that when cellobiose was not added, Cel-RS1 and Cel-RS2 promoters were not expressed in both Streptomyces species and could not drive expression of kanamycin resistance gene, resulting in the inability of recombinant strains to grow on kanamycin-added medium, and the control had Streptomyces growth (see A1, B1 of FIG. 6); when 0.3mM cellobiose was added to the medium, both inducible promoters were specifically induced to express, initiating expression of the kanamycin resistance gene. It is noted that the Cel-RS2 promoter has better expression tendency in both hosts than Cel-RS1 under the induction of cellobiose, which is basically the same as that in Streptomyces albus J1074 (A2 and B2 in FIG. 6).
Example 4 application of Cel-RS2 in Natural blue pigment Synthesis
The biosynthesis of natural cyanine (indigoid) is responsible for the 1 gene cluster present in the genome of S.albidus J1074, which contains a gene indC coding for the non-ribosomal peptide synthetase (NRPS) of the oxidation domain. Under normal laboratory culture conditions, S.parvulus J1074 is unable to produce individine. This example is intended to use the inducible promoter Cel-RS2 to initiate expression of indC, thereby activating the indigo biosynthetic gene cluster to produce cyanine.
First, the recombinant plasmid pSET152-Cel-RS2-indC constructed in example 2 was conjugately transferred to Streptomyces albus J1074 to obtain a recombinant strain of pSET152-Cel-RS2-indC (A in FIG. 7), and production of inditoidine was observed in R5A solid medium. After culturing on R5A solid medium for 5 days, the production of indigoid was observed.
The experiment is carried out with PkasO*As a positive control, a recombinant plasmid pSET152-P was constructedkasO*-an indC. With pSET152-P obtained in example 3kasO*-neo as template, double digestion with NdeI/EcoRI; artificially synthesizing indC gene, carrying out double enzyme digestion by NdeI/EcoRI, and further carrying out enzyme digestion on pSET152-PkasO*-neo (NdeI/EcoRI) and indC (NdeI/EcoRI) were subjected to homologous recombination to obtain recombinant plasmid pSET152-PkasO*-an indC. pSET152-PkasO*Transfer of-indC to J1074 to obtain J1074 pSET152-PkasO*-strain indC.
Using J1074 as the material, pSET152-PkasO*InDC strain as positive control, J1074:, pSET152 (obtained by transferring the Streptomyces pSET152 integrative vector to J1074) as negative control, cellobiose induction concentration 0.3 mM. The experimental results showed that, in the case of the recombinant strain J1074:: pSET152-Cel-RS2-indC, there was no production of natural blue pigment without cellobiose induction (see B1 in FIG. 7); after the addition of cellobiose at a concentration of 0.3mM, the recombinant strain was induced to produce a large amount of natural blue pigment (see B2 of FIG. 7). B1 of fig. 7 is no cellobiose added; b2 is the addition of cellobiose.
The induction effect of Cel-RS2 was further evaluated by detecting the amount of individine produced in the recombinant strain broth by the absorbance OD600And carrying out quantitative analysis on the yield of the fermentation liquor. Adding cellobiose with concentration gradient of 0, 0.005, 0.01, 0.02, 0.04, 0.08, 0.16, 0.32, 0.64, 1.28mM into R5A liquid culture medium, performing fermentation culture, and detecting OD of solution at 48h and 72h after induction600Absorbance value at nm. The results show that when fermentation is carried out for 48h after different concentrations of inducer are added, the color of the fermentation liquor is not obvious, which indicates that the accumulation of the individine is still at a lower level (C1 in FIG. 7); however, after 72h of induction, the bluish purple color in the fermentation broth gradually deepens with the increase of the cellobiose concentration, and the OD of the fermentation broth at the cellobiose concentration of 0.32mM600At 0.63, the increase in individine production was not significant when the induction concentrations reached 0.64mM and 1.28mM, indicating that the production was already near the peak at 0.32mM (C2 in FIG. 7).
Example 5 application of Cel-RS2 in CRISPR System expression
Plasmid pCRISPR-dCas9-orf1P-A5NT (Tong Y, Charusanti P, Zhang L, Weber T, Lee SY. CRISPR-Cas9 Based Engineering of Actinomycetal genome. ACS Synth biol.2015Sep 18; 4(9):1020-9.) was double digested with XbaI and NdeI; the recombinant plasmid pSET152-Cel-RS2-neo obtained in example 1 was also digested with XbaI and NdeI to obtain a fragment Cel-RS2 (XbaI/NdeI); the digested fragments were ligated with T4 to obtain recombinant plasmid pSET152-idCas 9-acta (FIG. 8B).
In this example, dCas9 protein was initiated mainly by Cel-RS2, and plasmid construction was as shown (A in FIG. 8). Under sgRNA guidance of the target gene, expression of ACT gene cluster is suppressed, and biosynthesis of actinorhodin is suppressed (fig. 8 a).
The recombinant plasmid pSET152-idCas9-actI is introduced into Streptomyces coelicolor M145 through conjugative transfer to obtain a recombinant strain M145: pSET152-idCas 9-actI. The 4 recombinant strains M145: pSET152-idCas9-actI, which were verified to be correct, were selected on R5MS solid medium for characterization.
Will constitute the promoter PermE*The initiated dCas9 protein (pCRISPR-dCas9-orf1p-A5NT) was introduced into S.coelicolor M145 as a control to give M145:: pCRISPR-dCas9-orf1p-A5 NT.
As can be seen from C1 and C2 in FIG. 8 (where C1 is the case without adding Cellobiont and C2 is the case with adding Cellobiont), in Streptomyces coelicolor M145 containing pSET152-idCas9-actI plasmid, a blue substance identical to wild-type M145 was produced when cellobiose was not added, indicating that Cel-RS2 did not induce CRISPR system expression at this time, expression of ACT gene cluster was not inhibited, and actinorhodin can be normally synthesized (see C1 in FIG. 8); after the addition of 0.3mM cellobiose, no blue material was produced, consistent with the phenotype of M145:: pCRISPR-dCas9-orf1p-A5NT recombinant strain, indicating that Cel-RS2 successfully activated the expression of CRISPR system at this time, and the ACT gene cluster was suppressed, resulting in the failure of normal synthesis of actinorhodin (see C2 in FIG. 8). Thus, priming of dCas9 protein with Cel-RS2 successfully interfered with the production of actinorhodin in S.coelicolor M145.
Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made in the above embodiments by those of ordinary skill in the art without departing from the principle and spirit of the present invention.
SEQUENCE LISTING
<110> university of southwest
<120> promoter, recombinant vector and use
<130> XNDX-21001-CNI
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 44
<212> DNA
<213> Artificial Synthesis
<400> 1
ttgggctgca ggtcgactct agactcagca ggtggaagag ggac 44
<210> 2
<211> 38
<212> DNA
<213> Artificial Synthesis
<400> 2
gacgacaaaa ctttagatct ccgccttccg ccggaacg 38
<210> 3
<211> 111
<212> DNA
<213> Artificial Synthesis
<400> 3
tgttcacatt cgaacggtct ctgctttgac aacatgctgt gcggtgttgt aaagtcgtgg 60
ccatgggagc gctcccagga gaatacgaca gcgtgcagga ctgggggagt t 111
<210> 4
<211> 795
<212> DNA
<213> Artificial Synthesis
<400> 4
atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc 60
ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120
gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg 180
caagacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg 240
ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag 300
gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg 360
cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc 420
atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480
gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgca catacccgac 540
ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat 600
ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac 660
atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc 720
ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780
gacgagttct tctga 795
<210> 5
<211> 30
<212> DNA
<213> Artificial Synthesis
<400> 5
agatctaaag ttttgtcgtc tttccagacg 30
<210> 6
<211> 47
<212> DNA
<213> Artificial Synthesis
<400> 6
cagctatgac atgattacga attctcagaa gaactcgtca agaaggc 47
<210> 7
<211> 2181
<212> DNA
<213> Artificial Synthesis
<400> 7
tcagcaggtg gaagagggac tggattccaa agttctcaat gctgcttgct gttcttgaat 60
ggggggtcgt tgacgacgac atggctcgat tggcgcgaca agttgctgcg attctcacca 120
ataaaaaacg cccggcggca accgagcgtt ctgaacaaat ccagatggag ttctgaggtc 180
attactggac ggatcctcag gaagaatccc gccccaccag ctccgtcggc agcaccacct 240
ggcgtcgttc caagcccctc gacaccgccg ggcggcggtc cgcgatctcg tccaggagga 300
ggtcgatcat cgcgcggccc atctcctcta tcggctggcg gacgctggtg agcggcgggt 360
ccatgtggcg ggcgatcgcc gagtcgtcgt agccgaccag cgccacgtcg tcgggtatgc 420
ggcggccctc ctcgcggagc acctggcggg cgccggcggc catgacgtcc gactcggcga 480
agaccgcgtc gaggtcgggg cagcgggcca ggagttcgcg catcgctcgg cggccgccct 540
cctccgtgaa gtcaccgggg gcgatcaggc gctcgtccac ctcgcggccc gcgtcctcca 600
gggcgtcgcg gtagccctcg atgcgccgct gggcgccgta gacgtccagc cggccggtga 660
tcgtggcgat ccgggcgcgc ccccgtgcga tgaggtgctc gaccgccgag cggccgccgc 720
cgtagttgtc ggagtcgacc gaggggagcg tctcgtgctc ggagcggggg ccgctgatga 780
cggccgggat ttccagttgc gacagcagat cggggagcgg gtcgtccgcg tggacggaga 840
ccaggaggac accgtcgacg cggtgcgcgg ccaggtactg ggcgaggcgc cggcgctccc 900
ggtcgttgcc cgcgaagatc agcaggagct gcatctcggt gtcggacagt tgcgctccga 960
cacccttgag gatgtcggag aagtacggct ccgagaagaa gcgggtctcc ggttcgggca 1020
cgaccatcgc gatcgcgtcg gtacggttcg ccgcgagcgc gcgggccgcc gtgttcggga 1080
cgtaacccag ctccgcgacg gccgcctcga ccgccgcgcg ggtcgcgtcg ctcacccggg 1140
gcgagccgtt gatcacccgg gacaccgtcc cccggcccac tccggcccgt gcggcgacct 1200
cctccaacgt cggccgccca ccgctccggc cccgtgcccc gtggcctgtc accatgaaca 1260
acctctcgga acgttgaaaa acggcttccg gccccgtcca cggcggacag gggccgacca 1320
ccggcttggg aatgggccga cggtgcgggc gggccgggga gatgcacagc gccgtgaacg 1380
gcgtccgtat tccctccgcg gctgtcacct cttaggtcat cgtgttgttc ccaagagcgt 1440
tacgcccaat ccgcgtggcc cgagtcacac cccgtaagcg atcaaaattg gtcagatgcg 1500
gataaacaag gtcatcaact cgtaccttgc ggccgcgcga ggaaggcgca gcctgctcat 1560
cacaccttcg gaccccgtgg aaccgggagc ggctccacgg ggtccgaagg tgacggcggt 1620
ggccggccac agccacagga ggggtttggc gtgcccggac cccgccgttc cggcggaagg 1680
cggagatcta aagttttgtc gtctttccag acgttagtaa atgaattttc tgtatgaggt 1740
tttgctaaac aactttcaac agtttcagcg gagtgagaat agaaaggaac aactaaagga 1800
attgcgaata ataatttttt cacgttgaaa atctccaaaa aaaaaggctc caaaaggagc 1860
ctttaattgt atcggtttat cagcttgctt tcgaggtgaa tttcttaaac agcttgatac 1920
cgatagttgc gccgacaatg acaacaacca tcgcccacgc ataaccgata tattcggtcg 1980
ctgaggcttg cagggagtca aaggccgctt ttgcgggatc tcgtcgaagg cggcgggggc 2040
gccggacgcg gccgggttcc cgggcttaag tgttcacatt cgaacggtct ctgctttgac 2100
aacatgctgt gcggtgttgt aaagtcgtgg ccatgggagc gctcccagga gaatacgaca 2160
gcgtgcagga ctgggggagt t 2181
<210> 8
<211> 125
<212> DNA
<213> Artificial Synthesis
<400> 8
tgttcacatt cgaacggtct ctgctttgac aacatgctgt gcggtgttgt aaagtcgtgg 60
cctgggagcg ctcccaatgg gagcgctccc aggagaatac gacagcgtgc aggactgggg 120
gagtt 125
<210> 9
<211> 2195
<212> DNA
<213> Artificial Synthesis
<400> 9
tcagcaggtg gaagagggac tggattccaa agttctcaat gctgcttgct gttcttgaat 60
ggggggtcgt tgacgacgac atggctcgat tggcgcgaca agttgctgcg attctcacca 120
ataaaaaacg cccggcggca accgagcgtt ctgaacaaat ccagatggag ttctgaggtc 180
attactggac ggatcctcag gaagaatccc gccccaccag ctccgtcggc agcaccacct 240
ggcgtcgttc caagcccctc gacaccgccg ggcggcggtc cgcgatctcg tccaggagga 300
ggtcgatcat cgcgcggccc atctcctcta tcggctggcg gacgctggtg agcggcgggt 360
ccatgtggcg ggcgatcgcc gagtcgtcgt agccgaccag cgccacgtcg tcgggtatgc 420
ggcggccctc ctcgcggagc acctggcggg cgccggcggc catgacgtcc gactcggcga 480
agaccgcgtc gaggtcgggg cagcgggcca ggagttcgcg catcgctcgg cggccgccct 540
cctccgtgaa gtcaccgggg gcgatcaggc gctcgtccac ctcgcggccc gcgtcctcca 600
gggcgtcgcg gtagccctcg atgcgccgct gggcgccgta gacgtccagc cggccggtga 660
tcgtggcgat ccgggcgcgc ccccgtgcga tgaggtgctc gaccgccgag cggccgccgc 720
cgtagttgtc ggagtcgacc gaggggagcg tctcgtgctc ggagcggggg ccgctgatga 780
cggccgggat ttccagttgc gacagcagat cggggagcgg gtcgtccgcg tggacggaga 840
ccaggaggac accgtcgacg cggtgcgcgg ccaggtactg ggcgaggcgc cggcgctccc 900
ggtcgttgcc cgcgaagatc agcaggagct gcatctcggt gtcggacagt tgcgctccga 960
cacccttgag gatgtcggag aagtacggct ccgagaagaa gcgggtctcc ggttcgggca 1020
cgaccatcgc gatcgcgtcg gtacggttcg ccgcgagcgc gcgggccgcc gtgttcggga 1080
cgtaacccag ctccgcgacg gccgcctcga ccgccgcgcg ggtcgcgtcg ctcacccggg 1140
gcgagccgtt gatcacccgg gacaccgtcc cccggcccac tccggcccgt gcggcgacct 1200
cctccaacgt cggccgccca ccgctccggc cccgtgcccc gtggcctgtc accatgaaca 1260
acctctcgga acgttgaaaa acggcttccg gccccgtcca cggcggacag gggccgacca 1320
ccggcttggg aatgggccga cggtgcgggc gggccgggga gatgcacagc gccgtgaacg 1380
gcgtccgtat tccctccgcg gctgtcacct cttaggtcat cgtgttgttc ccaagagcgt 1440
tacgcccaat ccgcgtggcc cgagtcacac cccgtaagcg atcaaaattg gtcagatgcg 1500
gataaacaag gtcatcaact cgtaccttgc ggccgcgcga ggaaggcgca gcctgctcat 1560
cacaccttcg gaccccgtgg aaccgggagc ggctccacgg ggtccgaagg tgacggcggt 1620
ggccggccac agccacagga ggggtttggc gtgcccggac cccgccgttc cggcggaagg 1680
cggagatcta aagttttgtc gtctttccag acgttagtaa atgaattttc tgtatgaggt 1740
tttgctaaac aactttcaac agtttcagcg gagtgagaat agaaaggaac aactaaagga 1800
attgcgaata ataatttttt cacgttgaaa atctccaaaa aaaaaggctc caaaaggagc 1860
ctttaattgt atcggtttat cagcttgctt tcgaggtgaa tttcttaaac agcttgatac 1920
cgatagttgc gccgacaatg acaacaacca tcgcccacgc ataaccgata tattcggtcg 1980
ctgaggcttg cagggagtca aaggccgctt ttgcgggatc tcgtcgaagg cggcgggggc 2040
gccggacgcg gccgggttcc cgggcttaag tgttcacatt cgaacggtct ctgctttgac 2100
aacatgctgt gcggtgttgt aaagtcgtgg cctgggagcg ctcccaatgg gagcgctccc 2160
aggagaatac gacagcgtgc aggactgggg gagtt 2195
<210> 10
<211> 14
<212> DNA
<213> Artificial Synthesis
<400> 10
tgggagcgct ccca 14
<210> 11
<211> 97
<212> DNA
<213> Artificial Synthesis
<400> 11
tgttcacatt cgaacggtct ctgctttgac aacatgctgt gcggtgttgt aaagtcgtgg 60
ccaggagaat acgacagcgt gcaggactgg gggagtt 97
<210> 12
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 12
tctagacccg ggaacccggc 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 13
aactccccca gtcctgcacg 20
Claims (9)
1. A gene with promoter function is characterized in that the sequence is shown as SEQ ID NO. 3 or SEQ ID NO. 8.
2. Use of the gene of claim 1 or a promoter having a promoter function comprising the gene of claim 1.
3. The use according to claim 2, wherein the gene of claim 1 has the sequence shown in SEQ ID NO. 7 or SEQ ID NO. 9.
4. A recombinant vector comprising the gene of claim 1.
5. The recombinant vector according to claim 4, wherein the recombinant vector comprises the gene of claim 1 as the sequence of SEQ ID NO. 3 or SEQ ID NO. 8, or as the sequence of SEQ ID NO. 7 or SEQ ID NO. 9.
6. A recombinant cell comprising the recombinant vector of claim 4 or 5.
7. A method for improving the production of natural blue pigment by Streptomyces, which is characterized in that the recombinant vector of claim 4 or 5 is transferred into Streptomyces and cellobiose is added.
8. The method of claim 7, wherein the Streptomyces is Streptomyces albus, Streptomyces lividans, or Streptomyces coelicolor.
9. The method of claim 8, wherein the streptomyces is streptomyces albidoflavus J1074, streptomyces lividans TK24, streptomyces coelicolor M1146, or streptomyces coelicolor M145.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110505406.5A CN113444724B (en) | 2021-05-10 | 2021-05-10 | Promoter, recombinant vector and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110505406.5A CN113444724B (en) | 2021-05-10 | 2021-05-10 | Promoter, recombinant vector and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113444724A true CN113444724A (en) | 2021-09-28 |
| CN113444724B CN113444724B (en) | 2023-03-17 |
Family
ID=77809647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110505406.5A Active CN113444724B (en) | 2021-05-10 | 2021-05-10 | Promoter, recombinant vector and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113444724B (en) |
Citations (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU4028199A (en) * | 1998-06-05 | 1999-12-30 | Discovery Technologies Ltd. | Transformed cell lines which express heterologous g-protein-coupled receptors |
| US20080064107A1 (en) * | 2006-07-19 | 2008-03-13 | Monsanto Technology Llc | Use of multiple transformation enhancer sequences to improve plant transformation efficiency |
| US20110287936A1 (en) * | 2010-04-23 | 2011-11-24 | E.I. Dupont De Nemours And Company | Gene switch compositions and methods of use |
| CN102286512A (en) * | 2011-06-30 | 2011-12-21 | 复旦大学 | Multi-fragment deoxyribose nucleic acid (DNA) series connection recombination assembly method based on site-specific recombination |
| CN103421778A (en) * | 2012-05-23 | 2013-12-04 | 中国科学院微生物研究所 | Streptomycete constitutive promoter and applications thereof |
| CN104109688A (en) * | 2014-07-23 | 2014-10-22 | 南通大学 | Method for randomly knocking out streptomyces genome DNA large fragment in vivo |
| CN104818291A (en) * | 2015-05-08 | 2015-08-05 | 江南大学 | Construction and application of streptomycete recombinant expression vector |
| CN105176873A (en) * | 2015-09-30 | 2015-12-23 | 菏泽学院 | Streptomyces sp. strain for producing environment-friendly blue pigment |
| CN105255210A (en) * | 2015-09-30 | 2016-01-20 | 菏泽学院 | Environment-friendly blue pigment extracting technology |
| CN105567611A (en) * | 2016-03-04 | 2016-05-11 | 北京工商大学 | Streptomyces exfoliatus A1013Y and application thereof |
| CN105821053A (en) * | 2015-01-04 | 2016-08-03 | 中国科学院微生物研究所 | Method for constructing recombinant strain by utilization of terramycin positive regulator gene and raising yield of terramycin |
| CN106520821A (en) * | 2016-12-07 | 2017-03-22 | 西南大学 | T7 RNA polymerase expression cassette PhT7 applicable to streptomyces as well as expression vector and application of T7 RNA polymerase expression cassette PhT7 |
| CN106701788A (en) * | 2016-12-20 | 2017-05-24 | 武汉大学 | Biosynthetic gene cluster of pentostatin and arabinofuranosyladenine and application of biosynthetic gene cluster |
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| CN107805640A (en) * | 2017-10-13 | 2018-03-16 | 中国农业科学院植物保护研究所 | A kind of method for improving secondary metabolism of Streptomyces Product yields |
| CN109295056A (en) * | 2018-09-10 | 2019-02-01 | 天津大学 | A kind of streptomyces coelicolor bidirectional promoter SCP1 |
| CN111518718A (en) * | 2020-04-29 | 2020-08-11 | 天津科技大学 | Recombinant escherichia coli indinoid production culture medium and method for fermenting and preparing crude pigment |
| CN112410278A (en) * | 2020-11-30 | 2021-02-26 | 上海交通大学 | Method for efficiently synthesizing moenomycin A in streptomyces albus |
| CN112501101A (en) * | 2020-12-16 | 2021-03-16 | 西南大学 | High-yield strain of natural herbicide thaxtomins and preparation method and application thereof |
| CN112899210A (en) * | 2021-03-08 | 2021-06-04 | 上海交通大学 | Method for improving validamycin fermentation level by enhancing positive regulatory protein gene expression |
| CN113637619A (en) * | 2021-07-23 | 2021-11-12 | 湖南师范大学 | Saccharopolyspora whiskers delta Clu13-MmsA and construction method and application thereof |
-
2021
- 2021-05-10 CN CN202110505406.5A patent/CN113444724B/en active Active
Patent Citations (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU4028199A (en) * | 1998-06-05 | 1999-12-30 | Discovery Technologies Ltd. | Transformed cell lines which express heterologous g-protein-coupled receptors |
| US20080064107A1 (en) * | 2006-07-19 | 2008-03-13 | Monsanto Technology Llc | Use of multiple transformation enhancer sequences to improve plant transformation efficiency |
| US20110287936A1 (en) * | 2010-04-23 | 2011-11-24 | E.I. Dupont De Nemours And Company | Gene switch compositions and methods of use |
| CN102286512A (en) * | 2011-06-30 | 2011-12-21 | 复旦大学 | Multi-fragment deoxyribose nucleic acid (DNA) series connection recombination assembly method based on site-specific recombination |
| CN103421778A (en) * | 2012-05-23 | 2013-12-04 | 中国科学院微生物研究所 | Streptomycete constitutive promoter and applications thereof |
| CN104109688A (en) * | 2014-07-23 | 2014-10-22 | 南通大学 | Method for randomly knocking out streptomyces genome DNA large fragment in vivo |
| CN105821053A (en) * | 2015-01-04 | 2016-08-03 | 中国科学院微生物研究所 | Method for constructing recombinant strain by utilization of terramycin positive regulator gene and raising yield of terramycin |
| CN104818291A (en) * | 2015-05-08 | 2015-08-05 | 江南大学 | Construction and application of streptomycete recombinant expression vector |
| CN105255210A (en) * | 2015-09-30 | 2016-01-20 | 菏泽学院 | Environment-friendly blue pigment extracting technology |
| CN105176873A (en) * | 2015-09-30 | 2015-12-23 | 菏泽学院 | Streptomyces sp. strain for producing environment-friendly blue pigment |
| WO2017151059A1 (en) * | 2016-02-29 | 2017-09-08 | Agency For Science, Technology And Research | Multiplexable activation of silent biosynthetic clusters in native actinomycete hosts for natural product discovery |
| CN105567611A (en) * | 2016-03-04 | 2016-05-11 | 北京工商大学 | Streptomyces exfoliatus A1013Y and application thereof |
| CN106520821A (en) * | 2016-12-07 | 2017-03-22 | 西南大学 | T7 RNA polymerase expression cassette PhT7 applicable to streptomyces as well as expression vector and application of T7 RNA polymerase expression cassette PhT7 |
| CN106701788A (en) * | 2016-12-20 | 2017-05-24 | 武汉大学 | Biosynthetic gene cluster of pentostatin and arabinofuranosyladenine and application of biosynthetic gene cluster |
| CN107805640A (en) * | 2017-10-13 | 2018-03-16 | 中国农业科学院植物保护研究所 | A kind of method for improving secondary metabolism of Streptomyces Product yields |
| CN109295056A (en) * | 2018-09-10 | 2019-02-01 | 天津大学 | A kind of streptomyces coelicolor bidirectional promoter SCP1 |
| CN111518718A (en) * | 2020-04-29 | 2020-08-11 | 天津科技大学 | Recombinant escherichia coli indinoid production culture medium and method for fermenting and preparing crude pigment |
| CN112410278A (en) * | 2020-11-30 | 2021-02-26 | 上海交通大学 | Method for efficiently synthesizing moenomycin A in streptomyces albus |
| CN112501101A (en) * | 2020-12-16 | 2021-03-16 | 西南大学 | High-yield strain of natural herbicide thaxtomins and preparation method and application thereof |
| CN112899210A (en) * | 2021-03-08 | 2021-06-04 | 上海交通大学 | Method for improving validamycin fermentation level by enhancing positive regulatory protein gene expression |
| CN113637619A (en) * | 2021-07-23 | 2021-11-12 | 湖南师范大学 | Saccharopolyspora whiskers delta Clu13-MmsA and construction method and application thereof |
Non-Patent Citations (12)
Also Published As
| Publication number | Publication date |
|---|---|
| CN113444724B (en) | 2023-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109207387B (en) | Yeast strains and methods for producing collagen | |
| CN101001951B (en) | Method for isolation of transcription termination sequences | |
| CN101522706B (en) | Telomerase reverse transcriptase fusion protein, nucleotides encoding it, and uses thereof | |
| DK2689015T3 (en) | A process for the production of secreted polypeptides | |
| Wu et al. | pHsh vectors, a novel expression system of Escherichia coli for the large-scale production of recombinant enzymes | |
| CA2727628C (en) | Improved protein expression system | |
| AU783763B2 (en) | Vectors for transforming plants | |
| KR20200040247A (en) | Sialyltransferase and its use in the production of sialylated oligosaccharides | |
| CN110938671A (en) | Non-replicating transduction particles and transduction particle-based reporter systems | |
| Rother et al. | Heterologous expression of archaeal selenoprotein genes directed by the SECIS element located in the 3′ non‐translated region | |
| KR20190138274A (en) | Optimized genetic tool for modifying clostridium bacteria | |
| BRPI0806354A2 (en) | transgender oilseeds, seeds, oils, food or food analogues, medicinal food products or medicinal food analogues, pharmaceuticals, beverage formulas for babies, nutritional supplements, pet food, aquaculture feed, animal feed, whole seed products , mixed oil products, partially processed products, by-products and by-products | |
| US11851648B2 (en) | Humanized cell line | |
| KR20180086206A (en) | Modified bi-directional catalase promoter from Bacillus | |
| CN113621642A (en) | Genetic intelligent breeding system for crop cross breeding seed production and application thereof | |
| CN1350582A (en) | Method for generating split, non-transferable genes that are able to express an active protein product | |
| CN113302303A (en) | Modified filamentous fungal host cells | |
| CN107002070A (en) | Co-expression plasmid | |
| CN107287236B (en) | Construction method of mouse model for human acute pancreatitis | |
| CN109402171A (en) | A kind of Bursaphelenchus xylophilus RNAi controlling gene and its application | |
| CN113444724B (en) | Promoter, recombinant vector and application | |
| WO2021113522A1 (en) | Compositions comprising a nuclease and uses thereof | |
| TWI515295B (en) | Regulation of inducible promoters | |
| KR102282778B1 (en) | Recombinant microorganisms and methods of use thereof | |
| CN113614229A (en) | Genetically modified Clostridium bacteria, their preparation and use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |