CN113430282B - Kit and method for identifying zokor - Google Patents
Kit and method for identifying zokor Download PDFInfo
- Publication number
- CN113430282B CN113430282B CN202110944099.0A CN202110944099A CN113430282B CN 113430282 B CN113430282 B CN 113430282B CN 202110944099 A CN202110944099 A CN 202110944099A CN 113430282 B CN113430282 B CN 113430282B
- Authority
- CN
- China
- Prior art keywords
- zokor
- species
- identifying
- kit
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit and a method for identifying a zokor, and belongs to the technical field of identification. The kit comprises reagents for detecting the following SNP loci in the 16S rRNA gene of a species to be detected: the 34 th position of the conserved motif sequence shown in SEQ ID NO. 3. The kit for simply, conveniently and accurately identifying the species of the zokor and the method for identifying the zokor solve the problem of identifying the species of the zokor by morphology and have excellent application prospect in the species identification of the zokor.
Description
Technical Field
The invention belongs to the technical field of identification, and particularly relates to a kit and a method for identifying a zokor.
Background
Zokor is a collective term for animals of the subfamily zokorae (myopalacinae), and is mainly distributed in china and south siberian. Existing zokors include the genus pizokor (Eospalax) and the genus pizokor (myspaax), and nearly all of the current zokor species are distributed in our country. The zokor comprises 2-3 species such as grassland zokor (M.aspalax) and northeast zokor (M.psilurus), and the genus of the zokor is distributed only in China, and comprises 6 species such as Chinese zokor (E.fontaniri), stony zokor (E.smithi), rogowski zokor (E.rothskidi), highland zokor (E.baileyi), gansu zokor (E.cansus) and Qinling zokor (E.rufesciens).
The Luo's zokor is mainly distributed in the north of Hubei, east of Sichuan and south of Shaanxi in China. The zokor mainly inhabits the young forest land, nursery land, farming land and grass underground of the Huashan pine with the altitude of more than 1500 meters, and the arches nest and camp underground life. Zokor adult body length is 150-215 mm, and weight is 114-365 g. The body is thick and cylindrical, the capillary is dense, the base of Xia Mao is gray black, the hair tip is yellow, the adult body is brown yellow or rust red, and the hair color is gradually reduced from the body side to the abdomen. Some of the whole body is obviously rusty red on the back and both sides, the abdomen is gray black, and the hair tip part is slightly rusty red. The head is wide and flat, the nose tip is flat and blunt, the lower lip is milky white, most of the forehead has obvious white hair spots in the center, the eyes are very small, the earshells are undeveloped, and the nose is often covered under the villus. The limbs are short and thick, and have sharp claws, the front feet are developed more than the rear feet, and the front feet are bent outwards to form a sickle shape. The tail is short and small, the short hair is used, and the end part is white.
Zokor almost always lives in a closed underground tunnel system, and unique underground life modes enable zokor to have specificity in aspects of foraging, wedding, breeding and the like, so that the zokor is widely interested by scientists. Identification of biological species is the basis for understanding and protecting the diversity of organisms, and each organism can be studied in more fields only after being accurately identified. However, since different zokor living environments are similar and the shapes are convergent, species are very difficult to accurately identify through the shapes without professional training.
Therefore, research on a method and a reagent capable of rapidly and accurately identifying species of the zokor has very important significance.
Disclosure of Invention
The invention aims to provide a kit and a method for simply, conveniently and accurately identifying the species of zokor, and solve the problem of identifying the species of zokor by morphology.
The invention provides a kit for identifying a zokor, which comprises a reagent for detecting the following SNP loci in a 16S rRNA gene of a species to be detected: the 34 th position of the conserved motif sequence shown in SEQ ID NO. 3.
Further, the bases of the SNP sites are as follows: the 34 th base of the conserved motif sequence shown in SEQ ID NO. 3 is A.
Further, the reagent is a reagent for sequencing, a reagent for KASP method or a reagent for restriction fragment length polymorphism method.
Further, the kit also comprises a reagent for amplifying the conserved motif sequence of the 16S rRNA gene; the conserved motif sequence is shown as SEQ ID NO. 3.
Further, the reagent for amplifying the conserved motif sequence of the 16S rRNA gene comprises a primer pair shown in SEQ ID NO. 1-2.
The invention also provides application of a reagent for amplifying a 16S rRNA gene conserved motif sequence in preparation of a kit for identifying zokor, wherein the conserved motif sequence is a sequence shown in SEQ ID NO. 3.
Further, the reagent for amplifying the conserved motif sequence of the 16S rRNA gene comprises a primer pair shown in SEQ ID NO. 1-2.
The invention also provides a method for identifying the zokor, which comprises the following steps:
(1) Extracting total genome DNA of a zokor sample to be detected;
(2) The following SNP sites in the 16S rRNA gene sequence were detected: and (3) analyzing the 34 th position of the conserved motif sequence shown in SEQ ID NO. 3.
Further, the sample in the step (1) is a tissue sample or a blood sample;
and/or, the step of detecting in the step (2) is as follows:
1) Taking the DNA extracted in the step (1) as a template, and carrying out PCR amplification by using an amplification reagent to obtain an amplification product;
2) Performing agarose gel electrophoresis detection on the PCR amplification product obtained in the step 1);
3) Sequencing the PCR amplification product with a bright band at 1640bp in the detection result of the step 2) to obtain a 16S rRNA gene sequence;
4) Analyzing the following SNP loci in the 16S rRNA gene sequence obtained in the step 3): the 34 th position of the conserved motif sequence shown in SEQ ID NO. 3;
further, the amplification reagent in the step 1) comprises a primer pair shown in SEQ ID NO. 1-2; the annealing temperature of the PCR amplification is 52-56 ℃; the sequencing of step 3) is bidirectional Sanger sequencing.
Further, the analysis method in the step (2) comprises the following steps: if the base of the SNP locus is as follows, the zokor to be detected is a Luo zokor: the 34 th base of the conserved motif sequence shown in SEQ ID NO. 3 is A.
The invention has the beneficial effects that:
according to the invention, 1 specific SNP genotype of the species of the Zaocys is found in the 16S rRNA gene for the first time, the zokor to be detected can be judged to be the zokor by detecting the specific SNP genotype, the requirement on the sequencing length is low, and the judgment result is accurate and reliable.
The key point of the invention is that the relation between 1 SNP locus in the conserved motif sequence of the zokor 16S rRNA gene segment and the species of the zokor is found, and any reagent or equipment capable of detecting the base of the SNP locus can be used for species identification of the zokor on the basis.
Specifically, the present embodiments provide examples of detecting SNP sites by means of sequencing. The primer pair provided by the invention has good specificity, and PCR is performed by using the primer pair, so that non-specific amplification is not generated with DNA fragments except a target; the amplification target gene is a mitochondrial single copy gene, cloning is not needed, and the method can be directly used for sequencing and is simple. The invention also provides a 1-segment of the conserved motif sequence of the species of the zokor, which can assist in determining the position of the specific SNP locus of the species of the zokor in the 16S rRNA gene segment (DNA bar code) and is convenient for determining the genotype of the SNP locus.
It should be apparent that, in light of the foregoing, various modifications, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.
The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.
Drawings
FIG. 1 shows the sequencing peak pattern (motif sequence) of the PCR product of the zokor 16S rRNA gene numbered ZBX-4 in example 3.
FIG. 2 shows a sequence of the zokor 16S rRNA gene PCR product sequencing peak (motif position sequence) numbered LD-3 in example 3.
Detailed Description
For a clearer understanding of the present invention, the present invention will now be further described with reference to the following examples and drawings. The examples are for illustration only and are not intended to limit the invention in any way.
Experimental methods for which specific conditions are not noted in the examples are conventional methods and conventional conditions well known in the art, or conditions according to manufacturer's recommendations; the various chemical reagents used in the examples are commercially available and the primers used were designed for the synthesis.
Example 1A kit for differentiating Luo zokor according to the invention
The kit comprises the following components:
(1) PCR amplification reagent: a primer pair comprising SEQ NO. 1-2; (2) reagents for sequencing.
Example 2 PCR primer design and verification of SNP site
According to the invention, mitochondrial genome sequences of 121 zokor individuals of 8 zokor species are compared, and 1 zokor species-specific SNP genotype of the 16S rRNA gene is found, and conserved sequences exist at two ends of the SNP locus, so that the 16S rRNA gene fragment is determined to be a zokor species identification DNA bar code.
8 zokor species 121 zokor individuals: wherein 12 grasslands zokor, 10 northeast zokor, 15 Chinese zokor, 18 stoneware zokor, 16 rosis zokor, 14 plateau zokor, 24 Gansu zokor and 12 Qinling zokor are provided.
The 16S rRNA gene sequence was designed as follows:
ME16S-1L：AGAGGAGATAAGTCGTAACAAGGT(SEQ ID NO:1)；
ME16S-1R：TCCTGATCCAACATCGAGGT(SEQ ID NO:2)。
amplifying DNA samples of different zokor species by using the primers, and confirming the following SNP sites of the 16S rRNA gene for identification of the zokor species:
the 391 base (34 base of SEQ ID NO:3 conserved motif sequence) genotype of the zokor amplification product is A, and the genotypes of other zokor species at the site are T/C.
SEQ ID NO. 3 sequence is: CCCGAAACCAAACGAGCTACCTAAGAACAATTTAT.
The results prove that the base of the specific SNP locus is different from other zokors in the zokor, and the zokor can be identified by detecting the specific SNP locus.
Example 3, identification of species of the zokor
First, a 16S rRNA primer pair was synthesized:
ME16S-1L：AGAGGAGATAAGTCGTAACAAGGT(SEQ ID NO:1)；
ME16S-1R：TCCTGATCCAACATCGAGGT(SEQ ID NO:2)。
the identification is carried out by adopting the following method:
a) Extracting total genome DNA of zokor muscle Tissue with the number of ZBX-4, total genome DNA of zokor liver Tissue with the number of DLL-5 and total genome DNA of zokor liver Tissue with the number of LD-3 respectively by using a Kanji DNeasy Blood & Tissue Kit;
b) Taking the total genome DNA in the step a) as a template, and carrying out PCR reaction by utilizing the 16S rRNA primer pair, wherein the zokor group reaction system with the number of ZBX-4 is 50 mu L, and the annealing temperature is 52 ℃; 25 mu L of a zokor group reaction system with the number of DLL-5 and annealing temperature of 56 ℃; 25 mu L of a zokor reaction system with the number of LD-3 and an annealing temperature of 55 ℃;
c) Detecting the PCR product obtained in the step b) by 1% agarose gel electrophoresis, and observing a bright band of about 1460 bp;
d) Performing bidirectional Sanger sequencing on the PCR product in the step c) to obtain a 16S rRNA gene sequencing peak diagram;
e) The conserved motif sequence of SEQ ID NO. 3 is found in the obtained sequencing peak diagram, and SNP locus bases are analyzed.
The results were as follows:
(1) Zokor numbered ZBX-4:
the 34 th base in the sequence of SEQ ID NO. 3 is A (figure 1), namely, the zokor with the number ZBX-4 is judged to be the Luo zokor.
(2) Zokor numbered DLL-5:
the 34 th base in the sequence of SEQ ID NO. 3 is A, namely, the zokor numbered DLL-5 is judged to be the Luo zokor.
(3) Zokor numbered LD-3:
the 34 th base in the sequence of SEQ ID NO. 3 is T, and is not A (figure 2), namely, the zokor with the number LD-3 is judged not to be the Luo zokor.
In addition, zokor numbered ZBX-4, DLL-5 and LD-3 were identified by conventional morphological identification.
ZBX-4 and DLL-5 have small body size, the front paws are obviously delicate, the nose pad is in a shape of a cap, and the tails are dense; the occipital portion of the skull is raised, the zygomatic arch is expanded, the top ridges are parallel and are not close to the middle joint, the occipital portion is folded inwards and close to the forehead, the anterior and developed supraorbital ridges are combined, the incisor holes are surrounded by the anterior jawbone and the maxilla, and the zokor with the numbers ZBX-4 and DLL-5 is proved to be the Luo zokor.
While LD-3 has large body size, oval nose pad, longer tail, and thin white hair; occipital bulge of skull, expansion of zygomatic arch, parallel top ridge, fold inward near forehead, combine with developed supraorbital ridge, developed occipital ridge, incisor hole surrounded by anterior and maxilla, third upper molar (M 3 ) The absence of backward extending leaves indicates that it is a Gansu zokor, not a Luo zokor.
The experimental results show that the method for identifying the zokor is accurate and can be practically used for identifying and detecting the species of the zokor.
In conclusion, the kit for simply, conveniently and accurately identifying the species of the zokor and the method for identifying the zokor are provided, the problem of zokor species identification through morphology is solved, and the kit has excellent application prospect in zokor species identification.
SEQUENCE LISTING
<110> national academy of sciences northwest high Protozoa institute
<120> kit and method for identifying zokor
<130> GY417-2021P0113583CC
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 24
<212> DNA
<213> artificial sequence
<400> 1
agaggagata agtcgtaaca aggt 24
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
tcctgatcca acatcgaggt 20
<210> 3
<211> 35
<212> DNA
<213> artificial sequence
<400> 3
cccgaaacca aacgagctac ctaagaacaa tttat 35
Claims (2)
1. A method for identifying a rogowski zokor, the method being capable of being used to identify a rogowski zokor from: grassland zokor, northeast zokor, chinese zokor, stony zokor, plateau zokor, gansu zokor, qinling zokor, the method comprising the steps of:
(1) Extracting total genome DNA of a zokor sample to be detected;
(2) Detecting SNP loci in a 16S rRNA gene sequence, and if the bases of the SNP loci are as follows, detecting the zokor to be detected as the Luo zokor: the 34 th base of the conserved motif sequence shown in SEQ ID NO. 3 is A.
2. The method of claim 1, wherein the sample of step (1) is a tissue sample or a blood sample.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110944099.0A CN113430282B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor |
| NL2032311A NL2032311B1 (en) | 2021-08-17 | 2022-06-28 | Kit and method for identifying eospalax rothschildi |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110944099.0A CN113430282B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113430282A CN113430282A (en) | 2021-09-24 |
| CN113430282B true CN113430282B (en) | 2023-09-22 |
Family
ID=77797705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110944099.0A Active CN113430282B (en) | 2021-08-17 | 2021-08-17 | Kit and method for identifying zokor |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN113430282B (en) |
| NL (1) | NL2032311B1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151542B (en) * | 2021-03-18 | 2023-05-05 | 西南林业大学 | Development method and application of Huashansong genome SNP |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113430281B (en) * | 2021-08-17 | 2024-02-06 | 中国科学院西北高原生物研究所 | Kit and method for identifying species of zokor with raised cranium |
-
2021
- 2021-08-17 CN CN202110944099.0A patent/CN113430282B/en active Active
-
2022
- 2022-06-28 NL NL2032311A patent/NL2032311B1/en active
Non-Patent Citations (3)
| Title |
|---|
| Eospalax rothschildi mitochondrion, complete genome;NCBI;NCBI;第1-2页 * |
| 高原鼢鼠DNA条形码筛选;王缠等;草业科学;第37卷(第12期);第1-10页 * |
| 鼢鼠属凸颅亚属(Eospa...ax)的分类研究及一新亚种;李保国等;动物学报;第35卷(第1期);第1-7页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113430282A (en) | 2021-09-24 |
| NL2032311B1 (en) | 2023-03-14 |
| NL2032311A (en) | 2023-02-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112029872B (en) | SNP (Single nucleotide polymorphism) marker related to fine wool sheep wool character and detection primer group, kit, detection method and application thereof | |
| US11306365B1 (en) | Molecular marker C42257 for rapidly identifying genetic sex of Marsupenaeus japonicus and applications thereof | |
| CN105950742B (en) | A method of identification ovine growth character is assisted based on rs417014745 SNP site | |
| CN111088370B (en) | Sex-specific molecular marker primer for Trachinotus ovatus, identification method and application of sex-specific molecular marker primer | |
| CN113913538A (en) | SNP molecular marker related to chicken carcass traits and application | |
| CN113430282B (en) | Kit and method for identifying zokor | |
| CN113430281B (en) | Kit and method for identifying species of zokor with raised cranium | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| NL2032209B1 (en) | Kit and method for identifying eospalax smithi | |
| CN105483281B (en) | It is a kind of to be used to identify glutinous No. 1 SNP marker of five firework of waxy corn Shanghai and its identification method | |
| CN110607376A (en) | Patinopecten yessoensis living body sex identification method based on DNA molecular marker | |
| CN113444814B (en) | Kit and method for identifying Chinese zokor | |
| CN113637769B (en) | Kit and method for identifying northeast zokor | |
| CN106048003A (en) | Method for assisting in identifying sheep growth characters based on rs430810656 SNP locus | |
| CN107177698B (en) | Primer, kit and method for paternity test of deer animals | |
| CN109234412A (en) | The quickly method of the fast erythroculter ilishaeformis of the detection speed of growth and molecular labeling used | |
| CN113444812B (en) | Kit and method for identifying zokor in Qinling mountain | |
| CN113462790B (en) | Kit and method for identifying highland zokor | |
| CN113637770B (en) | Kit and method for identifying grassland zokor | |
| CN113444813B (en) | Kit and method for identifying Gansu zokor | |
| CN109880915A (en) | One kind SNP site relevant to the high character of donkey body and its application | |
| CN116516026B (en) | Molecular marker related to antibody titer of broiler chickens, detection method and application | |
| CN109735646A (en) | A kind of CAPS molecular labeling and method and its application for identifying rice varieties | |
| CN117363753A (en) | SNP molecular marker related to growth traits and related method and application thereof | |
| Khan et al. | Sex determination by CHD (Chromo helicase DNA binding) gene in local rock pigeons (Columba livia) from Lahore, Pakistan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |