CN113416751A

CN113416751A - Ac96 inactivated baculovirus vector

Info

Publication number: CN113416751A
Application number: CN202110742717.3A
Authority: CN
Inventors: 不公告发明人
Original assignee: Shaanxi Bacmid Biological Technology Co ltd
Current assignee: Shaanxi Bacmid Biological Technology Co ltd
Priority date: 2021-07-01
Filing date: 2021-07-01
Publication date: 2021-09-21
Anticipated expiration: 2041-07-01
Also published as: CN113416751B

Abstract

The invention discloses a gene inactivation type baculovirus expression vector. The non-essential gene Ac96 of the baculovirus vector is inactivated, so that the expression level of foreign protein is obviously improved. Meanwhile, the proliferation characteristics of the virus are not changed obviously. The improvement of the expression yield can reduce the production cost of enterprises, and the inactivation of Ac96 can improve the biological safety of the recombinant baculovirus. The baculovirus vector can be used in the field of biological product industry.

Description

Ac96 inactivated baculovirus vector

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a gene-inactivated baculovirus vector.

Background

Baculovirus is a double-stranded DNA virus that specifically infects arthropods, and Autographa californica nuclear polyhedrosis virus (AcMNPV) is a model species of baculovirus. Since Smith GE, etc. expressed human interferon-beta gene in insect cells with baculovirus for the first time in 1983 (Mol Cell biol. 1983; 3: 2156-65), baculovirus expression vector systems have been widely used in research and production due to their low cost, high yield, and various post-translational modification systems.

However, the yield of baculovirus expression vector systems is less than satisfactory than the prokaryotic expression systems (E.coli, B.subtilis) and yeast expression systems which are commonly used in industry. For this purpose, various strategies have been adopted to increase the yield of the expression system, including:

1. the promoter and surrounding elements are modified. For example, GFP production can be increased 4.4-fold by concatenating the p6.9 and p10 promoters (PLoS ONE 2014; 9(5): e 96562.); a repeat of the Burst sequence downstream of the polh promoter increased the GUS enzyme activity by 1.5-fold (Biotechnol Bioeng. 2010; 107: 909-16.).

2. Constructing an anti-apoptotic vector or cell line. Sf-caspase-1 dsRNA is expressed in insect cells Sf9 by using an RNA interference vector, so that the Sf-caspase-1 in the cells can be successfully silenced, and the yield of foreign proteins is remarkably improved (Biotechnol Appl biochem, 2007; 48: 11-19.). Zhang Xiaoyue et al cloned the double-stranded small RNA coding sequence targeting Sf-caspase-1 directly into the baculovirus genome, increasing the expressed luciferase activity by 10-fold (BMC Biotechnol. 2018; 18: 24.).

3. Knocking out non-essential genes. For example, the knock-out of chitinase and cathepsin (ChiA/V-Cath) contributes to the increased expression of secreted proteins (J Virol methods, 2004; 122: 113-118.); on the basis, three continuous non-essential genes p26, p10 and p74 are knocked out, so that the yield of the EGFP can be increased by 2.6 times (Cell Biol Toxicol. 2010; 26: 57-68.).

The mechanism of knocking out non-essential genes to improve the yield of foreign genes is diverse. The degradation of protein can be reduced by knocking out a cathepsin (V-Cath) gene; knock-out p10 may release intracellular transcriptional resources late in infection.

In addition, knockout of non-essential genes can also reduce the size of the baculovirus genome, facilitating the accommodation of larger foreign DNA fragments. Wild-type baculoviruses are capable of inserting up to about 40kb of foreign DNA fragments, and if multiple proteins are expressed with one recombinant virus or another viral vector is loaded with a baculoviral vector, the 40kb space is often too open to the elbow. If more space can be released by knocking out genes, the application range of the baculovirus expression vector can be greatly expanded.

The inventors found, by searching the literature, that a large number of non-essential genes, including Ac96, were present in the baculovirus genome.

Ac96 encodes a protein with a molecular weight of 19.8 kDa containing 173 amino acids (PIF-4), is Ac96 an oral infectious agent, is a protein identified in the fourth AcMNPV genome, and is present in all baculovirus genomes. Baculovirus knock-out of this gene replicates in cell lines but not in insects (J Virol. 2009;83: 12569-78.).

Downstream of Ac96 is a potential gene Ac97, which may encode a protein with a molecular weight of 6.5 kDa consisting of 56 amino acids. This potential gene appears to be present only in AcMNPV, and the absence of a homologous gene in BmNPV indicates that the gene is not a functional gene. Even in AcMNPV, some whole genome sequencing results did not label it as a potential gene, such as KM667940, further indicating that it is not a functional gene.

Overall, Ac96 (including Ac 97) is a non-essential gene of baculovirus, at least two genes do not exhibit important functions when replicated in insect cell lines. The effect of deletion of these genes on the expression level of foreign genes and the proliferation of viruses have not been noticed. In addition, deletion of Ac96 can prevent the virus from infecting insects, and can increase the biological safety of the recombinant baculovirus.

Disclosure of Invention

The present invention aims to provide a gene-deleted baculovirus vector, which aims to solve the problems of low expression level and low foreign DNA fragment capacity mentioned in the background technology.

The invention obtains a baculovirus vector with high foreign protein yield by inactivating Ac96 gene.

The invention obtains a baculovirus vector with high foreign protein yield by simultaneously inactivating Ac96-97 genes.

The invention is realized by knocking out Ac96 fragment from the baculovirus vector by using homologous recombination or gene editing and other technologies, thus obtaining the baculovirus vector with Ac96 inactivated.

The method is realized by knocking out an Ac96 fragment and an Ac97 and Ac96 overlapping sequence from the baculovirus vector by using homologous recombination or gene editing and other technologies, and the baculovirus vector with Ac96-97 inactivated is obtained.

Or when the baculovirus vector is synthesized, the baculovirus vector does not contain Ac96 gene, namely, the baculovirus vector with Ac96 and Ac96-97 inactivated is obtained.

Or carrying out base deletion, insertion and replacement on promoter regions and/or coding regions and/or 3' non-coding regions of Ac96 and Ac97 genes to ensure that the genes lose the original activity, namely obtaining the baculovirus vector with Ac96 or Ac96-97 inactivated.

Another objective of the invention is to provide a recombinant baculovirus, which is obtained by recombining the Ac96 or Ac96-97 inactivated baculovirus vector with a DNA fragment with a foreign sequence.

The invention also aims to provide a recombinant protein, wherein the gene-inactivated baculovirus vector is used for constructing a recombinant virus, and then insect host cells are infected and expressed into the recombinant protein, so that the recombinant protein is obtained.

According to determination, the proliferation curve of the recombinant baculovirus constructed by the gene inactivation type baculovirus vector is not obviously different from that of a wild type vector. The expression level of the exogenous recombinant protein of the gene inactivation type baculovirus is obviously higher than that of the control vector.

After the Ac96 gene is inactivated, the protein expression level is obviously improved, and the proliferation level of the virus is not influenced. Thus, the present invention provides a baculovirus expression vector having excellent production characteristics and high productivity.

In addition, baculovirus with the gene knocked out cannot replicate in insects, and the biological safety of baculovirus expression vectors is improved.

Another object of the present invention is to provide the use of the gene-inactivated baculovirus expression vector in the bioproduct industry.

Drawings

FIG. 1 is a schematic diagram of a gene knockout strategy for baculovirus vectors provided by the present invention.

FIG. 2 is a primary growth curve of Bacmid Δ Ac96 baculovirus vectors provided by the present invention. Compared with the wild-type vector, the Ac96 knockout did not significantly affect the virus proliferation.

FIG. 3 is a green fluorescent protein GFP expressed using the Bacmid Δ Ac96 baculovirus vector provided by the present invention. Cells 4 days after virus infection were subjected to SDS-polyacrylamide gel electrophoresis and stained with Coomassie blue.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.

1. Knock-out of Ac96 gene.

The knockout strategy is detailed in FIG. 1. A rpsL-AMP expression cassette with an Ac96 homologous arm is amplified by a PCR technique using a primer with an Ac96 gene upstream and downstream 54bp homologous arm and a prpsL-AMP plasmid (the report of university of agriculture and forestry, Nature science, 2015, 12 months, volume 43, page 181-190) as a template. The primer sequences used in this step are as follows:

Ac96U: ttggctatcgtgtttgtacttttcgtgttaatttatttaataatttcgatcaaagatggcctggtgatgg

Ac96D: aaacattatggattacgaacaatattttattaaataaaaatataaactctattcttaccaatgcttaatc。

the obtained PCR product (about 1.5kb in size) was electrically transformed into E.coli HS996 containing Bacmid Bac10: KO1629 (Nucleic Acids Research, 2003, Vol. 31, number 2 e 6), the pSC101-BAD-gbaA plasmid was induced by arabinose to express RedET recombinase, homologous recombination was achieved in E.coli, and positive clones were obtained by ampicillin resistance screening (see GENE BRIDGES Co., Counter-Selection BAC Modification Kit). After PCR identification and sequencing identification, Bacmid with the Ac96 fragment replaced by rpsL-AMP is obtained and named Bacmid-Ac 96.

To remove the selection marker rpsL-AMP expression cassette, a further counter-selection was required.

A108 bp reverse-screening replacement sequence was amplified in a PCR instrument using the following primers:

Ac96f: ttggctatcgtgtttgtacttttcgtgttaatttatttaataatttcgatcaaagaatagagtttatattttta

Ac96r: aaacattatggattacgaacaatattttattaaataaaaatataaactctattc。

the amplification product of the obtained reverse-screening replacement sequence is electrically transformed into Escherichia coli HS996 containing Bacmid-Ac96:, rpsL-AMP is used for inducing pSC101-BAD-gbaA plasmid to express RedET recombinase through arabinose, homologous recombination is realized in Escherichia coli, resistant colonies on background bacterial lawn are selected through streptomycin resistance screening, and positive clones are obtained (see the instruction of Counter-Selection BAC Modification Kit of GENE BRIDGES company). After PCR identification and sequencing identification, Bacmid knocked out by the Ac96 fragment is obtained and named as Bacmid delta Ac 96. This was the Ac96 knockout baculovirus expression vector.

E.coli HS996 containing Bacmid delta Ac96 is enlarged and then Bacmid delta Ac96 is extracted by a baculovirus shuttle vector Bacmid miniprep kit (product of Biyunshi), and then the Bacmid delta Ac96 is cut and linearized by Bsu36I restriction enzyme. The linearized Bacmid delta Ac96 was extracted with phenol-chloroform, and after removal of proteins, was dissolved in sterile water for use.

2. Recombinant viruses were constructed.

Linearized wild-type Bacmid (Bac 10: KO 1629) and Ac96 knock-out Bacmid were co-transfected with pTriEx-GFP plasmid (GFP gene fragment cloned between pTriEx1.1 NcoI/XhoI sites) into Sf9 insect cells, and recombinant viruses of P0 generation were collected 5 days after transfection. Sf9 cells were infected with the appropriate amount of P0 virus, and 4 days after transfection, P1 virus was collected.

3. Viral proliferation profile.

Sf9 cells were infected at 0.1 MOI with control recombinant virus and Ac96 knock-out recombinant virus, after which samples were taken every 24 hours until 144 hours post-infection. The virus titer was determined by quantitative PCR and a primary virus growth curve was plotted (FIG. 2). Compared to wild-type virus, Ac96 knockout virus has similar viral proliferation properties as the control virus. In other words, knock-out of Ac96 did not significantly affect viral replication.

4. The recombinant protein is expressed.

Sf9 cells and High Five cells were infected with recombinant virus at 3 MOI and cells were harvested on the fourth day after infection. After cell lysis, SDS-polyacrylamide gel electrophoresis and Coomassie blue staining were performed (FIG. 3). Compared with wild virus vectors, the expression level of the exogenous recombinant protein GFP is remarkably improved in both Sf9 cells and High Five cells. Since the knock-out virus staining signal was too strong to assess the yield exactly by density scanning, the expression of GFP was observed to increase several-fold in both Sf9 cells and High Five cells.

GFP produces both an observable fluorescent signal and is not cytotoxic, and therefore is a commonly used reporter protein in the field of protein expression. The increase of the expression level of GFP in this example indicates that the Ac96 knockout recombinant virus has good recombinant protein expression characteristics. By utilizing the high-yield characteristic, any protein product and subunit vaccine can be expressed with high efficiency.

From the above experiments, it can be seen that Ac96 knockout does not affect virus proliferation, but greatly improves the yield of foreign proteins. Moreover, Ac96 knock-out also reduced the viral genome by 0.6kb, increasing the capacity of the viral vector. And as an oral infection factor, the Ac96 knockout can also increase the biological safety of baculovirus expression vectors. Compared with the prior art, the method has outstanding substantive features and remarkable progress.

The expression of the green fluorescent protein GFP described above is only an example of the present invention, and is not intended to limit the present invention. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

It is additionally noted that the current view is that Ac97 is not a functional gene, and its open reading frame overlaps with the carboxy-terminus of the coding region of the Ac96 gene. In this example, the Ac96 is knocked out, and the Ac97 open reading frame is also damaged, so that Ac96-97 can be considered to be knocked out at the same time.

Claims

1. A baculovirus vector comprising an Ac96 gene inactivated in the baculovirus vector.

2. A baculovirus vector comprising an Ac96-97 gene inactivated in the baculovirus vector.

3. A recombinant virus constructed using the baculovirus vector of any one of claims 1-2.

4. A recombinant protein obtained by constructing a recombinant virus using the baculovirus vector of any one of claims 1-2, then infecting cells and expressing as a recombinant protein.

5. Use of the baculovirus vector of any one of claims 1-2 in the bioproduct industry.