CN113403408A - Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing - Google Patents

Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing Download PDF

Info

Publication number
CN113403408A
CN113403408A CN202110658131.9A CN202110658131A CN113403408A CN 113403408 A CN113403408 A CN 113403408A CN 202110658131 A CN202110658131 A CN 202110658131A CN 113403408 A CN113403408 A CN 113403408A
Authority
CN
China
Prior art keywords
species
data
sequencing
identification
sequences
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202110658131.9A
Other languages
Chinese (zh)
Inventor
姜帆
王超楠
朱水芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chinese Academy of Inspection and Quarantine CAIQ
Original Assignee
Chinese Academy of Inspection and Quarantine CAIQ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chinese Academy of Inspection and Quarantine CAIQ filed Critical Chinese Academy of Inspection and Quarantine CAIQ
Publication of CN113403408A publication Critical patent/CN113403408A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Abstract

The invention relates to a species identification technology, in particular to a pathogenic microorganism multiple amplification kit and a method based on high-throughput sequencing, which are characterized in that the kit comprises a bacteria universal primer. The universal primer combinations are used for carrying out single-tube multiplex amplification on a sample to be detected, so that the target species can be amplified as much as possible, and meanwhile, the amplified fragments have enough variation to distinguish different species, so that the universal primer combinations are the basis for high-throughput sequencing and species analysis.

Description

Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing
Technical Field
The invention relates to a species identification technology, in particular to a pathogenic microorganism multiple amplification kit and a method based on high-throughput sequencing.
Background
With the rapid development of global trade and the increasing international communication, the work of entry and exit inspection and quarantine meets the unprecedented challenge, and the port work faces a plurality of problems such as large traffic, insufficient personnel, lack of appraisal experts and the like at present. How to ensure the quality of inspection and quarantine, shorten the inspection and quarantine period and accelerate the clearance speed becomes a big problem, so a new quarantine identification technology is required to be provided.
DNA barcode technology is a new technology for species identification using one or several standard, easily amplifiable DNA fragments with interspecies differences larger than intraspecies differences, originally proposed by Hebert, a Canada scholarly. Compared with the traditional classification identification technology, the DNA barcode technology has the advantages of simple operation, no limitation of individual development stage and morphological characteristics and the like, so that people without species classification identification knowledge can identify the species through the technology. Once the technology is provided, the technology quickly becomes a core method of molecular taxonomy and molecular identification technology, and plays an important role in biological species identification. However, conventional DNA barcode technology usually identifies only one or a few species at a time, and cannot rapidly analyze millions of gene sequences and identify thousands of species at a time. In most cases, the sample to be tested is usually a mixture of a plurality of different species, especially pathogenic microorganisms, so there is an increasing need to identify multiple species in the mixed sample at the same time.
The high-throughput sequencing technology can simultaneously obtain the DNA sequence of each species in a sample, has the advantages of high sequencing throughput, high speed, low cost and the like, and is widely applied to various fields of biosafety, medicine, health and the like in recent years. In the process of identifying species by applying a high-throughput sequencing technology, a universal primer is firstly needed to amplify genetic materials of a sample to be detected, the quality (universality, sensitivity and the like) of the universal primer determines the degree of mining species existing in the sample to be detected, and subsequent sequencing results and analysis results are determined, so that in order to promote high-quality application of the high-throughput sequencing technology in species identification, a technology matched with the high-throughput sequencing technology needs to be developed.
Disclosure of Invention
Based on the needs in the field, the invention provides a microorganism species identification kit and a method based on high-throughput sequencing, and the technical scheme is as follows:
1. a microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3221F:ACGGHCCARACTCCTACGGAA；
796R:CTACCMGGGTATCTAATCCKG。
2. a microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3222F:ACGGHCCARACTCCTACGGRA；
796R:CTACCMGGGTATCTAATCCKG。
3. a microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3221F:ACGGHCCARACTCCTACGGAA；
3222F:ACGGHCCARACTCCTACGGRA；
796R:CTACCMGGGTATCTAATCCKG。
4. the kit for identifying a microbial species according to any one of the preceding claims, further comprising at least one pair of fungal universal primers. On the basis of the bacterial universal primer designed by the invention, the kit of the invention can also be added with a fungal universal primer, and the added fungal universal primer can be known in the field.
5. The microbial species identification kit is characterized in that the fungus universal primer is
ITS1F：CTYGGTVATTTAGAGGAAGTAA，
ITS4:TCCTCCGCTTATTGATATGC。
6. A method of identifying a microbial species, comprising the steps of:
(1) extracting nucleic acid:
extracting DNA from the material suspected to contain fungi or bacteria by preliminary judgment;
extracting RNA from the material suspected to contain the virus by preliminary judgment;
extracting RNA and DNA from materials which are preliminarily judged to be various or unclear in microorganism types;
(2) siRNA sequencing is carried out on the extracted RNA to obtain siRNA sequencing data;
adding all the universal primers in any one of the kits into the extracted DNA in the same reaction tube for PCR multiple amplification;
(3) sequencing the amplification products to construct library data; such as Illumina Miseq paired-end sequencing; siRNA sequencing is carried out on the extracted RNA to obtain siRNA sequencing data;
(4) the library data and siRNA sequencing data are processed and analyzed to obtain an identification result indicating the number of classes of species contained in the sample to be tested at the phylum, class, order, family, genus and species level, and the major species contained therein.
7. The method for identifying a microbial species according to the foregoing, characterized in that: the PCR multiplex amplification adopts the following system:
2 XPCR buffer 12.5. mu.l; mu.l of each 10 mu mol/L primer; 1. mu.l of template DNA; the volume of the sterile water is fixed to 25 mu l;
the reaction conditions adopted by the PCR multiplex amplification are as follows:
94 ℃ for 5 min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 deg.C, 10 min.
8. The method for identifying a microbial species according to claim 6 or 7,
wherein processing library data refers to filtering out adaptors, rejecting low quality sequences, chimeric sequences and overly short sequences, to obtain a collection of effective sequences for subsequent analysis; performing classification operation, namely OTU clustering analysis on the set of the effective sequences to obtain data for analysis;
wherein CutAdapt software is adopted to filter the joint;
OTU clustering analysis is carried out by using CD-hit, Ucluster, BLAST, mothur, usearch or prefix/suffix;
and preprocessing siRNA sequencing data, namely assembling the siRNA sequencing data to obtain a virus contig and a viroid gene group, and acquiring preprocessing data for subsequent analysis.
9. The method for identifying a microbial species according to the foregoing, characterized in that,
wherein, the analysis refers to BLAST comparison of the preprocessed data with a reference sequence database of known species to obtain the classification quantity of phyla, class, order, family, genus and classification level related to the species in the sample to be tested and the main species type in the samples;
wherein the database of reference sequences of known species comprises one or more of BOLD, NT, UNITE, RDP, Sliva or GreenGene, NT, NR.
10. The method for identifying a microbial species as described above, wherein the processing and analysis of the library data is performed using a species identification system,
the species identification system comprises a remotely accessible server; the server comprises a data preprocessing module and a species identification module;
wherein the species identification module is provided with a eukaryote identification unit, a prokaryote identification unit and a virus identification unit; wherein a database of reference sequences of known species that are related to eukaryotic identification units and that can be called for BLAST alignment comprises BOLD, NT; reference sequence databases of known species that are related to the prokaryotic identification unit and that can be called for BLAST alignment include BOLD, NT, UNITE, RDP, Sliva, or GreenGene; reference sequence databases of known species that are related by viroid identification units and can be called for BLAST alignment include NT, NR;
the data processing pre-module is used for calling a nucleic acid sequence data processing tool according to a user data analysis starting instruction to pre-process sequencing data provided by a user to obtain pre-processed data;
pre-processing of sequencing data from PCR amplicons, comprising
Removing joints, and eliminating low-quality sequences, chimeric sequences and over-short sequences to obtain a set of effective sequences for subsequent analysis; and performing classification operation, namely OTU clustering analysis, on the set of effective sequences to obtain the preprocessed data, wherein the preprocessed data comprise representative sequencing sequences representing species contained in the sample;
pre-processing sequencing data from the siRNA, comprising assembling the siRNA sequencing data to obtain a viral contig and a viroid genome group, to obtain the pre-processed data comprising representative sequencing data of the viroid species contained in the sample;
species identification of the pre-processed data: matching all the preprocessed data with a eukaryote identification unit, a prokaryote identification unit and a virus identification unit in a species identification module, and carrying out BLAST comparison on a plurality of representative sequencing sequences matched with the units and a known species reference sequence database stored locally or associated online in different identification units at the same time to obtain the identification result.
The invention develops the bacterial universal primer with ideal amplification efficiency and the combination of the bacterial universal primer and the fungal universal primer for species identification based on high-throughput sequencing, and develops a multiple detection method on the basis. The universal primer combinations are used for carrying out single-tube multiplex amplification on a sample to be detected, so that the target species can be amplified as much as possible, and meanwhile, the amplified fragments have enough variation to distinguish different species, so that the method is the basis for subsequent high-throughput sequencing and subsequent species analysis.
In the kit and the method, under the condition that the species group to be identified in the article is definite, the known nucleic acid extraction technology aiming at different groups is adopted for extraction; in cases where the species group to be identified in the quarantine item is unknown, nucleic acids are simultaneously extracted using commercial DNA and RNA co-extraction kits. The sequencing technology, data processing and analysis used in the method can be completed based on known technology, and in the data processing and analysis, the species identification system developed by the applicant in the previous period can be adopted to directly obtain the identification result in one step.
Drawings
FIG. 1 is a schematic diagram of the site attempted in the present invention for designing a bacterial universal primer
FIG. 2 is a gel detection chart of PCR amplification products of the universal primers for bacteria in the present invention
FIG. 3 is a dilution chart comparing the sequencing results of different universal primers amplifying the same sample,
wherein the abscissa represents the amount of randomly drawn sequencing data; the ordinate represents the number of species observed (Sobs), showing that under the same sequencing number, the amplification results of the bacterial universal primers 3222F/796R and 3221F/796R provided by the invention can obtain more species than the amplification results of the known universal primer 341F _806R, and the 3222F/796R is better than 3221F/796R.
FIG. 4 is a diagram for analyzing species identification results of amplification products of the bacterial universal primers provided by the present invention at the genus classification level
FIG. 5 analysis of species identification results of amplification products of the bacterial universal primers provided by the present invention at the classification level of species
FIG. 6 is a schematic view of a species identification system employed in a preferred embodiment of the present invention.
Detailed Description
Without limiting the scope of protection of the invention, some exemplary embodiments of the method and system of the invention are described in connection with the accompanying drawings.
Example 1 primers used in the present invention
TABLE 1 entrusted Synthesis
Figure BDA0003114085580000051
Designing or selecting bacterial primers: designing primers on different regions of the 16S rRNA gene of the plant pathogenic bacteria, evaluating the universality of the primers, and selecting the primers capable of amplifying species sequences in a sample to the maximum extent.
Through design and screening, 3221F/796R and 3222F/796R have better universality than the known universal primer 341F/806R.
Example 2 comparison of bacterial Universal primers
Experimental materials: the experimental materials used in the research are derived from tobacco leaves, cucumber leaves cultured in a laboratory, and cucumber leaves, citrus leaves, corn leaves, pepper fruits and tomato plants collected in the field.
The experimental procedure was as follows:
1. sample processing
100mg of mixed plant sample is taken and added with liquid nitrogen for full grinding.
2. Extraction of nucleic acids
The ground powder was quickly transferred to a centrifuge tube pre-filled with 700 μ L of 65 ℃ pre-heated buffer GP1 (mercaptoethanol was added to pre-heated GP1 to a final concentration of 0.1% before the experiment), the mixture was quickly inverted and mixed, and then the centrifuge tube was placed in a 65 ℃ water bath for 20min, and the centrifuge tube was inverted during the water bath to mix the samples several times.
Add 700. mu.L chloroform, mix well and centrifuge at 12,000rpm for 5 min.
Carefully transfer the upper aqueous phase obtained in the previous step into a new centrifuge tube, add 700. mu.L of buffer GP2, and mix well.
The mixed solution was transferred to an adsorption column CB3, centrifuged at 12,000rpm for 30 seconds, and the waste solution was discarded.
To adsorption column CB3, 500. mu.L of buffer GD (to which absolute ethanol should be checked before use) was added, centrifuged at 12,000rpm for 30 seconds, discarded, and adsorption column CB3 was put into the collection tube.
To the adsorption column CB3, 700. mu.L of a rinsing solution PW (to check whether or not absolute ethanol is added before use) was added, centrifuged at 12,000rpm for 30 seconds, discarded, and the adsorption column CB3 was put into a collection tube.
To the adsorption column CB3, 500. mu.L of the rinsing solution PW was added, centrifuged at 12,000rpm for 30 seconds, the waste liquid was discarded, and the adsorption column CB3 was put into a collection tube.
The adsorption column CB3 was returned to the collection tube, centrifuged at 12,000rpm for 2min, and the waste liquid was discarded. The adsorption column CB3 was left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material.
Transferring the adsorption column CB3 into a clean EP tube, suspending and dropwise adding 50 mu L ddH to the middle part of the adsorption column2O, standing at room temperature for 5min, centrifuging at 12,000rpm for 2min, collecting in EP tubeThe extracted DNA solution.
PCR amplification
PCR amplification was performed using primer 1, primer 2, and primer 3 of Table 1, respectively.
And (3) PCR reaction system: 2 XPCR buffer 12.5. mu.l; primers (10. mu. mol/L) were each 1. mu.l; 1 μ l of template DNA; the volume of the sterile water is adjusted to 25 mu l.
And (3) PCR reaction conditions: 94 ℃ for 5 min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 deg.C, 10 min.
The PCR reaction was detected by agarose gel electrophoresis, as shown in FIG. 2, lanes 3, 4, and 5 correspond to primers 1, 2, and 3, respectively.
And (3) sending the amplified PCR product to Shanghai Meiji biological medicine science and technology limited for Illumina Miseq sequencing.
The off-line Data is Raw Data, clear Data is obtained after Data filtering, and the Data filtering comprises the following specific steps: removing low-quality data according to a window; removing reads containing joints; removing the reads containing N; and fourthly, removing low-complexity reads.
After clear Read is obtained, paired reads obtained by double-end sequencing are assembled into a sequence by utilizing the overlap relation, and the seeds are spliced by using software FLASH2(Fast Length Adjustment of Short reads, v1.2.11), so that Tags are obtained. Removing reads without overlap relation, and performing primer removal treatment on the Tags to finally obtain Clean Tags. The sequence splicing conditions are as follows: setting the minimum matching length as 15 bp; ② the mismatching rate of the overlapping area is not more than 0.1.
Performing classification operation, namely OTU clustering analysis on the set of the effective sequences to obtain the preprocessed data; and comparing the preprocessed data with a reference sequence database of known species to obtain an Alpha diversity result.
The sequencing analysis results were as follows:
(1) alpha diversity analysis
Figure BDA0003114085580000071
Simpson: one of the indices used to estimate the microbial diversity in a sample is commonly used in ecology to quantitatively describe the biological diversity of an area. The larger the Simpson index value, the lower the community diversity.
Shannon: is used to estimate one of the indices of microbial diversity in the sample. It is similar to Simpson diversity index and is often used to reflect community alpha diversity. The larger the Shannon value, the higher the community diversity.
Coverage: refers to the coverage of each sample library, with higher values indicating higher probability of sequence being measured in the sample and lower probability of not being measured. The index reflects whether the sequencing result represents the true condition of the microorganism in the sample.
ace and chao: to estimate the number of OTUs in the sample.
(2) Dilution Curve analysis
The graph is produced using an R language tool.
The dilution curve of the analysis results is shown in FIG. 3, with the abscissa representing the amount of randomly drawn sequencing data; ordinate, number of species observed (Sobs)
The dilution curve (Rarefection curve) is mainly constructed by using the microorganism Alpha diversity index of each sample at different sequencing depths, so as to reflect the microorganism diversity of each sample at different sequencing quantities.
The method can be used for comparing the abundance, the uniformity or the diversity of species in samples with different sequencing data volumes, and can also be used for explaining whether the sequencing data volume of the samples is reasonable or not. The dilution curve adopts a method of randomly sampling sequences, and the Rarefection curve is constructed by the number of the extracted sequences and the number of corresponding species (such as OTU) or diversity index. If the diversity index is sobs (which characterizes the number of species actually observed), when the curve tends to be flat, it indicates that the sequencing data volume is reasonable, and a larger data volume only generates a small amount of new species (e.g., OTU), otherwise, it indicates that more new species (e.g., OTU) may be generated by continuing the sequencing. In the case of other diversity indices (e.g., Shannon-Wiener curve), the curve tends to be flat, indicating that the amount of sequencing data is large enough to reflect the diversity information of most microorganisms in the sample.
When the sequencing depth is increased and the tail end is flattened, the sequencing data volume is reasonable, and a small amount of new OTU can be generated by more data volume. The samples above are more abundant in species than the samples below. In the results of the present invention, as in fig. 3, the richness of the 3222F _796R sample is the highest, and the richness of the 341F _806R sample is the lowest
(3) Species Venn plot analysis
Species Venn plot analysis was performed on the sequencing results.
The Venn graph can be used for counting the number of common and unique species (such as OTU) in a plurality of groups or a plurality of samples, and the similarity and the overlapping condition of the species (such as OTU) composition of the environmental samples can be visually represented. Typically, a sample table of OTU or other taxonomic levels with a similarity level of 97% is used for the analysis.
R language (version 3.3.1) tool statistics and mapping.
As shown in FIGS. 4 and 5, the amplification efficiency was the best with the primer 3222F/796R, the depth of the sequence that could be obtained with this primer was the best, and the species information obtained was more abundant.
Example 3 identification of pathogenic microorganisms carried by common field crops
Experimental materials: collecting flower melon leaves, tomato leaves, pepper leaves and eggplant leaves from the Mitsubishi Shuihoucun field vegetable field in Beijing. .
The experimental procedure was as follows:
co-extraction of DNA and RNA
(1) Weighing 2g of plant seeds, grinding the plant seeds into powder in liquid nitrogen, transferring the plant seed powder into 1.5mL centrifuge tubes, wherein the plant sample powder in each centrifuge tube with the volume of 1.5mL is less than or equal to 100mg in order to ensure the subsequent nucleic acid extraction quality. Then 500. mu.L of CPL buffer (20. mu.L of 2-mercaptoethanol per 1mL of CPL buffer mixed before use, the mixture can be stored at room temperature for 1 month), and water bath at 55 ℃ for 10min is added into each 1.5mL centrifuge tube.
(2) 500. mu.L of chloroform was added thereto, and the mixture was centrifuged at 13,000 Xg for 5min with shaking for 30 seconds.
(3) Transferring 350 mu L of supernatant into a new centrifuge tube, adding 350 mu L of PR buffer solution into the centrifuge tube, shaking and uniformly mixing, transferring the mixed solution to a DNA adsorption column (the DNA adsorption column is placed into a 2mL collection tube), centrifuging for 1min at 10,000 Xg, placing the DNA adsorption column at room temperature or 4 ℃ for subsequent DNA extraction, and using eluent for subsequent RNA extraction.
DNA extraction
(4) The DNA adsorption column obtained in (3) was put into a new 2mL centrifuge tube, 500. mu.L of DNA washing buffer was added to the DNA adsorption column, centrifugation was carried out at 10,000 Xg for 1min, and the filtrate was discarded.
(5) mu.L of DNA washing buffer was added to the DNA adsorption column, centrifuged at 14,000 Xg for 2min, and the filtrate was discarded. The centrifugation time can be appropriately prolonged to ensure thorough drying of the DNA adsorption column.
(6) Putting the DNA adsorption column into a new 1.5mL centrifuge tube, suspending and dripping 50-100 mu L of TE buffer solution into the middle of the adsorption membrane, standing at room temperature for 2min, centrifuging at 10,000 Xg for 2min, eluting the DNA into the centrifuge tube, subpackaging, marking, and storing at-80 ℃ for later use.
RNA extraction
(7) And (4) adding absolute ethyl alcohol with the volume of 0.5 time that of the eluent into the eluent obtained in the step (3), and gently mixing the mixture.
(8) mu.L of the resulting solution (7) was transferred to an RNA adsorption column (the RNA adsorption column was placed in a 2mL collection tube), centrifuged at 10,000 Xg for 1min, and the filtrate was discarded.
(9) The remaining (7) liquid was transferred to an RNA adsorption column, centrifuged at 10,000 Xg for 1min, and the filtrate was discarded.
(10) Add 500. mu.L of RWC wash buffer to the RNA adsorption column, centrifuge at 10,000 Xg for 1min, and discard the filtrate.
(11) To the RNA adsorption column was added 500. mu.L of RNA washing buffer II (corresponding amount of absolute ethanol was added as specified before use), centrifuged at 10,000 Xg for 1min, and the filtrate was discarded.
(12) mu.L of RNA washing buffer II was added to the RNA adsorption column, centrifuged at 10,000 Xg for 2min, and the filtrate was discarded. The centrifugation time can be appropriately prolonged to ensure thorough drying of the RNA adsorption column.
(13) Putting the RNA adsorption column into a new 1.5mL centrifuge tube, suspending and dripping 40-70 mu L DEPC (diethyl pyrocarbonate) elution buffer solution into the middle of the adsorption membrane, standing at room temperature for 2min, centrifuging at 14,000 Xg for 1min, and eluting the RNA into the centrifuge tube.
(14) To increase the RNA concentration, the centrifuged RNA was again aspirated, and the RNA was placed in an RNA adsorption column and centrifuged at 14,000 Xg for 1min at room temperature for 2 min.
(15) RNA is eluted into a centrifuge tube, subpackaged, marked and stored at-80 ℃ for later use.
PCR amplification
3222F-796R in example 1, and ITS1F-ITS4 were used
PCR amplification System (25. mu.L)
mu.L of the total amplification system was Mix 12.5. mu.L, primers (10. mu. mol/L) 1. mu.L each, and template DNA 2. mu. L, ddH2O 6.5.5. mu.L.
The multiplex amplification conditions were 94 ℃ for 3min, 35 cycles of 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 30s, and 72 ℃ for 5 min.
PCR product detection and purification, see SN/T4278 "detection of PCR product" implementation.
And (3) determining the concentration of the PCR product: detecting the concentration and quality of PCR product with DNA concentration analyzer, respectively measuring the absorption values of sample solution at 260nm, 280nm, 230nm and 270nm with DNA dissolving solution as reference, and calculating A260/A280，A260/A230，A260/A270A DNA sample satisfying the following conditions at the same time can be regarded as genomic DNA of high quality: a. the260/A280Is 1.8 to 1.9, A260/A230＞2.0，A260/A2701.1 to 1.3. Using A260The DNA concentration was calculated for 1-50. mu.g/mL of double-stranded DNA, and the total amount of DNA in the PCR product was 2. mu.g or more and the concentration was 50 ng/. mu.L or more.
4. High throughput sequencing
The PCR product and RNA obtained above were submitted to America biomedical science and technology, Inc. of Shanghai for high throughput sequencing (Illumina misseq sequencing).
5. The sequencing data was submitted to the species identification system of the invention (as shown in FIG. 6) for the following:
preprocessing the sequencing data to obtain preprocessed data
Pre-processing of sequencing data from PCR amplicons, comprising
Removing joints, and eliminating low-quality sequences, chimeric sequences and over-short sequences to obtain a set of effective sequences for subsequent analysis; performing classification operation, namely OTU clustering analysis on the set of the effective sequences to obtain the preprocessed data;
species identification of the pre-processed data: and matching all the preprocessed data with a eukaryote identification unit, a prokaryote identification unit and a virus identification unit in a species identification module, and carrying out BLAST comparison on the preprocessed data matched with the unit and a known species reference sequence database stored locally or associated online in different identification units to obtain a species identification result.
Clustering was performed at 97% similarity.
The identification results are as follows:
30 plant pathogenic fungi of 63 genera, 15 plant pathogenic bacteria of 64 genera, and 3 plant viruses were detected.
Figure BDA0003114085580000111
Figure BDA0003114085580000121
The kit and the method can identify a plurality of pathogenic microorganisms such as bacteria, fungi, viruses and the like at the same time, and the universal primers have good universality and specificity.

Claims (10)

1. A microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3221F:ACGGHCCARACTCCTACGGAA；
796R:CTACCMGGGTATCTAATCCKG。
2. a microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3222F:ACGGHCCARACTCCTACGGRA；
796R:CTACCMGGGTATCTAATCCKG。
3. a microbial species identification kit based on high-throughput sequencing is characterized by comprising bacterial universal primers:
3221F:ACGGHCCARACTCCTACGGAA；
3222F:ACGGHCCARACTCCTACGGRA；
796R:CTACCMGGGTATCTAATCCKG。
4. the microbial species identification kit of any one of claims 1-3, further comprising at least one pair of fungal universal primers. On the basis of the bacterial universal primer designed by the invention, the kit of the invention can also be added with a fungal universal primer, and the added fungal universal primer can be known in the field.
5. The microorganism species identification kit according to claim 4, wherein the fungus universal primer is
ITS1F：CTYGGTVATTTAGAGGAAGTAA，
ITS4:TCCTCCGCTTATTGATATGC。
6. A method of identifying a microbial species, comprising the steps of:
(1) extracting nucleic acid:
extracting DNA from the material suspected to contain fungi or bacteria by preliminary judgment;
extracting RNA from the material suspected to contain the virus by preliminary judgment;
extracting RNA and DNA from materials which are preliminarily judged to be various or unclear in microorganism types;
(2) siRNA sequencing is carried out on the extracted RNA to obtain siRNA sequencing data;
adding all the universal primers in the kit of any one of claims 1-6 into the extracted DNA in the same reaction tube for PCR multiple amplification;
(3) sequencing the amplification products to construct library data; such as Illumina Miseq paired-end sequencing; siRNA sequencing is carried out on the extracted RNA to obtain siRNA sequencing data;
(4) the library data and siRNA sequencing data are processed and analyzed to obtain an identification result indicating the number of classes of species contained in the sample to be tested at the phylum, class, order, family, genus and species level, and the major species contained therein.
7. The method for identifying a microbial species according to claim 6, wherein: the PCR multiplex amplification adopts the following system:
2 XPCR buffer 12.5. mu.l; mu.l of each 10 mu mol/L primer; 1. mu.l of template DNA; the volume of the sterile water is fixed to 25 mu l;
the reaction conditions adopted by the PCR multiplex amplification are as follows:
94 ℃ for 5 min; 94 ℃, 30s, 55 ℃, 30s, 72 ℃, 30s, 35 cycles; 72 deg.C, 10 min.
8. The method for identifying a microbial species according to claim 6 or 7,
wherein processing library data refers to filtering out adaptors, rejecting low quality sequences, chimeric sequences and overly short sequences, to obtain a collection of effective sequences for subsequent analysis; performing classification operation, namely OTU clustering analysis on the set of the effective sequences to obtain data for analysis;
wherein CutAdapt software is adopted to filter the joint;
OTU clustering analysis is carried out by using CD-hit, Ucluster, BLAST, mothur, usearch or prefix/suffix;
and preprocessing siRNA sequencing data, namely assembling the siRNA sequencing data to obtain a virus contig and a viroid gene group, and acquiring preprocessing data for subsequent analysis.
9. The method for identifying a microbial species according to claim 8,
wherein, the analysis refers to BLAST comparison of the preprocessed data with a reference sequence database of known species to obtain the classification quantity of phyla, class, order, family, genus and classification level related to the species in the sample to be tested and the main species type in the samples;
wherein the database of reference sequences of known species comprises one or more of BOLD, NT, UNITE, RDP, Sliva or GreenGene, NT, NR.
10. The method of claim 6, wherein the processing and analyzing of the library data is performed using a species identification system,
the species identification system comprises a remotely accessible server; the server comprises a data preprocessing module and a species identification module;
wherein the species identification module is provided with a eukaryote identification unit, a prokaryote identification unit and a virus identification unit; wherein a database of reference sequences of known species that are related to eukaryotic identification units and that can be called for BLAST alignment comprises BOLD, NT; reference sequence databases of known species that are related to the prokaryotic identification unit and that can be called for BLAST alignment include BOLD, NT, UNITE, RDP, Sliva, or GreenGene; reference sequence databases of known species that are related by viroid identification units and can be called for BLAST alignment include NT, NR;
the data processing pre-module is used for calling a nucleic acid sequence data processing tool according to a user data analysis starting instruction to pre-process sequencing data provided by a user to obtain pre-processed data;
pre-processing of sequencing data from PCR amplicons, comprising
Removing joints, and eliminating low-quality sequences, chimeric sequences and over-short sequences to obtain a set of effective sequences for subsequent analysis; and performing classification operation, namely OTU clustering analysis, on the set of effective sequences to obtain the preprocessed data, wherein the preprocessed data comprise representative sequencing sequences representing species contained in the sample;
pre-processing sequencing data from the siRNA, comprising assembling the siRNA sequencing data to obtain a viral contig and a viroid genome group, to obtain the pre-processed data comprising representative sequencing data of the viroid species contained in the sample;
species identification of the pre-processed data: matching all the preprocessed data with a eukaryote identification unit, a prokaryote identification unit and a virus identification unit in a species identification module, and carrying out BLAST comparison on a plurality of representative sequencing sequences matched with the units and a known species reference sequence database stored locally or associated online in different identification units at the same time to obtain the identification result.
CN202110658131.9A 2020-06-12 2021-06-15 Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing Pending CN113403408A (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2020105327833 2020-06-12
CN202010532783 2020-06-12

Publications (1)

Publication Number Publication Date
CN113403408A true CN113403408A (en) 2021-09-17

Family

ID=77683779

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110658131.9A Pending CN113403408A (en) 2020-06-12 2021-06-15 Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing

Country Status (1)

Country Link
CN (1) CN113403408A (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101514362A (en) * 2008-12-12 2009-08-26 上海市农业科学院 Mark of Ganoderma subamaboinense seed strain or fruiting body molecule thereof, and acquisition method and application thereof
CN101880729A (en) * 2010-08-06 2010-11-10 复旦大学附属华山医院 Detection method and kit for microfluidic high-throughput of pathogenic fungi
CN106244699A (en) * 2016-08-23 2016-12-21 上海华点云生物科技有限公司 Identify that the multiple PCR primer of antibacterial is to combination and authentication method
US20170020138A1 (en) * 2013-06-26 2017-01-26 Symbiota, Inc. Agricultural endophyte-plant compositions, and methods of use
CN108277296A (en) * 2018-04-17 2018-07-13 中国农业科学院植物保护研究所 A kind of identification of the Fusarium strain for causing root rot and differentiating method
CN109750113A (en) * 2017-11-01 2019-05-14 中国科学院微生物研究所 A method of parsing endophytic bacterium flora
CN110218780A (en) * 2019-06-13 2019-09-10 湖北邦之德牧业科技有限公司 A method of objective microbe improves its physical and chemical index and safety during controlling fermenting plant protein using high-flux sequence
CN110343754A (en) * 2019-08-15 2019-10-18 深圳谱元科技有限公司 A method of it is quickly detected for hematopoietic stem cell transplantation donor pathogenic microorganism
CN110387438A (en) * 2019-07-08 2019-10-29 广东省公共卫生研究院 Multi-primers, kit and method for enterovirus high-flux sequence

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101514362A (en) * 2008-12-12 2009-08-26 上海市农业科学院 Mark of Ganoderma subamaboinense seed strain or fruiting body molecule thereof, and acquisition method and application thereof
CN101880729A (en) * 2010-08-06 2010-11-10 复旦大学附属华山医院 Detection method and kit for microfluidic high-throughput of pathogenic fungi
US20170020138A1 (en) * 2013-06-26 2017-01-26 Symbiota, Inc. Agricultural endophyte-plant compositions, and methods of use
CN106244699A (en) * 2016-08-23 2016-12-21 上海华点云生物科技有限公司 Identify that the multiple PCR primer of antibacterial is to combination and authentication method
CN109750113A (en) * 2017-11-01 2019-05-14 中国科学院微生物研究所 A method of parsing endophytic bacterium flora
CN108277296A (en) * 2018-04-17 2018-07-13 中国农业科学院植物保护研究所 A kind of identification of the Fusarium strain for causing root rot and differentiating method
CN110218780A (en) * 2019-06-13 2019-09-10 湖北邦之德牧业科技有限公司 A method of objective microbe improves its physical and chemical index and safety during controlling fermenting plant protein using high-flux sequence
CN110387438A (en) * 2019-07-08 2019-10-29 广东省公共卫生研究院 Multi-primers, kit and method for enterovirus high-flux sequence
CN110343754A (en) * 2019-08-15 2019-10-18 深圳谱元科技有限公司 A method of it is quickly detected for hematopoietic stem cell transplantation donor pathogenic microorganism

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LUCAS SINCLAIR ET AL.: "Microbial Community Composition and Diversity via 16S rRNA Gene Amplicons: Evaluating the Illumina Platform", 《PLOS ONE》 *
MIYO NAKANO ET AL.: "16S rRNA Gene Primer Validation for Bacterial Diversity Analysis of Vegetable Products", 《JOURNAL OF FOOD PROTECTION》 *
冯岩等: "中国番木瓜枯萎病病原菌的首次鉴定", 《植物检疫》 *
范晓攀等: "肉类调理食品中细菌多样性的分析", 《现代食品科技》 *

Similar Documents

Publication Publication Date Title
CN108642208B (en) General SSR molecular marker for cinnamomum and related plants and development method and application thereof
CN111554349B (en) Species identification system and method based on high-throughput sequencing
CN113699220A (en) Method for identifying honey and tracing honey producing area by regional plant sources
CN111916151B (en) Traceability detection method and application of verticillium wilt of alfalfa
CN111718928A (en) Polygonatum sibiricum chloroplast DNA extraction optimization method
CN109371110B (en) LAMP (loop-mediated isothermal amplification) detection kit for bacterial canker pathogen of poplar
CN111321242A (en) Rapid molecular detection method and application of rubber tree anthracnose pathogen Siamese anthrax
CN111534631A (en) 2 SNP molecular markers related to oil content of oil-tea camellia kernel and application thereof
CN113403408A (en) Pathogenic microorganism multiplex amplification kit and method based on high-throughput sequencing
CN114032326B (en) DNA bar code for screening yellow-green stropharia rugoso-annulata with high antioxidant activity
CN115960902A (en) CRISPR-Cas system-based primer for detecting various mycoplasmas, crRNA and application of CRISPR-Cas system-based primer
CN113201599B (en) Method for detecting pathogens infected with cerebrospinal fluid based on PCR and nanopore sequencing
WO2019117704A1 (en) Methods for detecting pathogenicity of ganoderma sp.
CN105567814B (en) It quickly distinguishes the randomly amplified polymorphic DNA method in imitative stichopus japonicus source place and realizes the primer of the method
CN111996274B (en) Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing
KR102147340B1 (en) A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same
EP2471955B1 (en) Organism-specific hybridisable nucleic acid molecule
KR102147327B1 (en) A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same
KR102147412B1 (en) A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same
KR102147351B1 (en) A composition for detecting Ganoderma microorganism and diagnosing basal stem rot and a method using the same
CN112680542B (en) Universal SSR molecular marker primer composition for orchidaceae plants and application of universal SSR molecular marker primer composition
CN112795660B (en) Reference gene for stable expression of lygus lucorum under different factors and application thereof
CN110501414B (en) Identification model, construction method and application of VIM type and SPM type metalloenzyme pseudomonas aeruginosa
CN116904620B (en) Primer group, kit and method for rapidly detecting rice pathogenic bacteria based on MNP
CN110093447B (en) SCAR molecular marker for identifying traditional Chinese medicine rhizoma drynariae and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20210917