CN113444666B - Method for efficiently separating mycoplasma hyopneumoniae - Google Patents
Method for efficiently separating mycoplasma hyopneumoniae Download PDFInfo
- Publication number
- CN113444666B CN113444666B CN202110792367.1A CN202110792367A CN113444666B CN 113444666 B CN113444666 B CN 113444666B CN 202110792367 A CN202110792367 A CN 202110792367A CN 113444666 B CN113444666 B CN 113444666B
- Authority
- CN
- China
- Prior art keywords
- mycoplasma hyopneumoniae
- culture
- culture medium
- levofloxacin
- generation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/70—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in livestock or poultry
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to mycoplasma separation and discloses a method for efficiently separating mycoplasma hyopneumoniae. The method for efficiently separating mycoplasma hyopneumoniae is to purify and culture mycoplasma hyopneumoniae by using a culture medium containing levofloxacin, wherein the concentration of the levofloxacin is 50-200 mug/mL. The invention discovers that the levofloxacin can obviously inhibit the growth of mycoplasma hyorhinis in a certain concentration range without affecting the growth of mycoplasma hyorhinis, and the culture medium containing the levofloxacin can be used for purifying the mycoplasma hyorhinis and reducing the pollution of the mycoplasma hyorhinis. The mycoplasma hyopneumoniae separation efficiency by the method can reach about 50 percent, which is far higher than that of the traditional separation and purification method.
Description
Technical Field
The invention relates to mycoplasma separation, in particular to a method for efficiently separating mycoplasma hyopneumoniae.
Background
Mycoplasma belongs to the class of mollicutes, and the cell morphology and structure of mycoplasma are mostly spherical, the size (diameter between 0.3 and 0.8 μm) is between viruses and bacteria, and the mycoplasma is a prokaryote lacking cell walls. Mycoplasma is the smallest microorganism that can proliferate itself in cell-free medium, and because mycoplasma loses genes related to biosynthetic pathways during evolution, amino acids, purines and pyrimidines, and cell membrane components, which are essential for mycoplasma growth, must be taken up from the environment in which they are grown, mycoplasma is very demanding in vitro culture conditions, and until now many mycoplasma species have not been able to grow in vitro.
Mycoplasma hyopneumoniae is an extracellular pathogen that adheres to the cilia of the tracheal or bronchial epithelium of porcine lung tissue, regulating the innate and adaptive immune systems, thereby escaping host defenses and establishing a chronic and persistent infection. Mycoplasma hyopneumoniae cells are round or oval, have diameters ranging from 0.5 to 0.8 mu m, and are only used for specifically infecting pigs, thus being one of important pathogens causing respiratory diseases of pigs. Once a herd is infected with mycoplasma hyopneumoniae, it becomes very complex and difficult to eradicate it. In practical production, the main means for controlling infection caused by mycoplasma hyopneumoniae is vaccination. However, in clinic, the probability of successfully separating mycoplasma hyopneumoniae from the lung tissue of pigs is small, so that the candidate strains for selection in the current vaccine production are limited (the mycoplasma hyopneumoniae inactivated vaccine strains used in China are mainly from abroad). Moreover, existing commercial vaccines provide only partial protection and do not prevent mycoplasma hyopneumoniae proliferation in the host. Therefore, it is important to separate and purify mycoplasma hyopneumoniae strains with good growth characteristics and high immunogenicity.
Mycoplasma hyopneumoniae was first identified in 1965 and medium specific for isolated culture of mycoplasma hyopneumoniae was not reported until 1975. However, the clinical samples usually contain fast-growing mycoplasma hyorhinis, and the fast-growing mycoplasma hyorhinis can competitively consume nutrient components in a growing environment, so that the quantity of mycoplasma hyorhinis cultured in the separation process is smaller and smaller, and only mycoplasma hyorhinis can be identified in the final separation medium, and in most cases, the separation of mycoplasma hyorhinis ends with the excessive fast-growing mycoplasma hyorhinis. The mycoplasma hyopneumoniae separation and purification work is seriously hindered due to the existence of mycoplasma hyopneumoniae in the mycoplasma hyopneumoniae separation process and the lack of an effective method for removing mycoplasma hyopneumoniae. Up to now, research at home and abroad considers that the isolated culture of mycoplasma hyopneumoniae is still complex and not easy to succeed, and only 8 complete mycoplasma hyopneumoniae complete genomes are reported by NCBI. The lack of a method for efficiently separating mycoplasma hyopneumoniae greatly prevents the separation of clinical pathogenic strains, and the limited strains limit the screening of mycoplasma hyopneumoniae effective antigens, the development of diagnostic molecules and the establishment of effective prevention and control strategies.
Disclosure of Invention
The invention aims to overcome the defects and shortcomings of the prior art and provides a method for efficiently separating mycoplasma hyopneumoniae.
The aim of the invention is achieved by the following technical scheme:
a method for efficiently separating mycoplasma hyopneumoniae is to purify and culture mycoplasma hyopneumoniae by using a culture medium containing levofloxacin.
Preferably, the purification culture is purification by subculture; the number of subculture is preferably six, and the transfer ratio is 1:10000-1:100000 in the fourth generation.
Preferably, the method for efficiently separating mycoplasma hyopneumoniae comprises the following steps:
(1) Samples taken from diseased porcine lung tissue with respiratory disease were processed and transferred to culture medium for culture.
(2) After six days of sample culture in step (1), transferring the first-generation culture into a new liquid culture medium containing levofloxacin for second-generation culture, and so on; the sixth generation of culture product is coated on a solid culture medium containing levofloxacin, after a single clone grows, a single colony is picked up by an inoculating wire to streak on the solid culture medium, after a new single colony grows, the single colony is picked up again to streak, repeated for a plurality of times, and finally the single clone is picked up in a liquid culture medium, namely the mycoplasma hyopneumoniae is separated and purified.
Preferably, the sample treatment in step (1) is to place the sample in PBS, shear the sample, grind the sample, centrifuge the sample, filter the supernatant with a filter to sterilize, transfer the supernatant to a liquid medium containing levofloxacin for culture.
Preferably, the concentration of the levofloxacin is 50-200 mug/mL. More preferably, the concentration of levofloxacin is 128 μg/mL.
More preferably, the method for efficiently separating mycoplasma hyopneumoniae comprises the following steps:
(1) Samples taken from diseased pig lung tissue with respiratory disease were placed in 2mL centrifuge tubes with PBS, minced and ground, centrifuged at 4 ℃ for 5min at 5000r/min, the supernatant was sterilized by filtration using a 0.45 μm filter, and transferred to a liquid medium containing 128 μg/mL of levofloxacin at 1:4 (volume ratio) for culture.
(2) Six days after the sample culture of step (1), the first generation culture is transferred to a new liquid culture medium containing 128 mug/mL of levofloxacin according to the volume ratio of 1:4 for second generation culture, and so on; transferring the third-generation culture into a liquid culture medium containing 128 mug/mL of levofloxacin according to the volume ratio of 1:10000-1:100000 for six days when the culture is transferred to the fourth generation; transferring the fourth-generation culture into a new liquid culture medium containing 128 mug/mL of levofloxacin according to the volume ratio of 1:10 for six days, and the like, coating the sixth-generation culture product onto a solid culture medium containing 128 mug/mL of levofloxacin, picking a single colony by using an inoculating wire to streak on the solid culture medium after a single colony grows, re-picking the single colony to streak, repeating for a plurality of times, and finally picking the single colony in the liquid culture medium, namely separating and purifying to obtain mycoplasma hyopneumoniae.
Preferably, the culture medium is a Friis culture medium; the culture conditions were 37℃and 5% CO 2 。
The invention has the following advantages and beneficial effects: the invention discovers that the levofloxacin can obviously inhibit the growth of mycoplasma hyorhinis in a certain concentration range without affecting the growth of mycoplasma hyorhinis, and the culture medium containing the levofloxacin can be used for purifying the mycoplasma hyorhinis and reducing the pollution of the mycoplasma hyorhinis. The mycoplasma hyopneumoniae separation efficiency by the method can reach about 50 percent, which is far higher than that of the traditional separation and purification method.
Detailed Description
The following examples are provided to further illustrate the present invention and should not be construed as limiting the invention, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principles of the invention are intended to be equivalent substitutes.
The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise indicated.
And (3) sample collection: samples must be taken from pig farms with clinical symptoms of typical mycoplasma hyopneumoniae, such as adult fattening pigs with severe asthmatic disease and emaciated hair, serological tests are positive for mycoplasma hyopneumoniae antibodies; the pig lung tissue disease material with changed meat is taken in the field, put into liquid nitrogen for preservation, transported to a laboratory and frozen at-20 ℃ for further study.
Preparation of mycoplasma hyopneumoniae Friis liquid culture medium:
after fully and evenly mixing, evenly packaging into 7 1L blue mouth bottles, sterilizing for 20min at 110 ℃, and after the room temperature is restored, respectively adding the following components into each blue mouth bottle:
the prepared culture medium is used as basic culture medium, and before use, 12.5% pig serum and 12.5% horse serum are added, and the culture medium is placed at 4 ℃ for standby.
Preparation of mycoplasma hyopneumoniae Friis solid medium: 1.8g agarose is added into 23mL Hanks' balanced salt solution added with 0.1% Diethylaminoethyl (DEAE) -dextran, sterilized in a sterilizing pot at 120 ℃ for 1min, cooled to 100 ℃, fully and uniformly mixed with 200mL Friis liquid culture medium preheated to 56 ℃, poured into a flat plate, and placed at 4 ℃ for standby after solidification.
EXAMPLE 1 isolation and purification of Mycoplasma hyopneumoniae by conventional methods
1) Pretreatment of pig lung tissue samples: the lung tissue is taken out from the chest of a sick pig suffering from serious respiratory diseases, the lung surface is wiped by 75% alcohol, after the alcohol is volatilized, a scissor is used for sampling from the junction of shrimp-like meat change tissue and normal tissue, the taken sample is placed into liquid nitrogen for storage, and the sample is frozen at-20 ℃ after being transported to a laboratory. Taking out the disease material from the temperature of minus 20 ℃ and thawing the disease material in a refrigerator with the low temperature of 4 ℃; after the cleaning agent is completely thawed, the cleaning agent is quickly placed in an ultra-clean workbench; taking 10 samples (sample 1 to sample 10) from different sites at the tip leaf, the heart leaf, the accessory leaf and the diaphragm leaf of the lung (mainly at the junction of the occurrence of shrimp-like lesions and normal tissues) respectively by surgical scissors; the collected samples are respectively placed in a 2mL centrifuge tube filled with PBS; cutting the samples in the centrifuge tube by surgical scissors; grinding with a grinder, grinding at 60 Hz for 300 seconds, and centrifuging at 4deg.C for 5min at 5000 r/min.
2) Isolation culture of mycoplasma hyopneumoniae: after centrifugation was completed, the supernatant was taken, and then bacteria in the supernatant were removed by using a 0.45 μm filter; the filtered supernatant was placed in a sterile flask, followed by four volumes (1:4) of Fris broth containing 5% CO at 37deg.C 2 Culturing in an incubator.
3) Purification culture of mycoplasma hyopneumoniae: after six days of culture, the first generation cultures were transferred to fresh Friis liquid medium; after six days of second generation culture, the culture was transferred to fresh Friis liquid medium; and the like, culturing until the sixth generation, and identifying whether each generation of culture is mycoplasma hyopneumoniae or exists in mycoplasma hyopneumoniae by PCR.
4) Identification of mycoplasma hyopneumoniae: the culture only containing mycoplasma hyopneumoniae is identified by PCR in the step 3), twenty generations (six-day generation transmission) are continuously transmitted in vitro, and whether the mycoplasma hyopneumoniae exists in the isolated species is identified by PCR; the PCR is identified as stock solution and diluent which only exist in mycoplasma hyopneumoniae are smeared on a Friis solid culture medium for culture; the single colony grown in the Friis solid culture medium is picked up, put into the Friis liquid culture medium for culture, and after three times of repetition, whether the colony is mycoplasma hyopneumoniae is identified by PCR. Gel electrophoresis and sequencing comparison are carried out on the amplified products to determine whether the purified pathogen is mycoplasma hyopneumoniae.
Primers identifying mycoplasma hyorhinis (Mhr) are:
Mhr-F：GCATCTATATTTTCGCCAATAGC；
Mhr-R：AGCTAGAGTTTCATCATTACC；
primers for identification of mycoplasma hyopneumoniae (Mhp):
p36-F：CCTTAAATATTTTTAATTGCATCCTG；
p36-R：CGCATGAAACCTATTAAAATAGCTC。
experimental results: the results of the mycoplasma hyopneumoniae isolation by using the conventional method are shown in table 1. The results show that: the separation efficiency can only reach 10%, and the reason for low separation rate is mainly that the mycoplasma hyopneumoniae pollution can not be effectively removed, and the mycoplasma hyopneumoniae growth is rapidly and competitively inhibited by adding the mycoplasma hyopneumoniae growth rate, so that the mycoplasma hyopneumoniae existence can not be detected in the fourth generation, and the traditional method has low mycoplasma hyopneumoniae separation efficiency.
TABLE 1 Effect of traditional methods for isolation of mycoplasma hyopneumoniae from porcine lung tissue
Positive for the +; -negative for PCR detection result; the number of + or-represents the content of the detected pathogen.
EXAMPLE 2 Effect of antibiotics on isolation of purified Mycoplasma hyopneumoniae
1) Pretreatment of pig lung tissue samples: the lung tissue is taken out from the chest of a sick pig suffering from serious respiratory diseases, the lung surface is wiped by 75% alcohol, after the alcohol is volatilized, a scissor is used for sampling from the junction of shrimp-like meat change tissue and normal tissue, the taken sample is placed into liquid nitrogen for storage, and the sample is frozen at-20 ℃ after being transported to a laboratory. Taking out the disease material from the temperature of minus 20 ℃ and thawing the disease material in a refrigerator with the low temperature of 4 ℃; after the cleaning agent is completely thawed, the cleaning agent is quickly placed in an ultra-clean workbench; samples are taken from different sites (mainly the junctions of shrimp-like lesions and normal tissues) at the tip leaf, the heart leaf, the accessory leaf and the diaphragm leaf of the lung respectively through surgical scissors; the collected samples are respectively placed in a 2mL centrifuge tube filled with PBS; cutting the samples in the centrifuge tube by surgical scissors; grinding with a grinder, grinding at 60 Hz for 300 seconds, and centrifuging at 4deg.C for 5min at 5000 r/min.
2) Isolation culture of mycoplasma hyopneumoniae: after centrifugation was completed, the supernatant was taken, and bacteria in the supernatant was removed by using a 0.45 μm filter, and transferred to Friis liquid medium to which 100. Mu.g/mL of sodium penicillin (sample 1), 100. Mu.g/mL of erythromycin (sample 2), 100. Mu.g/mL of kanamycin (sample 3), 100. Mu.g/mL of oxytetracycline (sample 4), and 100. Mu.g/mL of levofloxacin (sample 5) were added, respectively, at 1:4, and the culture was placed at 37℃with 5% CO 2 Six days of culture in incubator, different antibiotics were added in order to find antibiotics that inhibit the growth of mycoplasma hyorhinis but do not affect the growth of mycoplasma hyorhinis.
3) Purification culture of mycoplasma hyopneumoniae: first, at 37℃with 5% CO 2 After six days of culture of each sample in the step 2), transferring to a Friis liquid culture medium which is respectively added with 100 mug/mL of penicillin sodium (sample 1), 100 mug/mL of erythromycin (sample 2), 100 mug/mL of kanamycin (sample 3), 100 mug/mL of terramycin (sample 4) and 100 mug/mL of levofloxacin (sample 5) according to the ratio of 1:4, culturing until the sixth generation (six days of culture per generation), coating the liquid culture on Friis solid culture medium containing corresponding antibiotics for culture, after single clone is grown, picking single colony with an inoculating wire for streaking, after new single colony is grown, re-picking single colony for streaking, repeating for three times, and finally picking single clone in the Friis liquid culture medium, namely separating and purifying mycoplasma hyopneumoniae. The presence of mycoplasma hyopneumoniae or mycoplasma hyopneumoniae in each generation was identified by PCR.
4) Identification of mycoplasma hyopneumoniae: continuously transferring the mycoplasma hyopneumoniae purified in the step 3) in vitro for twenty generations (six-day transfer generation), and identifying whether the mycoplasma hyopneumoniae exists in the isolated species by PCR; the PCR is identified as stock solution and diluent which only exist in mycoplasma hyopneumoniae are smeared on a Friis solid culture medium for culture; the single colony grown in the Friis solid culture medium is picked up, and is put into the Friis culture medium for culture, and after three times of repetition, whether the colony is mycoplasma hyopneumoniae is identified by PCR. Gel electrophoresis and sequencing comparison are carried out on the amplified products to determine whether the purified pathogen is mycoplasma hyopneumoniae.
Primers identifying mycoplasma hyorhinis (Mhr) are:
Mhr-F：GCATCTATATTTTCGCCAATAGC；
Mhr-R：AGCTAGAGTTTCATCATTACC；
primers for identification of mycoplasma hyopneumoniae (Mhp):
p36-F：CCTTAAATATTTTTAATTGCATCCTG；
p36-R：CGCATGAAACCTATTAAAATAGCTC。
experimental results: the results of the isolation of mycoplasma hyopneumoniae by using the method of this example are shown in table 2. The results show that: compared with the traditional method, the efficiency of the mycoplasma hyopneumoniae separation in the embodiment is higher than that of the traditional method, and the mycoplasma hyopneumoniae separation in the traditional method (without antibiotics) can not detect the existence of mycoplasma hyopneumoniae in the third generation; however, after mycoplasma hyopneumoniae is separated (antibiotics are added), the existence of mycoplasma hyopneumoniae can be detected after the third generation, and particularly, the levofloxacin (before the fifth generation) obviously inhibits the growth of mycoplasma hyopneumoniae, but does not influence the growth of mycoplasma hyopneumoniae, so that the method provides a thinking for further removing the pollution of mycoplasma hyopneumoniae.
TABLE 2 growth inhibition effects of different antibiotics on mycoplasma hyopneumoniae and mycoplasma hyopneumoniae
Positive for the +; -negative for PCR detection result; the number of + or-represents the content of the detected pathogen. Sample 6 was a control group without antibiotic.
EXAMPLE 3 Effect of different concentrations of levofloxacin on isolation of Mycoplasma hyopneumoniae
1) Pretreatment of pig lung tissue samples: the lung tissue is taken out from the chest of a sick pig suffering from serious respiratory diseases, the lung surface is wiped by 75% alcohol, after the alcohol is volatilized, a scissor is used for sampling from the junction of shrimp-like meat change tissue and normal tissue, the taken sample is placed into liquid nitrogen for storage, and the sample is frozen at-20 ℃ after being transported to a laboratory. Taking out the disease material from the temperature of minus 20 ℃ and thawing the disease material in a refrigerator with the low temperature of 4 ℃; after the cleaning agent is completely thawed, the cleaning agent is quickly placed in an ultra-clean workbench; samples are taken from different sites (mainly the junctions of shrimp-like lesions and normal tissues) at the tip leaf, the heart leaf, the accessory leaf and the diaphragm leaf of the lung respectively through surgical scissors; the collected samples are respectively placed in a 2mL centrifuge tube filled with PBS; cutting the samples in the centrifuge tube by surgical scissors; grinding with a grinder, grinding at 60 Hz for 300 seconds, and centrifuging at 4deg.C for 5min at 5000 r/min.
2) Isolation culture of mycoplasma hyopneumoniae: after the supernatant obtained by the centrifugation in step 1) was sterilized by filtration (0.45 μm), it was transferred to a Friis liquid culture containing 0. Mu.g/mL (sample 1), 16. Mu.g/mL (sample 2), 32. Mu.g/mL (sample 3), 64. Mu.g/mL (sample 4), 128. Mu.g/mL (sample 5) and 256. Mu.g/mL (sample 6) of levofloxacin at a ratio of 1:4 based on 5% CO at 37 ℃ 2 Culturing in an incubator for six days.
3) Purification culture of mycoplasma hyopneumoniae: first, at 37℃with 5% CO 2 After six days of culture of each sample in the step 2), transferring to a Friis liquid culture medium added with 0 mug/mL, 16 mug/mL, 32 mug/mL, 64 mug/mL, 128 mug/mL and 256 mug/mL of levofloxacin according to the ratio of 1:4, culturing until the sixth generation (six days of culture per generation), coating the liquid culture on a Friis solid culture medium containing the levofloxacin with the corresponding concentration for culture, picking single colony to streak on the solid culture medium by using an inoculating wire after a single clone grows, re-picking single colony to streak, repeating three times, and finally picking the single clone in the Friis liquid culture medium, namely separating and purifying to mycoplasma hyopneumoniae. The presence of mycoplasma hyopneumoniae or mycoplasma hyopneumoniae in each generation was identified by PCR.
4) Identification of mycoplasma hyopneumoniae: continuously transferring the mycoplasma hyopneumoniae purified in the step 3) for twenty generations (six-day transfer generation) in vitro, and identifying whether the mycoplasma hyopneumoniae exists in the isolated species through PCR; the PCR is identified as stock solution and diluent which only exist in mycoplasma hyopneumoniae are smeared on a Friis solid culture medium for culture; the single colony grown in the Friis solid culture medium is picked up, and is put into the Friis culture medium for culture, and after three times of repetition, whether the colony is mycoplasma hyopneumoniae is identified by PCR. Gel electrophoresis and sequencing comparison are carried out on the amplified products to determine whether the purified pathogen is mycoplasma hyopneumoniae.
Primers identifying mycoplasma hyorhinis (Mhr) are:
Mhr-F：GCATCTATATTTTCGCCAATAGC；
Mhr-R：AGCTAGAGTTTCATCATTACC；
primers for identification of mycoplasma hyopneumoniae (Mhp):
p36-F：CCTTAAATATTTTTAATTGCATCCTG；
p36-R：CGCATGAAACCTATTAAAATAGCTC。
experimental results: the results of the mycoplasma hyopneumoniae isolation by using the method of this example are shown in table 3: the results show that: 64. Mu.g/mL, 128. Mu.g/mL and 256. Mu.g/mL of levofloxacin, respectively, showed an effect of inhibiting the growth of Mycoplasma hyopneumoniae, wherein 256. Mu.g/mL of levofloxacin also inhibited the growth of Mycoplasma hyopneumoniae; 128 μg/mL of levofloxacin inhibits the growth of mycoplasma hyopneumoniae only in the third, fourth and fifth generations, and the number of mycoplasma hyopneumoniae in the fourth generation is greater than that of mycoplasma hyopneumoniae, so 128 μg/mL of levofloxacin contributes to the separation efficiency of mycoplasma hyopneumoniae.
TABLE 3 Effect of different concentrations of levofloxacin on the isolation of Mycoplasma hyopneumoniae
EXAMPLE 4 Effect of the ratio of vaccination on isolated and purified Mycoplasma hyopneumoniae
1) Pretreatment of pig lung tissue samples: the lung tissue is taken out from the chest of a sick pig suffering from serious respiratory diseases, the lung surface is wiped by 75% alcohol, after the alcohol is volatilized, a scissor is used for sampling from the junction of shrimp-like meat change tissue and normal tissue, the taken sample is placed into liquid nitrogen for storage, and the sample is frozen at-20 ℃ after being transported to a laboratory. Taking out the disease material from the temperature of minus 20 ℃ and thawing the disease material in a refrigerator with the low temperature of 4 ℃; after the cleaning agent is completely thawed, the cleaning agent is quickly placed in an ultra-clean workbench; samples are taken from different sites (mainly the junctions of shrimp-like lesions and normal tissues) at the tip leaf, the heart leaf, the accessory leaf and the diaphragm leaf of the lung respectively through surgical scissors; the collected samples are respectively placed in a 2mL centrifuge tube filled with PBS; cutting the samples in the centrifuge tube by surgical scissors; grinding with a grinder, grinding at 60 Hz for 300 seconds, and centrifuging at 4deg.C for 5min at 5000 r/min.
2) Isolation culture of mycoplasma hyopneumoniae: after the supernatant obtained in step 1) was filtered (0.45 μm) and sterilized, the supernatant was transferred 1:4 to Friis liquid culture with 128. Mu.g/mL of levofloxacin added (inhibiting growth of mycoplasma hyopneumoniae but not affecting growth of mycoplasma hyopneumoniae) based on 5% CO at 37 ℃ C 2 Culturing in an incubator for six days.
3) Purification culture of mycoplasma hyopneumoniae: first, at 37℃with 5% CO 2 After culturing the culture in step 2) in an incubator for six days, transfer to Friis liquid medium with 128 μg/mL of levofloxacin at 1:4, transfer to Friis liquid medium with 128 μg/mL of levofloxacin at 1:100000 (sample 1), 1:10000 (sample 2), 1:1000 (sample 3), 1:100 (sample 4), 1:10 (sample 5) and 1:5 (sample 6) respectively at the fourth generation (six days of culture); next, at 37℃with 5% CO 2 After six days in the incubator, the fifth generation was transferred to a new Friis liquid medium with 128 μg/mL levofloxacin at 37℃with 5% CO at 1:10 2 After six days in the incubator, the sixth generation was transferred to a new Friis liquid medium with 128 μg/mL levofloxacin at 37℃with 5% CO at 1:10 2 After culturing in an incubator for six days, the liquid culture is coated on a flat plate (Fris solid culture medium containing 128 mu g/mL of levofloxacin) for culturing, after a monoclonal is grown, a single colony is picked up by an inoculating wire and streaked on the solid culture medium, after a new single colony is grown, the single colony streaked is picked up again, repeated three times, and finally the monoclonal is picked up in the liquid culture medium, namely the mycoplasma hyopneumoniae is separated and purified. The presence of mycoplasma hyopneumoniae or mycoplasma hyopneumoniae in each generation was identified by PCR.
4) Identification of mycoplasma hyopneumoniae: continuously transferring the mycoplasma hyopneumoniae purified in the step 3) for twenty generations (six-day transfer generation) in vitro, and identifying whether the mycoplasma hyopneumoniae exists in the isolated species through PCR; the PCR is identified as stock solution and diluent which only exist in mycoplasma hyopneumoniae are smeared on a Friis solid culture medium for culture; the single colony grown in the Friis solid culture medium is picked up, and is put into the Friis culture medium for culture, and after three times of repetition, whether the colony is mycoplasma hyopneumoniae is identified by PCR. Gel electrophoresis and sequencing comparison are carried out on the amplified products to determine whether the purified pathogen is mycoplasma hyopneumoniae.
Primers identifying mycoplasma hyorhinis (Mhr) are:
Mhr-F：GCATCTATATTTTCGCCAATAGC；
Mhr-R：AGCTAGAGTTTCATCATTACC；
primers for identification of mycoplasma hyopneumoniae (Mhp):
p36-F：CCTTAAATATTTTTAATTGCATCCTG；
p36-R：CGCATGAAACCTATTAAAATAGCTC。
experimental results: the results of the mycoplasma hyopneumoniae isolation by using the method of this example are shown in table 4: the results show that: and transferring mycoplasma hyopneumoniae cultures through different proportions from the culture to the fourth generation, wherein the mycoplasma hyopneumoniae cultures can be transferred according to the proportion of 1:10000-1:100000, so that the mycoplasma hyopneumoniae can be effectively removed from the mycoplasma hyopneumoniae, and the mycoplasma hyopneumoniae can be separated and purified.
TABLE 4 influence of different transfer ratios on mycoplasma hyopneumoniae separation rate
Positive for the +; -negative for PCR detection result; the number of + or-represents the content of the detected pathogen.
EXAMPLE 5 isolation and purification of Mycoplasma hyopneumoniae by the method of the present invention
1) Pretreatment of pig lung tissue samples: the lung tissue is taken out from the chest of a sick pig suffering from serious respiratory diseases, the lung surface is wiped by 75% alcohol, after the alcohol is volatilized, a scissor is used for sampling from the junction of shrimp-like meat change tissue and normal tissue, the taken sample is placed into liquid nitrogen for storage, and the sample is frozen at-20 ℃ after being transported to a laboratory. Taking out the disease material from the temperature of minus 20 ℃ and thawing the disease material in a refrigerator with the low temperature of 4 ℃; after the cleaning agent is completely thawed, the cleaning agent is quickly placed in an ultra-clean workbench; taking 10 samples (sample 1 to sample 10) from different sites at the tip leaf, the heart leaf, the accessory leaf and the diaphragm leaf of the lung (mainly at the junction of the occurrence of shrimp-like lesions and normal tissues) respectively by surgical scissors; the collected samples are respectively placed in a 2mL centrifuge tube filled with PBS; cutting the samples in the centrifuge tube by surgical scissors; grinding with a grinder, grinding at 60 Hz for 300 seconds, and centrifuging at 4deg.C for 5min at 5000 r/min.
2) Isolation culture of mycoplasma hyopneumoniae: after the supernatant obtained in the step 1) was sterilized by filtration (0.45 μm), it was transferred to a Friis liquid medium supplemented with 128. Mu.g/mL of levofloxacin at a ratio of 1:4 for culturing.
3) Purification culture of mycoplasma hyopneumoniae: first, at 37℃with 5% CO 2 After culturing the culture in the step 2) for six days in an incubator, transferring the culture to the Friis liquid culture medium added with 128 mug/mL of levofloxacin according to the ratio of 1:4, and culturing until the fourth generation (six days of each generation of culture) is transferred to the Friis liquid culture medium added with 128 mug/mL of levofloxacin according to the ratio of 1:10000; next, at 37℃with 5% CO 2 After six days in the incubator, the fifth generation was transferred to a new Friis broth culture with 128 μg/mL levofloxacin at 37℃with 5% CO at 1:10 2 After six days in the incubator, the sixth generation was transferred to a new Friis broth culture with 128 μg/mL levofloxacin at 37℃with 5% CO at 1:10 2 After culturing in an incubator for six days, the liquid culture is coated on a flat plate (Fris solid culture medium containing 128 mu g/mL of levofloxacin) for culturing, after a single clone is grown, a single colony is picked up by an inoculating wire and streaked on the solid culture medium, after a new single colony is grown, the culture medium is re-grownAnd (3) single colony streaking is selected, repeated three times, and finally single clone is selected in a liquid culture medium, namely the mycoplasma hyopneumoniae is separated and purified. The presence of mycoplasma hyopneumoniae or mycoplasma hyopneumoniae in each generation was identified by PCR.
4) Identification of mycoplasma hyopneumoniae: continuously transferring the mycoplasma hyopneumoniae purified in the step 3) for twenty-six days in vitro, and identifying whether the isolated species exist mycoplasma hyopneumoniae or not through PCR; the PCR is identified as stock solution and diluent which only exist in mycoplasma hyopneumoniae are smeared on a Friis solid culture medium for culture; the single colony grown in the Friis solid culture medium is picked up, and is put into the Friis culture medium for culture, and after three times of repetition, whether the colony is mycoplasma hyopneumoniae is identified by PCR. Gel electrophoresis and sequencing comparison are carried out on the amplified products to determine whether the purified pathogen is mycoplasma hyopneumoniae.
Primers identifying mycoplasma hyorhinis (Mhr) are:
Mhr-F：GCATCTATATTTTCGCCAATAGC；
Mhr-R：AGCTAGAGTTTCATCATTACC；
primers for identification of mycoplasma hyopneumoniae (Mhp):
p36-F：CCTTAAATATTTTTAATTGCATCCTG；
p36-R：CGCATGAAACCTATTAAAATAGCTC。
experimental results: the results of the isolation of mycoplasma hyopneumoniae by using the method of the present invention are shown in table 5. The results show that: the mycoplasma hyopneumoniae separation efficiency can reach about 50%.
TABLE 5 Effect of the invention on isolation of Mycoplasma hyopneumoniae from porcine lung tissue
Positive for the +; -negative for PCR detection result; the number of + or-represents the content of the detected pathogen.
Sequence listing
<110> university of light industry in Wuhan
<120> a method for efficiently separating mycoplasma hyopneumoniae
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gcatctatat tttcgccaat agc 23
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
agctagagtt tcatcattac c 21
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ccttaaatat ttttaattgc atcctg 26
<210> 4
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cgcatgaaac ctattaaaat agctc 25
Claims (4)
1. A method for efficiently separating mycoplasma hyopneumoniae is characterized in that: the method comprises the steps of purifying and culturing mycoplasma hyopneumoniae by using a culture medium containing levofloxacin;
the concentration of the levofloxacin is 128 mug/mL, and the culture medium is a Friis culture medium;
the purification culture is to purify through subculture, the times of the subculture are six generations, and the transfer ratio is 1:10000-1:100000 in the fourth generation.
2. The method for efficiently isolating mycoplasma hyopneumoniae according to claim 1, wherein: the method comprises the following steps:
(1) After the samples from the lung tissues of the sick pigs suffering from respiratory diseases are treated, transferring the samples into a liquid culture medium containing levofloxacin for culture;
(2) After the sample in the step (1) is cultured for six days, transferring the first-generation culture to a new liquid culture medium containing levofloxacin for second-generation culture, coating a sixth-generation culture product on a solid culture medium containing levofloxacin, after a monoclonal is grown, picking a single colony by using an inoculating wire to streak on the solid culture medium, after a new single colony is grown, re-picking the single colony to streak, repeating for a plurality of times, and finally picking the monoclonal in the liquid culture medium, namely separating and purifying mycoplasma hyopneumoniae.
3. The method for efficiently isolating mycoplasma hyopneumoniae according to claim 2, wherein: the sample treatment described in step (1) is to place the sample in PBS, grind it after shearing, centrifuge, filter the supernatant with a filter to sterilize.
4. The method for efficiently isolating mycoplasma hyopneumoniae according to claim 1, wherein: the method comprises the following steps:
(1) Placing a sample of the lung tissue of a sick pig suffering from respiratory diseases into a 2mL centrifuge tube filled with PBS, shearing, grinding, centrifuging at 4 ℃ for 5min at 5000r/min, filtering and sterilizing the supernatant by using a 0.45 mu m filter, and transferring to a liquid culture medium containing 128 mu g/mL of levofloxacin for culture according to a ratio of 1:4;
(2) After six days of sample culture in step (1), transferring the first-generation culture into a liquid culture medium containing 128 mug/mL of levofloxacin at a ratio of 1:4 for second-generation culture, and so on; transferring the third-generation culture into a liquid culture medium containing 128 mug/mL of levofloxacin according to the ratio of 1:10000-1:100000 for six days when the third-generation culture is transferred to the fourth generation; transferring the fourth-generation culture into a new liquid culture medium containing 128 mug/mL of levofloxacin according to the ratio of 1:10, culturing for six days, and the like, coating the sixth-generation culture product onto a solid culture medium containing 128 mug/mL of levofloxacin, after a monoclonal is grown, picking a monoclonal on the solid culture medium by using an inoculating wire, streaking, after a new monoclonal is grown, re-picking the monoclonal, streaking, repeating for three times, and finally picking the monoclonal in the liquid culture medium, namely separating and purifying mycoplasma hyopneumoniae.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110792367.1A CN113444666B (en) | 2021-07-14 | 2021-07-14 | Method for efficiently separating mycoplasma hyopneumoniae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110792367.1A CN113444666B (en) | 2021-07-14 | 2021-07-14 | Method for efficiently separating mycoplasma hyopneumoniae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113444666A CN113444666A (en) | 2021-09-28 |
| CN113444666B true CN113444666B (en) | 2023-05-30 |
Family
ID=77816159
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110792367.1A Active CN113444666B (en) | 2021-07-14 | 2021-07-14 | Method for efficiently separating mycoplasma hyopneumoniae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113444666B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017856A (en) * | 2014-05-29 | 2014-09-03 | 山东省滨州畜牧兽医研究院 | Mycoplasma hyopneumoniae selective separation medium and preparation method thereof |
| CN108949623A (en) * | 2018-07-13 | 2018-12-07 | 北京农学院 | For separating and the solid medium for cultivating mycoplasma hyopneumoniae and preparation method thereof |
| CN111154696A (en) * | 2020-02-12 | 2020-05-15 | 石河子大学 | Mycoplasma hyopneumoniae culture medium and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI238721B (en) * | 2003-06-20 | 2005-09-01 | Animal Technology Inst Taiwan | Swine enzootic vaccine, its producing method and usage |
-
2021
- 2021-07-14 CN CN202110792367.1A patent/CN113444666B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017856A (en) * | 2014-05-29 | 2014-09-03 | 山东省滨州畜牧兽医研究院 | Mycoplasma hyopneumoniae selective separation medium and preparation method thereof |
| CN108949623A (en) * | 2018-07-13 | 2018-12-07 | 北京农学院 | For separating and the solid medium for cultivating mycoplasma hyopneumoniae and preparation method thereof |
| CN111154696A (en) * | 2020-02-12 | 2020-05-15 | 石河子大学 | Mycoplasma hyopneumoniae culture medium and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 猪肺炎支原体与猪鼻支原体分离鉴定及鉴别检测;李海利等;河南农业科学;第46卷(第11期);148-151 * |
| 阿奇霉素联合左氧氟沙星治疗肺炎支原体感染效果观察;蔡碧蓉;临床合理用药杂志;第13卷(第1A期);53-54 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113444666A (en) | 2021-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107312746B (en) | Large-scale full-suspension culture method for porcine circovirus type 2 | |
| AU2020100853A4 (en) | Proteus mirabilis phage rdp-sa-16033 and industrial production process thereof | |
| CN112779193B (en) | Virulent strain of mycoplasma synoviae and application thereof | |
| CN109913404A (en) | The preparation method of infections chicken cloacal bursa virus live vaccine | |
| CN113293143B (en) | Salmonella bacteriophage capable of reducing vertical transmission of salmonella pullorum and application thereof | |
| CN111481574A (en) | Combined phage preparation for treating piglet diarrhea | |
| KR940004541B1 (en) | Treponema hyodysenteriae bacterin and process for preparing thereof | |
| CN113444666B (en) | Method for efficiently separating mycoplasma hyopneumoniae | |
| CN114231499B (en) | Phage and application thereof | |
| CN113755368B (en) | Fujian chicken mycoplasma synoviae and culture medium thereof | |
| CN113322242B (en) | Multiple drug resistance coliphage and application thereof | |
| CN114958779A (en) | Bacteriophage LPCAP 6 capable of cracking clostridium perfringens and application | |
| CN114921420A (en) | Riemerella anatipestifer phage | |
| CN110527655B (en) | Duck-origin escherichia coli probiotic strain and screening preparation method and application thereof | |
| CN109602900A (en) | The preparation method and products thereof of chook MDV live vaccine | |
| CN113018425B (en) | Mycoplasma hyopneumoniae and haemophilus parasuis bivalent pentavalent inactivated vaccine and application thereof | |
| CN113018426B (en) | Combined strain for preparing haemophilus parasuis vaccine, octavalent inactivated vaccine and application thereof | |
| CN115851617B (en) | Coliphage LHE83 and application thereof | |
| WO2024032360A1 (en) | Lumpy skin disease virus strain, inactivated vaccine prepared from same, and method for preparing vaccine | |
| CN117737005B (en) | Porcine rotavirus strain and application thereof | |
| CN114940955B (en) | Mycoplasma gallisepticum attenuated vaccine strain and application thereof | |
| CN114921419B (en) | Richter duck plague bacillus phage | |
| CN117070476B (en) | Bovine herpesvirus 4 strain and application thereof in preparation of inactivated vaccine | |
| CN113444693B (en) | Combined fermentation process of bacteriophage and probiotics | |
| CN112831442B (en) | Serum 14 type haemophilus parasuis with cross protection and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |