CN113403291A - Aldol oxidase dimer and preparation method thereof - Google Patents
Aldol oxidase dimer and preparation method thereof Download PDFInfo
- Publication number
- CN113403291A CN113403291A CN202110689676.6A CN202110689676A CN113403291A CN 113403291 A CN113403291 A CN 113403291A CN 202110689676 A CN202110689676 A CN 202110689676A CN 113403291 A CN113403291 A CN 113403291A
- Authority
- CN
- China
- Prior art keywords
- petduet
- oxidase
- nucleotide sequence
- dimer
- txac
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03041—Alditol oxidase (1.1.3.41)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Abstract
The invention discloses an aldol oxidase dimer and a preparation method thereof, and the aldol oxidase dimer is obtained by carrying out fusion expression on SpyTag, a p53dim structural domain, aldol oxidase and Spycatcher in a gene fusion mode, wherein the aldol oxidase dimer remarkably improves the oxidation capacity of glycerol, and the catalytic efficiency of other sugar alcohol substrates is generally improved by 10-24 times.
Description
Technical Field
The invention relates to the field of protein engineering and enzyme engineering, in particular to an aldol oxidase dimer with improved enzyme activity and a preparation method thereof.
Background
Aldol oxidase (EC 1.1.3.41, AldO) is a soluble monomeric flavin-dependent oxidase. Its main function is to catalyze the selective oxidation of the terminal primary hydroxyl groups of various alditols to obtain aldehydes or acids, so that the alditol oxidase can be used for producing polyalcohols. The aldol oxidase has a huge application prospect in the industrial field of biocatalytic conversion of glycerol, the AldO can directly convert the glycerol to obtain glyceric acid with high added value, and the glyceric acid has important application value as a novel acidifier and a medical intermediate.
The best substrates of the existing aldol oxidase are xylitol and sorbitol, but the oxidation capacity of the existing aldol oxidase to glycerol is obviously weaker than the best substrates. It has been a hot topic to study the oxidation mechanism of alditol oxidase for the catalytic oxidation of alditol substrates. At present, some reports about improving the catalytic activity of aldolase on glycerol exist, but most of the reports focus on site-specific mutation of an active pocket part, and the reports of methods capable of remarkably improving the enzyme activity on the glycerol are few. As reported in Gerstenbruch et al, Asymmetric synthesis of d-glycerol acid by an alditol oxidase and directed evolution for enhanced oxidative activity over viruses, a tetra-mutant strain was obtained by directed evolution of aldol A3(2), which has been found to have an enzymatic activity on glycerol of 0.185U/mg to 0.624U/mg, but still at a lower level, compared to the wild-type aldol oxidase.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide an aldol oxidase dimer and a preparation method thereof, wherein the oxidation capacity of the aldol oxidase dimer on glycerol is remarkably improved, and the catalytic efficiency on other sugar alcohol substrates is generally improved by 10-24 times.
An aldol oxidase dimer, the nucleotide sequence of which is shown in SEQ ID NO. 1.
A method for preparing an aldol oxidase dimer, comprising the steps of:
(1) the gene SpyTag/SpyCatcher is fused with the p53dim gene and then is connected with a vector to obtain a recombinant plasmid pETDuet-TXC, the nucleotide sequence of the SpyTag/SpyCatcher from Streptococcus pyogenes is shown as SEQ ID No.4, and the nucleotide sequence of the p53 dimerization domain from the tumor suppressor is shown as SEQ ID No. 3;
(2) plasmid pETDuet-AldO is taken as a template, the nucleotide sequence is SEQ ID NO.2, P1 and P2 are taken as primers to amplify to obtain a target gene fragment containing AldO,
the P1 nucleotide sequence is: GAGCTCATGAGCGACATCACCGTTAC, respectively;
the P2 nucleotide sequence is: GTCGACAGAACCTGAGCCTGAGCCCGCCAGCACACCGCGC, respectively;
(3) connecting the target fragment AldO to the plasmid pETDuet-TXC by enzyme digestion connection by taking the plasmid pETDuet-TXC as a template to obtain a recombinant plasmid pETDuet-TXC;
(4) the recombinant plasmid pETDuet-TXAC is transformed into Escherichia coli JM109, after screening of a positive transformant by colony PCR, a genetically engineered bacterium pETDuet-TXAC JM109 is obtained, and then the recombinant plasmid pETDuet-TXAC is transformed into E.coli BL21(DE3) to obtain a genetically engineered bacterium pETDuet-TXAC BL21 (DE);
(5) inoculating a genetically engineered bacterium pETDuet-TXAC BL21(DE) into a TB liquid culture medium, and culturing at 37 ℃, 200 and 220rpm for 12-16 h; transferring the strain into a TB culture medium according to the inoculation amount of 1-2%, culturing for 3-5h at 30 ℃ and 200-220rpm until the optical density value at 600nm reaches 0.4-0.8, adding isopropyl beta-D-1-thiogalactopyranoside (IPTG) with the final concentration of 1mM for induction, and culturing for 20-24h at 16-18 ℃ and 200-220 rpm;
(6) centrifuging the fermentation liquor at 10000rpm and 4 ℃ for 10min, collecting the precipitate, and resuspending the thallus by using a resuspension solution, wherein the resuspension solution comprises the following components: 20mM Na2HPO420mM imidazole, 500mM NaCl, 1mM DTT, 0.5mM PMSF and pH 7.4, then carrying out ultrasonication and centrifugation, obtaining supernatant which is crude enzyme liquid of the aldehyde-alcohol oxidase dimer, and purifying by adopting Ni-NTA affinity chromatography and SEC two steps to obtain the aldehyde-alcohol oxidase dimer cataAldO.
The invention also aims to provide a construction method of the gene engineering bacteria for expressing the aldol oxidase dimer, which comprises the following construction steps:
(1) the gene SpyTag/SpyCatcher is fused with the p53dim gene and then is connected with a vector to obtain a recombinant plasmid pETDuet-TXC, the nucleotide sequence of the SpyTag/SpyCatcher from Streptococcus pyogenes is shown as SEQ ID No.4, and the nucleotide sequence of the p53 dimerization domain from the tumor suppressor is shown as SEQ ID No. 3;
(2) plasmid pETDuet-AldO is taken as a template, the nucleotide sequence is SEQ ID NO.2, P1 and P2 are taken as primers to amplify to obtain a target gene fragment containing AldO,
the P1 nucleotide sequence is: GAGCTCATGAGCGACATCACCGTTAC, respectively;
the P2 nucleotide sequence is: GTCGACAGAACCTGAGCCTGAGCCCGCCAGCACACCGCGC, respectively;
(3) connecting the target fragment AldO to the plasmid pETDuet-TXC by enzyme digestion connection by taking the plasmid pETDuet-TXC as a template to obtain a recombinant plasmid pETDuet-TXC;
(4) the recombinant plasmid pETDuet-TXAC is transformed into Escherichia coli JM109, after screening of positive transformants by colony PCR screening, genetic engineering bacteria pETDuet-TXAC JM109 are obtained, and then the recombinant plasmid pETDuet-TXAC is transformed into E.coli BL21(DE3), so that the genetic engineering bacteria pETDuet-TXAC BL21(DE) for expressing the aldol oxidase dimer is obtained.
The invention has the beneficial effects that:
according to the invention, the method for constructing the aldol oxidase dimer by adopting protein engineering draws the spatial distance of different functional structural domains of aldol oxidase closer, so that the oxidation capacity of the aldol oxidase on glycerol is obviously improved, and the catalytic efficiency of the aldol oxidase on other sugar alcohol substrates is generally improved by 10-24 times. The aldolase gene used in the invention is derived from Streptomyces coelicolor A3(2), has wide pH adaptation range and high stability (the pH adaptation range is 6-9, the optimum reaction pH range is 7-8, and the optimum reaction temperature is 55 ℃).
Drawings
FIG. 1 is an SDS-PAGE electrophoresis of the catAldO protein of the embodiment of the invention, M: Marker; lane 1 crude enzyme solution; lane 2, Ni-NTA purified sample; lane 3 purification of cataAldO by SEC.
FIG. 2 is a reaction kinetic curve of the cat AldO catalysis of glycerol (A), D-sorbitol (B), D-mannitol (C), arabinose (D) and 1, 2-propanediol (E) in the embodiment of the invention.
Detailed Description
The present invention is described in detail below with reference to examples, which are intended to be illustrative only and are not to be construed as limiting the scope of the invention, and any methods and materials similar or equivalent to those described herein can be used in the present invention.
The media used in the examples of this application are the following:
LB culture medium: 5g/L of yeast extract, 10g/L of tryptone and 10g/L of NaCl.
TB culture medium: 24g of yeast extract, 12g of peptone and 4g of glycerol are dissolved in distilled water and the volume is adjusted to 900mL to obtain solution A. Weighing 12.54g K2HPO4And 2.31g KH2PO4Adding distilled water to dissolve and fixing the volume to 100mL to be liquid B. Sterilizing the two solutions at high temperature, cooling to room temperature, and mixing solution A and solution B in sterile workbench.
The solid culture medium is liquid culture medium added with 2% agar.
Example 1: construction of recombinant plasmids
(1) Plasmid pETDuet-TXC was constructed by sending the SpyTag gene sequence with accession number 4MLS _ B, the Spycatcher gene sequence with accession number AFD50637.1 and the p53dim gene in tandem to the company for total synthesis at NCBI. The nucleotide sequence of the streptococcus pyogenes derived SpyTagSpycatcher is shown as SEQ ID NO.4, and the nucleotide sequence of the tumor suppressor derived p53 dimerization domain is shown as SEQ ID NO. 3.
(2) PCR is carried out by taking plasmid pETDuet-AldO preserved in a laboratory as a template and taking nucleotide sequences of SEQ ID NO.2, P1 and P2 as primers, and a gene fragment containing aldO derived from Streptomyces coelicolor A3(2) of Streptomyces coelicolor is obtained by PCR amplification. The PCR amplification system is as follows: template 1. mu.L, upstream and downstream primers 1. mu.L each, PrimerSTAR 25. mu.L, ddH2O 22. mu.L. The PCR conditions were: 94 ℃ for 5min, 94 ℃ for 30s, 55 ℃ for 30s, 72 ℃ for 90s, 72 ℃ for 5min, 30 cycles. And after the PCR product gel is recovered, carrying out gel recovery again by adopting Sal I and Sac I double enzyme digestion to obtain a target fragment. Plasmid pETDuet-TXC is used as a template, and Sal I and Sac I double-enzyme gel cutting is adopted for recovery to obtain the skeleton. Adding 2 μ L of skeleton, 1.5 μL target fragment, 1 μ L T4 buffer，0.5μL T4 ligase、5μL ddH2O was attached overnight in a metal bath at 16 ℃. Coli JM109 was transformed and positive transformants were screened by colony PCR. And (3) selecting 2 positive transformants, inoculating the transformants into an LB liquid culture medium, culturing for 12h at 37 ℃, and transferring the transformants to Shanghai workers for sequencing, wherein the sequencing is correct, so that the construction of the genetically engineered bacterium pETDuet-TXAC is successful. The recombinant plasmid pETDuet-TXAC was transformed into E.coli BL21(DE 3). After screening positive transformants, the genetically engineered bacterium pETDuet-TXAC BL21(DE) was obtained.
Primer Table I
| Primer name | Sequence of |
| P1 | GAGCTCATGAGCGACATCACCGTTAC |
| P2 | GTCGACAGAACCTGAGCCTGAGCCCGCCAGCACACCGCGC |
Example 2: fermentation and purification of aldol oxidase dimer enzyme
(1) The genetically engineered bacterium pETDuet-TXAC BL21(DE) finally obtained in example 1 is inoculated into a TB liquid culture medium containing 10 mu g/mL ampicillin and cultured for 12-16h at 37 ℃ and 200-220 rpm; transferring the 1-2% inoculum size into TB liquid culture medium containing 10. mu.g/mL ampicillin, culturing at 30 deg.C and 200-220rpm for 3-5h until the optical density value at 600nm reaches 0.4-0.8, adding isopropyl beta-D-1-thiogalactopyranoside (IPTG) with final concentration of 1mM for induction, and culturing at 16-18 deg.C and 200-220rpm for 20-24 h.
(2) Centrifuging the fermentation liquor at 10000rpm and 4 ℃ for 10min,collecting the precipitate, and resuspending the thallus with a resuspension solution, wherein the resuspension solution comprises: 20mM Na2HPO420mM imidazole, 500mM NaCl, 1mM DTT, 0.5mM PMSF, pH 7.4, then carrying out ultrasonication and centrifugation, wherein the supernatant is crude enzyme liquid of the aldol oxidase dimer (shown as a first lane), and firstly purifying the target protein by adopting Ni-NTA affinity chromatography to obtain three protein bands (shown as a second lane). We further separated and purified the target protein by using SEC molecular sieve, and the third lane is a single target protein band, i.e. purified aldol oxidase dimer catAldO is successfully obtained. Through gene sequencing, the aldol oxidase dimer cat AldO nucleotide sequence is SEQ ID NO. 1.
Example 3: determination of the enzymatic Activity of the aldolase dimer:
and measuring the enzymatic activity of the aldehyde alcohol oxidase dimer by a colorimetric method. Under optimum reaction conditions, 1. mu. mol of H is produced per unit2O2The required enzyme amount is one enzyme activity unit. Enzyme activity determination conditions: 20 μ L of 1mg/mL aldol oxidase dimer pure enzyme solution, 10 μ L of 1mg/mL Horseradish Peroxidase (HRP), 1470 μ L of 0.1mM 2,2 '-diaza-bis-3-ethylbenzothiazoline-6-sulfonic acid (2,2' -azino-bis (3-ethyllbenzothiazoline-6-sulfoacid), ABTS), 500 μ L of 200mM glycerol (D-sorbitol, D-mannitol, L-arabinose, 1, 2-propanediol) were mixed uniformly and reacted at 55 ℃, and the absorbance value at 420nm was detected on line by UV-visible spectrophotometry. The specific calculation formula of the enzyme activity is as follows:
in the above formula,. DELTA.OD420Change in absorbance at 420 nm; k represents the dilution ratio of the enzyme solution; ε represents the millimolar extinction coefficient (value 36L. mmol)-1·cm-1)；VcellThe total volume of the reaction solution in the cuvette; venzymeThe volume of the enzyme solution added to the cuvette was expressed, and the same sample was measured 3 times to take an average value and calculate a standard deviation.
Example 4: catalytic properties
The catalytic properties of the purified aldol oxidase dimer (catAldO) were studied and are shown in Table 2. It can be observed that the catalytic efficiency of the catAldO to glycerol is improved by 78.4 times and 7 times respectively compared with the original strain and the four mutant strains. And the affinity of the catAldO to most sugar alcohol substrates and the catalytic efficiency show different degrees of improvement.
KmAnd KcatThe specific calculation method is as follows
Kinetic constants of enzyme versus substrate glycerol: the catalytic activity of the enzyme was measured at 55 ℃ in 50mM PBS buffer pH 8.0, against various concentrations of glycerol (0-200 mM). According to the standard enzyme activity determination method, the reaction is carried out under the optimal reaction condition, and an ultraviolet-visible spectrophotometer is utilized to continuously monitor the change curve of the absorbance value of the final product along with the time within a period of time as shown in figure 2. Taking the initial and final OD values of the linear section on the kinetic curve, converting the time-dependent increase rate of the absorbance value into the time-dependent increase rate of the substrate concentration (in mu mol. min)-1Is shown)
Fitting the curve by Origin 2019 software according to the following formula to obtain KmAnd Vmax
In the above formula, V represents the initial reaction rate, mu mol/s; vmaxMu mol/s is the maximum reaction speed; s represents substrate concentration, mM; kmIn mM, as the Michaelis constant.
Number of enzyme conversions (K)cat) Can be calculated by the following formula:
in the above formula VmaxRepresents the maximum reaction rate,. mu.mol/s; [ E ]]Represents the protein concentration,. mu.g/mL; v is enzyme volume, mL; mr represents the molecular weight of the enzyme, μ g/μmol;
catalytic characteristics of Epimedium
Aldol oxidase (AldO) derived from Streptomyces coelicolor has a wide substrate spectrum and has certain catalytic capability on sugar alcohol and aliphatic and aromatic 1, 2-gem-diol. Sorbitol, mannitol, arabinose and 1, 2-propanediol were selected as substrates in the study, the substrate specificity of the catAldO was determined, and the steady state kinetic parameters of some representative substrates were determined, and the results are shown in table two. Firstly, the catalytic activity of the cat AldO to the glycerol is obviously improved, wherein the wild type AldO, the four mutant type AldO and the cat AldO show different substrate specificities to the glycerol, and KmThe values were 350, 111, 52.1mM, respectively. The affinity of the catAldO compared with wild-type enzyme and tetramutant type is improved by 6.7 times and 2.1 times respectively. And the affinity of the catAldO to sugar alcohol substrates shows a 10-24 fold increase in catalytic efficiency. Wherein, sorbitol is the most suitable substrate of the cat AldO and has extremely high affinity (K) to the cat AldOm0.09 mM). On the other hand, the turnover rate is increased, which provides higher catalytic efficiency for all substrates.
Example 5: enzymological Properties
The optimum reaction conditions and stability of the purified aldol oxidase dimer (catAldO) and the wild-type and four-mutant aldol oxidases were compared, as shown in Table 3.
Watch III
TABLE III compares the enzymatic properties of the herein-described catAldO with those reported in AldO-related studies.
On one hand, the optimal reaction conditions of the hisALDO and the cataAldO are compared, the optimal temperature of the hisALDO and the cataLDO is higher, namely 55 ℃, and the hisALDO and the cataLDO can keep more than 50% of activity in a wider temperature range (30 ℃ -55 ℃). At the temperature of 40-60 ℃, the activity of the catalyst is slightly influenced, and 80% of activity can be still maintained. However, both enzyme activities are reduced at temperatures above 60 ℃. In general, both catAldO and hisAldO exhibit the properties of a thermophilic enzyme, and have a wide reaction temperature range. And the optimal pH values of the hisALDO and the catAldO are moderately alkaline, namely pH 7.0 and 8.0. The pH has obvious influence on enzyme activities of the two, the catAldO can only keep more than 60% of activity within the range of pH 6-8, the hisAldO can only keep more than 60% of activity within the range of pH 6-7, and the activity can be obviously reduced when the pH deviates from the range. Both lose viability at pH values below 5 or above 10. We found that the catAldO and the hisAldO have close optimal reaction conditions, but the enzyme activity of the catAldO is obviously higher than that of the hisAldO in any reaction environment.
On the other hand we compared the stability of hisAldO with catAldO. The results of the study show that the enzymatic activity of the catAldO is highest at 40 ℃ with increasing temperature. The enzyme activity is slowly reduced at 40-45 ℃. When the temperature is higher than this range, the stability of the enzyme is significantly reduced, and both of them substantially lose the enzyme activity after incubation at 55 ℃ for 30 min. In terms of pH stability, hisAldO and catAldO have good pH stability in a moderately alkaline environment. After incubation of the catAldO in the pH 6-10 for 1h, the relative enzyme activity can still be kept above 80%, and good pH stability is shown. However, at pH values below 6, the enzymatic activity of the catAldO is essentially completely lost. The hisALDO can still maintain better activity after being incubated for 1h in a buffer pH of 6-9.
It should be understood that the above examples are only for the purpose of clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. It will be apparent to those skilled in the art that other variations and modifications may be made in the invention without departing from the spirit or scope of the invention as defined in the following claims. However, obvious variations or modifications which fall within the spirit of the invention are intended to be covered by the scope of the invention.
Sequence listing
<110> university of Chinese
<120> an aldol oxidase dimer and a preparation method thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1882
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agcccatatt gtcatggttg atgcatacaa gccgaccaaa ggttcaggtg ctagcggcgg 60
aggtggctca gaagccgcag caaaaggtgg aggaggctca acaggaggag aatatttcac 120
ccttcagatc cgtgggcgtg agcgcttcga ggagttccga gagaagaatg aggccttgga 180
actcaaggat gcccaggctg ggaaggagcc aggggggtca ggtgagctca tgagcgacat 240
caccgttacc aactgggccg gcaacatcac ctacaccgcg aaggaactgc tgcgtccgca 300
ctccctggac gcgctgcgtg ccctggtggc ggacagcgcc cgtgtgcgtg tgctgggcag 360
cggtcactcc ttcaacgaga tcgccgagcc gggcgacggt ggtgttctgc tgtctctggc 420
gggcctgccg tccgtggtgg acgtggacac cgcggcccgt accgtgcgtg ttggcggcgg 480
tgtgcgttac gcggagctgg cccgtgtggt gcacgcgcgt ggcctggcgc tgccgaacat 540
ggcctctctg ccgcacatct ctgttgccgg ttctgtggcc accggcaccc acggttctgg 600
tatgggcaac ggttctctgg cctctatggt gcgcgaggtg gagctggtta ccgcggacgg 660
ttctaccgtg gtgatcgcgc gtggcgacga gcgtttcggc ggtgcggtga cctctctggg 720
cgcgctgggc gtggtgacct ctctgaccct ggacctggag ccggcgtacg agatggaaca 780
gcacgttttc accgagctgc cgctggccgg tctggacccg gcgaccttcg agaccgtgat 840
ggcggcggcg tacagcgtgt ctctgttcac cgactggcgt gcgccgggtt tccgtcaggt 900
gtggctgaag cgtcgcaccg accgtccgct ggacggtttc ccgtacgcgg ccccggccac 960
cgagaagatg catccggtgc cgggcatgcc ggcggtgaac tgcaccgagc agttcggtgt 1020
gccgggtccg tggcacgagc gtctgccgca cttccgcgcg gagttcaccc cgagcagcgg 1080
tgccgagctg cagtctgagt acctgatgcc gcgtgagcac gccctggccg ccctgcacgc 1140
gatggacgcg atccgtgaga ccctggcgcc ggtgctgcag acctgcgaga tccgcaccgt 1200
tgccgccgac gcgcagtggc tgagcccggc gtacggtcgt gacaccgtgg ccgcgcactt 1260
cacctgggtt gaggacaccg cggcggtgct gccggtggtg cgtcgtctgg aggaggcgct 1320
ggttccgttc gcggcccgtc cgcactgggg taaggtgttc accgttccgg cgggcgagct 1380
gcgtgcgctg tacccgcgtc tggccgactt cggtgcgctg gcccgtgcgc tggacccggc 1440
gggtaagttc accaacgcgt tcgtgcgcgg tgtgctggcg ggctcaggct caggttctgt 1500
cgacatccca acgaccgaaa acctgtattt tcagggcgcc atggttgata ccttatcagg 1560
tttatcaagt gagcaaggtc agtccggtga tatgacaatt gaagaagata gtgctaccca 1620
tattaaattc tcaaaacgtg atgaggacgg caaagagtta gctggtgcaa ctatggagtt 1680
gcgtgattca tctggtaaaa ctattagtac atggatttca gatggacaag tgaaagattt 1740
ctacctgtat ccaggaaaat atacatttgt cgaaaccgca gcaccagacg gttatgaggt 1800
agcaactgct attaccttta cagttaatga gcaaggtcag gttactgtaa atggcaaagc 1860
aactaaaggt gacgctcata tt 1882
<210> 2
<211> 1257
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgagcgaca tcaccgttac caactgggcc ggcaacatca cctacaccgc gaaggaactg 60
ctgcgtccgc actccctgga cgcgctgcgt gccctggtgg cggacagcgc ccgtgtgcgt 120
gtgctgggca gcggtcactc cttcaacgag atcgccgagc cgggcgacgg tggtgttctg 180
ctgtctctgg cgggcctgcc gtccgtggtg gacgtggaca ccgcggcccg taccgtgcgt 240
gttggcggcg gtgtgcgtta cgcggagctg gcccgtgtgg tgcacgcgcg tggcctggcg 300
ctgccgaaca tggcctctct gccgcacatc tctgttgccg gttctgtggc caccggcacc 360
cacggttctg gtatgggcaa cggttctctg gcctctatgg tgcgcgaggt ggagctggtt 420
accgcggacg gttctaccgt ggtgatcgcg cgtggcgacg agcgtttcgg cggtgcggtg 480
acctctctgg gcgcgctggg cgtggtgacc tctctgaccc tggacctgga gccggcgtac 540
gagatggaac agcacgtttt caccgagctg ccgctggccg gtctggaccc ggcgaccttc 600
gagaccgtga tggcggcggc gtacagcgtg tctctgttca ccgactggcg tgcgccgggt 660
ttccgtcagg tgtggctgaa gcgtcgcacc gaccgtccgc tggacggttt cccgtacgcg 720
gccccggcca ccgagaagat gcatccggtg ccgggcatgc cggcggtgaa ctgcaccgag 780
cagttcggtg tgccgggtcc gtggcacgag cgtctgccgc acttccgcgc ggagttcacc 840
ccgagcagcg gtgccgagct gcagtctgag tacctgatgc cgcgtgagca cgccctggcc 900
gccctgcacg cgatggacgc gatccgtgag accctggcgc cggtgctgca gacctgcgag 960
atccgcaccg ttgccgccga cgcgcagtgg ctgagcccgg cgtacggtcg tgacaccgtg 1020
gccgcgcact tcacctgggt tgaggacacc gcggcggtgc tgccggtggt gcgtcgtctg 1080
gaggaggcgc tggttccgtt cgcggcccgt ccgcactggg gtaaggtgtt caccgttccg 1140
gcgggcgagc tgcgtgcgct gtacccgcgt ctggccgact tcggtgcgct ggcccgtgcg 1200
ctggacccgg cgggtaagtt caccaacgcg ttcgtgcgcg gtgtgctggc gggctaa 1257
<210> 3
<211> 114
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggaggagaat atttcaccct tcagatccgt gggcgtgagc gcttcgagga gttccgagag 60
aagaatgagg ccttggaact caaggatgcc caggctggga aggagccagg gggg 114
<210> 4
<211> 384
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcccatattg tcatggttga tgcatacaag ccgaccaaag ccatggttga taccttatca 60
ggtttatcaa gtgagcaagg tcagtccggt gatatgacaa ttgaagaaga tagtgctacc 120
catattaaat tctcaaaacg tgatgaggac ggcaaagagt tagctggtgc aactatggag 180
ttgcgtgatt catctggtaa aactattagt acatggattt cagatggaca agtgaaagat 240
ttctacctgt atccaggaaa atatacattt gtcgaaaccg cagcaccaga cggttatgag 300
gtagcaactg ctattacctt tacagttaat gagcaaggtc aggttactgt aaatggcaaa 360
gcaactaaag gtgacgctca tatt 384
Claims (3)
1. An aldol oxidase dimer, characterized in that: the nucleotide sequence is shown as SEQ ID NO. 1.
2. The method for producing the aldol oxidase dimer according to claim 1, comprising the steps of:
(1) the gene SpyTag/SpyCatcher is fused with the p53dim gene and then is connected with a vector to obtain a recombinant plasmid pETDuet-TXC, the nucleotide sequence of the SpyTag/SpyCatcher from Streptococcus pyogenes is shown as SEQ ID No.4, and the nucleotide sequence of the p53 dimerization domain from the tumor suppressor is shown as SEQ ID No. 3;
(2) plasmid pETDuet-AldO is taken as a template, the nucleotide sequence is SEQ ID NO.2, P1 and P2 are taken as primers to amplify to obtain a target gene fragment containing AldO,
the P1 nucleotide sequence is: GAGCTCATGAGCGACATCACCGTTAC, respectively;
the P2 nucleotide sequence is: GTCGACAGAACCTGAGCCTGAGCCCGCCAGCACACCGCGC, respectively;
(3) connecting the target fragment AldO to the plasmid pETDuet-TXC by enzyme digestion connection by taking the plasmid pETDuet-TXC as a template to obtain a recombinant plasmid pETDuet-TXC;
(4) the recombinant plasmid pETDuet-TXAC is transformed into Escherichia coli JM109, after screening of a positive transformant by colony PCR, a genetically engineered bacterium pETDuet-TXAC JM109 is obtained, and then the recombinant plasmid pETDuet-TXAC is transformed into E.coli BL21(DE3) to obtain a genetically engineered bacterium pETDuet-TXAC BL21 (DE);
(5) inoculating a genetically engineered bacterium pETDuet-TXAC BL21(DE) into a TB liquid culture medium, and culturing at 37 ℃, 200 and 220rpm for 12-16 h; transferring the strain into a TB culture medium according to the inoculation amount of 1-2%, culturing for 3-5h at 30 ℃ and 200-220rpm until the optical density value at 600nm reaches 0.4-0.8, adding isopropyl beta-D-1-thiogalactopyranoside (IPTG) with the final concentration of 1mM for induction, and culturing for 20-24h at 16-18 ℃ and 200-220 rpm;
(6) centrifuging the fermentation liquor at 10000rpm and 4 ℃ for 10min, collecting the precipitate, and resuspending the thallus by using a resuspension solution, wherein the resuspension solution comprises the following components: 20mM Na2HPO420mM imidazole, 500mM NaCl, 1mM DTT, 0.5mM PMSF and pH 7.4, then carrying out ultrasonication and centrifugation, obtaining supernatant which is crude enzyme liquid of the aldehyde-alcohol oxidase dimer, and purifying by adopting Ni-NTA affinity chromatography and SEC two steps to obtain the aldehyde-alcohol oxidase dimer cataAldO.
3. A method for constructing a genetically engineered bacterium that expresses the aldol oxidase dimer of claim 1, comprising the steps of:
(1) the gene SpyTag/SpyCatcher is fused with the p53dim gene and then is connected with a vector to obtain a recombinant plasmid pETDuet-TXC, the nucleotide sequence of the SpyTag/SpyCatcher from Streptococcus pyogenes is shown as SEQ ID No.4, and the nucleotide sequence of the p53 dimerization domain from the tumor suppressor is shown as SEQ ID No. 3;
(2) plasmid pETDuet-AldO is taken as a template, the nucleotide sequence is SEQ ID NO.2, P1 and P2 are taken as primers to amplify to obtain a target gene fragment containing AldO,
the P1 nucleotide sequence is: GAGCTCATGAGCGACATCACCGTTAC, respectively;
the P2 nucleotide sequence is: GTCGACAGAACCTGAGCCTGAGCCCGCCAGCACACCGCGC, respectively;
(3) connecting the target fragment AldO to the plasmid pETDuet-TXC by enzyme digestion connection by taking the plasmid pETDuet-TXC as a template to obtain a recombinant plasmid pETDuet-TXC;
(4) the recombinant plasmid pETDuet-TXAC is transformed into Escherichia coli JM109, after screening of positive transformants by colony PCR screening, genetic engineering bacteria pETDuet-TXAC JM109 are obtained, and then the recombinant plasmid pETDuet-TXAC is transformed into E.coli BL21(DE3), so that the genetic engineering bacteria pETDuet-TXAC BL21(DE) for expressing the aldol oxidase dimer is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110689676.6A CN113403291A (en) | 2021-06-22 | 2021-06-22 | Aldol oxidase dimer and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110689676.6A CN113403291A (en) | 2021-06-22 | 2021-06-22 | Aldol oxidase dimer and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113403291A true CN113403291A (en) | 2021-09-17 |
Family
ID=77682203
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110689676.6A Pending CN113403291A (en) | 2021-06-22 | 2021-06-22 | Aldol oxidase dimer and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113403291A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6196986A (en) * | 1984-10-17 | 1986-05-15 | Unitika Ltd | Alcohol oxidase and its preparation |
| CN111172123A (en) * | 2020-01-07 | 2020-05-19 | 江南大学 | Production method of D-glyceraldehyde |
| CN111560391A (en) * | 2020-05-21 | 2020-08-21 | 北京大学 | Biosynthesis method of protein heterogeneous catenane |
-
2021
- 2021-06-22 CN CN202110689676.6A patent/CN113403291A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS6196986A (en) * | 1984-10-17 | 1986-05-15 | Unitika Ltd | Alcohol oxidase and its preparation |
| CN111172123A (en) * | 2020-01-07 | 2020-05-19 | 江南大学 | Production method of D-glyceraldehyde |
| CN111560391A (en) * | 2020-05-21 | 2020-08-21 | 北京大学 | Biosynthesis method of protein heterogeneous catenane |
Non-Patent Citations (2)
| Title |
|---|
| XIAO-WEI WANG: "Protein Catenation Enhances Both the Stability and Activity of Folded Structural Domains", 《ANGEWANDTE CHEMIE》 * |
| ZHANG W等: "Huge enhanced activity of the alditol oxidase by a novel method based on the mechanically interlocked dimmer synthesized in vivo", 《EUROPE PMC》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101085424B1 (en) | Oxidoreductase from pichia capsulata | |
| US11225675B2 (en) | D-lactate dehydrogenase, engineered strain containing D-lactate dehydrogenase and construction method and use of engineered strain | |
| CN108795916B (en) | Lysine decarboxylase mutant, coding gene thereof, expression and application thereof | |
| CN106929521B (en) | Aldehyde ketone reductase gene recombination co-expression vector, engineering bacterium and application thereof | |
| CN110452845B (en) | Escherichia coli for producing sucrose phosphorylase | |
| US10294479B2 (en) | Candida carbonyl reductase and method for preparing (R)-lipoic acid precursor | |
| CN111996176B (en) | Carbonyl reductase mutant and application thereof | |
| CN102808002B (en) | The reconstitution cell of a kind of biological process synthesizing methyl acetoin and derivative thereof and method | |
| Oh et al. | Identification of a lactose-oxidizing enzyme in Escherichia coli and improvement of lactobionic acid production by recombinant expression of a quinoprotein glucose dehydrogenase from Pseudomonas taetrolens | |
| Kaswurm et al. | Evaluation of the food grade expression systems NICE and pSIP for the production of 2, 5-diketo-D-gluconic acid reductase from Corynebacterium glutamicum | |
| CN113817693A (en) | Short-chain carbonyl reductase PpYSDR mutant, encoding gene, recombinant expression vector, genetic engineering bacterium and application | |
| Sasaki et al. | Lactobacillus reuteri ATCC 53608 mdh gene cloning and recombinant mannitol dehydrogenase characterization | |
| El-Enshasy et al. | GpdA-promoter-controlled production of glucose oxidase by recombinant Aspergillus niger using nonglucose carbon sources | |
| Jong-Won et al. | Characterization of styrene catabolic genes of Pseudomonas putida SN1 and construction of a recombinant Escherichia coli containing styrene monooxygenase gene for the production of (S)-styrene oxide | |
| US8383375B2 (en) | Thermostable gluconate dehydratase and use thereof | |
| CN113403291A (en) | Aldol oxidase dimer and preparation method thereof | |
| JP4216719B2 (en) | Halogen compound-resistant novel formate dehydrogenase and method for producing the same | |
| CN113061593B (en) | L-malate dehydrogenase mutant and application thereof | |
| WO2006027081A1 (en) | Biocatalyst for hydrolyzing cyanide | |
| EP2119770B1 (en) | Production of alpha-oxyfunctionalized carbonyl compounds | |
| CN113355366A (en) | Method for preparing 2-phenethyl alcohol by multi-enzyme cascade | |
| Yamada et al. | A new aldehyde oxidase catalyzing the conversion of glycolaldehyde to glycolate from Burkholderia sp. AIU 129 | |
| CN110628849A (en) | Method for regenerating oxidation state nicotinamide cofactor | |
| CN111254170A (en) | Method for preparing (S) -1,2,3, 4-tetrahydroisoquinoline-3-formic acid by multi-enzyme coupling | |
| AU2021102284A4 (en) | Peptide linker, fusion protein comprising the peptide linker and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20210917 |
|
| WD01 | Invention patent application deemed withdrawn after publication |