CN113388620A - FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application - Google Patents
FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application Download PDFInfo
- Publication number
- CN113388620A CN113388620A CN202110776134.2A CN202110776134A CN113388620A CN 113388620 A CN113388620 A CN 113388620A CN 202110776134 A CN202110776134 A CN 202110776134A CN 113388620 A CN113388620 A CN 113388620A
- Authority
- CN
- China
- Prior art keywords
- leu
- glu
- ile
- lys
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Saccharide Compounds (AREA)
Abstract
The invention relates to the field of gene editing, in particular to an FcCGA 1 gene related to citrus disease resistance, a primer pair, a silencing vector and application. The invention provides an FcCGA 1 gene related to citrus disease resistance, and the nucleotide sequence of the FcCGA 1 gene comprises a sequence shown as SEQ ID No. 1. The resistance of the citrus to canker is obviously reduced by silencing the FcCGA 1 gene, and the gene can be used for breeding the citrus to resist canker.
Description
Technical Field
The invention relates to the field of gene editing, in particular to an FcCGA 1 gene related to citrus disease resistance, a primer pair, a silencing vector and application.
Background
The orange is the most important fruit tree in southern areas of China, and after new China is established, the orange industry develops rapidly, becomes an important support of the agricultural economy industry in the main citrus producing areas in China, and makes great contribution in different aspects such as enlarging employment of urban and rural residents, promoting increase of agricultural economy and income and the like. However, Canker Disease (CBCD) poses a very serious threat to the development of the Citrus industry in our country. Therefore, canker studies are a major part of citrus science and technology.
Based on the method, the cultivation of the citrus varieties with canker resistance is beneficial to the continuous and stable development of the citrus industry. Since most citrus varieties are of the multi-embryonic type, the vegetative embryos develop better than the sexual embryos, resulting in poor development of the latter, and in addition, the female and/or male abortion of part of the varieties, resistance breeding by sexual crossing is difficult. Therefore, it is very important to find a method for quickly and effectively obtaining disease-resistant varieties.
Disclosure of Invention
In order to solve the problems, the invention provides an FcCGA 1 gene related to citrus disease resistance, a primer pair, a silencing vector and application. The invention can obtain a method for quickly and effectively obtaining disease-resistant varieties by utilizing the FcCGA 1 gene.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides an FcCGA 1 gene related to citrus disease resistance, wherein the FcCGA 1 gene comprises a nucleotide sequence shown as SEQ ID No. 1.
Preferably, the protein coded by the FcCGA 1 gene comprises an amino acid sequence shown in SEQ ID No. 2.
The invention provides a primer pair for amplifying the gene, wherein the primer pair comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID No. 3; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4.
The invention provides a silencing vector comprising the gene.
The invention provides a preparation method of the silencing vector, which comprises the following steps:
connecting a specific fragment of the FcCGA 1 gene between BamHI and Sma I enzyme cutting sites of pTRV2 to obtain a silencing vector;
the nucleotide sequence of the specific fragment of the FcCGA 1 gene is shown as SEQ ID No. 5.
The invention provides the application of the gene or the primer pair or the silencing vector prepared by the preparation method in cultivating new varieties of citrus plants.
The invention provides application of the gene or the primer pair in improving disease resistance of citrus plants.
Preferably, the disease resistance comprises resistance to bacterial disease.
Preferably, the bacterial disease comprises an ulcer disease.
Has the advantages that: the invention provides an FcCGA 1 gene related to citrus disease resistance, wherein the FcCGA 1 gene comprises a nucleotide sequence shown as SEQ ID No. 1. After the FcCGA 1 gene is silenced, the resistance of citrus to canker is remarkably reduced, and the gene can be used for breeding citrus anti-canker, so that the resistance of citrus to canker is greatly enhanced by creating an overexpression material of the FcCGA 1 gene, and the direct economic loss of the citrus industry caused by canker every year is reduced.
In addition, the invention constructs a pTRV2 virus silencing expression vector plasmid containing a citrus FcCGA 1 gene specific fragment, cooperates with the pTRV1 plasmid, and injects the citrus seedling leaves by an agrobacterium-mediated method to silence the FcCGA 1 gene of the citrus, thereby effectively reducing the FcCGA 1 gene expression level and obtaining an FcCGA 1 gene silencing plant of the citrus. After the inoculation of citrus canker pathogen, the observation shows that the disease phenotype of the silent plant is more obvious and the injury degree is more serious, which indicates that the citrus FcCGA 1 gene has positive regulation effect in the resistance of citrus canker. According to the specific embodiment of the invention, a rapid and effective VIGS virus silencing system is established in kumquats, the operation is simple, the experimental period is short, the method can be used for researching gene functions, the problem of verifying kumquat gene functions can be effectively solved, and a foundation is laid for excavating important citrus stress-resistant genes and cultivating excellent, disease-resistant and special varieties.
Drawings
FIG. 1 shows the structure of kumquat FcCGA 1 gene, whose ORF region is 3954bp in length and codes 1318 amino acids; wherein (A) is an amplification diagram of FcCGA 1 gene, Marker is DL 2000DNAmarker (Takara) (B) is a structural diagram of FcCGA 1 gene, Exon is Exon, upstream/downstream is upstream/downstream, N-terminal is N segment, coded Coil is conserved Domain of coded Coil, NB-ARC is conserved Domain of nuclear-binding adapter Shared by APAF-1R proteins and CED-4, LRR N is conserved Domain of Leucine Rich N, C-terminal is C end, and Domain location (aa) is Domain position (aa);
FIG. 2 is an analysis of the inducible expression of the FcCGA 1 gene under ulcer disease, in which Relative expression Level is the Relative expression Level;
FIG. 3 is an analysis of the silencing efficiency of FcCGA 1 gene, wherein Relative expression Level is the Relative expression Level;
FIG. 4 is a phenotypic observation of citrus reticulata leaves injected with ulcerative pathogens, wherein Control on the leaves is Control, FcRGA1-VIGS is silent, C is Control, R is silent, Front is Front, Back is Back, 0dpi is 0days post exposure, i.e., before inoculation, 14dpi is 14days post inoculation, i.e., 14days post inoculation;
FIG. 5 is the colony count of ulcerative bacteria in the leaves of kumquat of the control group and the silent group after infection by ulcerative bacteria, and the Bacterial proliferation is the Bacterial proliferation amount;
FIG. 6 is the analysis of relative conductivity and Chlorophyll content in the leaves of control and silent groups of kumquat after infection with canker pathogen, wherein (A) is the relative conductivity after infection with canker pathogen, electroyte leak is the relative conductivity, (B) is the Chlorophyll content after infection with canker pathogen, and chlorophyl content is the Chlorophyll content.
Detailed Description
The reagents used in the present invention are all those conventionally purchased by those skilled in the art, unless otherwise specified.
The invention provides an FcCGA 1 gene related to citrus disease resistance, wherein the nucleotide sequence of the FcCGA 1 gene (note number: Ciclev10004102m, https:// phytozome.jgi.doe.gov/pz/portal.html #) comprises a sequence shown in SEQ ID No. 1, and specifically comprises the following steps: ATGGCTGAAATCATTCTTACTATTGTTGTAGAAGTTGTAAAGTGCTTGGCTCCTCCCGCATATCGCCAAATTAGCTATTTGCGTGAGAGCAAGTACATGAGCAACTTACAGAATCTCAAGATTGAAGTTGACGATCTGAAGTCTGAGAGGGTGCGTACAGAGCACCAGGTTGATGAGGCTAAAAGAAAAGGAGAAGAGATTGAAGAGAACGTTGAGAATTGGCTTGCAACGGCAAATAATGTCATTGTTGAGGCAGTTAAGTTTACAGACGATGAAGCCATTGCAAATAAGCGTTGTTTCAAGGGGTTATGTCCTAATTTGAAGACCCGCCGTCGACTTAGCAAGGAAGCAGAGAGGCAGAAGGAGGCTGTTGTCAAAGTCCGAGAAGCTCGAAGATTTGATAGAATTTCCTACTGTACTGCTCCAGAGGATATACGGCTTATCTCTAACAAAGACTACGAGCCCTTCGAATCAAGAATGTTCACTTTGAGGAATATACTCAGTGCACTAGAAGATCCCGATGTCAATATACTTGGGATTTATGGTATGGGCGGCATCGGAAAGACGATGCTGGCGGAAGAAATTGCTAGGAAAGTCAAGAGCGACAAACTCTTTGATCAGGTGGTTTTTGTTGAGGTGTCCCAGAATCAAGACATACGAAAGATTCAAGGAGAAATCGGAGATAAACTAGGCCTGAAGTTTCATGAGGAGAGTGAATCAGGAAGGGCGAACAGCTTATTTACACGTATAAAAGCAGAGAAGAAGATCTTGATAATTCTAGACAACATTTGGGAAAATCTTGATTTGCGGGTTGTCGGAATTCCACATGGAGATGGTCATAAAGGTTGTAAAGTACTGTTGACGGCCAGAAGTCAAGATGTATTGTCTGGGAAGATGGATTCTCGACCAAATTTCTCAATTGGTGTTCTAAACGGAGAAGAAGCTTGGAGTCTATTCAAGAAGATGGCAGGTGATTATATTGAAGATAGTGAATTCCAATCGATAGCAAGGGATGTGGCAAAGGAATGTGCAGGTTTGCCTATTTCCATTGTGACGATAGCGAGGGCATTAAGGAACAAGAGATTATTTGAATGGAAGGATGCGTTGGAACAACTAAGAAGGCCATCCTCAACGAATTTCAAAGACATACAGCCAACTGCATATAAAGCAATAGAGTTGAGTTACAACAAATTAGAAGGGGAGGAGCTCAAGAACATCCTTTTGCTAATAGGATATACAGCCATATCATCCATTGATGCCTTGTTAATGTGTGGTATGGGATTGGGTTTATTTCAAGGTGTCAATAAGATGGAAGTAGCACGAGCTCGAGTACTGACCTTGGTGCACAAACTCAAAGCTTCTTGCATGTTGCTAGACCATATAAGCAAGAAGGAAGAGTTCTTTTCCATGCATGATGTCGTTCGCGATGTTGCCATATCAATTGCATCTAGAGAGCAAAATGCATTGACAGCGACAAATGAGCAGGTTGATGGTTTCAGGGAATGGTCAGACGAAAGTGCAGTAAAGCGTTACACTTCGATCGTCTTACATGATGTCAGGACTAATGTGCTTCCTGAAGTAGTGGAATGTCCTCAACTCAAACTTCTTTTTATAAGTGCGGATAAGGAATCTTCATCATTAACCATTCCAAACAATTTTTTCAAGAGGATGATACAGGTCAGAGTTATAAACTTGACTTACATGAATCTACTGTCACTGCCTTCAACACTTGGTTTTCTGTTAAACCTTCGAGCACTGAGTTTGTGTTATTGCAAATTGCTAGATATAAGTGTTATAGGAGGCTTGAATAAACTAGAAATCCTTTGTTTAAGAGGCTCTGACATTAAGCAGCTGCCAACAGAAGTAGGTCAATTGACTTGGCTAACCTTGCTTGATTTGAGAGAATGTAGGAAACTAGAAGTTATCCCACCAAATGTTTTATCAAATTTATCCCATTTAGAAGAACTATACATAAGTTGTAGAAGCTTTCAAAAATGGGAGGTGGAGGTGGAAGGGGTTAAGAATGCTAGCGTTGAGGAGTTGAAGCATTTGCCTAACTTGACCTCTTTAGAATTAGACATCCATGATGTCAACACTCTGCCCAGAGGCTTGTTCTTGGAGAAGCTGGAAAAGTACAGAATACGTATTGGAGATTGGTATTGGGAGAGCACCAACATTTGGCGTAGAGAATTCAGACTCAGGCTGAACAACAAGATTTGCTTGAAGGATTGGCTGATCGTGCAACTGCAGGGAATTGAAGACCTTGAATTACGTGAATTGCAAGAGCAAGATGTCAATTATTTTGCTAATGAATTAGGCAAAGTGGGTTCTTCAGAACTCAAGTTTCTCAGGATCCATGGTTGCAGCGACGCCCTCAATCCGCCGGCAGAGTCAAAGAGACAGGAGGAATCAGCAAATGATATGCAGTCGAATGAAATCATTTTGGAGGACAATGTTAATATTTCTAATACACTTTTCATTGAGAAGGTTGCGTTACCAAAGTTGGAGAAGTTGGCGGTGCGTTCAATAAATATTGAGAGAATTTGGCAAAACCAAGTTGCAGCCATGACTTGCGGTATTGAGAATTTAACGCACTTGACGCTGTACAACTGTATGAATTTAAGATGTCTATTTTCATCTTCTACGGTTAGCGATAACATCTTTGTTCGACTCCAATACATTGAGATAGAAAAATGTCATGTCTTGGAAGAGTTAATAGTCATGGACAACCAAGAAGAAGAAAGGAAGAATAATATTGTAATGTTTCCTCAGTTACAATATCTGAAGATGTATGATCTTGAAAAACTCACAAGCTTCAGCACAGGAGATGTACATATGTTTGAATTTCCATCCTTGAAAGAATTATGGATATCTCGGTGTCCTGAGTTCATGGTGAGATTTAAAAGAACTACTAATGACTTGACAAAAAAGGTGTTTCCCAATTTGGAGGAGTTGATAGTAGATGCAAAGTATATAATAACAAATAAATTTATATTTTCAGAAGACTTGCTGTGCAAACTTAAATGCCTTGATGTTGTGTTTGTTGATGAGTTGACTACTATTTTATCACTTGATGATTTCCTCCAGAGATTTCACACCCTGAAAGTTCTCCAAATAGAAGGATATAGTGATTGGTTGCCAAAAGAAAAGGTTGAAAATGGGATGGAGGTAATCATAAGAAGAGTGTTCAGGTGTTATGACCTGAAGTACATCTTGAAACAAGAGTCCTCCTCTATTATGAACGATTTGGTTATTCTACATGTAACGAATTGTCACCGTTTGATCAATCTAGTGCCATCCTCGACATCCTTTCAGAATCTTACAAGTTTGGAGATATCGTATTGCAACGGATTGAAAAACGTATTAACATTCTCAATTGCAAAGACTCTGGTGCGACTCAGAGAAATGAAGATAGAATCATGTGCTATGATAACAGAAATAGTCCTGGCAGATGATGACGATGATCGTGATGCAGCGAAAGATGAGGTTATTGCTTTCAGCGAATTGAAAGAGTTGAAGCTTTTAAATTTAAAAAGTCTGAGAAGCTTCTACCCCGGCAATCGTGCCTTGAATTTCCCATCTTTGGAAAGATTACTGGTGGATGATTGCACCAATATGAAAAGTTTCTCTAGAGGAGAATTAAGCACACCCGTGTTACACAAAGTGCAGCTGAATAGGTGGGACGAAGCATGTTGGGCTTGGAAGGAGGGTTTAAATACAACCATTGAACAGGTAAATCTTCAGAAGGAAGGCTTCCTCAAGAAGCGTCGTGAAGCTCCTCCATCCCAGCAATTCCTTTCTTTCGCTCCTGCCCCCAATCTCAATCTCCAAACTAGGTTGGAAATTTTGCCCGCGATGGTTGCTGGCGTTTGGTCAGATGACAACAACTTGCAGCTGGAAGCAACTACTCAGTTCCGAAAACTGCTTTCAAATGAGAGGAGTCTACCAACTTAG, i.e., the ORF sequence of the coding region of the FcCGA 1 gene.
The protein coded by the FcCGA 1 gene preferably comprises an amino acid sequence shown in SEQ ID No. 2, and specifically comprises the following components: MetAla Glu Ile Ile Leu Thr Ile Val Val GluVal Lys Cys LeuAla Pro Pro Ala TyrArg Gln Ile Ser Tyr Leu Arg Glu Ser Lys Tyr Met SerAsn Leu Gln Asn Leu Lys Ile Glu Val Asp Asp Leu Lys Ser GluArg Val Arg Thr Glu His Gln Val Asp GluAla Lys Arg Lys Gly Glu Glu Ile Glu GluAsn Val GluAsn Trp LeuAla Thr Ala Asn Asn Val Ile Val Glu Ala Val Lys Phe Thr Asp Asp Glu Ala Ile Ala Asn Lys Arg Cys Phe Lys Gly Leu Cys Pro Asn Leu Lys Thr Arg Arg Arg Leu Ser Lys Glu Ala Glu Arg Gln Lys Glu Ala Val Val Lys Val Arg Glu AlaArg Arg Phe Asp Arg Ile Ser Tyr Cys Thr Ala Pro Glu Asp Ile Arg Leu Ile Ser Asn Lys Asp Tyr Glu Pro Phe Glu SerArg Met Phe Thr Leu ArgAsn Ile Leu SerAla Leu GluAsp Pro Asp ValAsn Ile Leu Gly Ile Tyr Gly Met Gly Gly Ile Gly Lys Thr Met Leu Ala Glu Glu Ile Ala Arg Lys Val Lys SerAsn Lys Leu Phe Asp Gln Val Val Phe Val Glu Val Ser GlnAsn Gln Asp Ile Arg Lys Ile Gln Gly Glu Ile Gly Asp Lys Leu Gly Leu Lys Phe His Glu Glu Ser Glu Ser Gly Arg Ala Asn Ser Leu Phe Thr Arg Ile Lys Ala Glu Lys Lys Ile Leu Ile Ile Leu Asp Asn Ile Trp Glu Asn Leu Asp Leu Arg Val Val Gly Ile Pro His GlyAsp Gly His Lys Gly Cys Lys Val Leu Leu ThrAlaArg Ser Gln Asp Val Leu Ser Gly Lys Met Asp SerArg Pro Asn Phe Ser Ile Gly Val Leu Asn Gly Glu Glu Ala Trp Ser Leu Phe Lys Lys Met Ala Gly Asp Tyr Ile Glu Asp Ser Glu Phe Gln Ser Ile Ala ArgAsp ValAla Lys Glu Cys Ala Gly Leu Pro Ile Ser Ile Val Thr Ile AlaArg Ala Leu ArgAsn Lys Arg Leu Phe Glu Trp Lys Asp Ala Leu Glu Gln LeuArgArg Pro Ser ThrAsn Phe Lys Asp Ile Gln Pro ThrAla Tyr Lys Ala Ile Glu Leu Ser Tyr Asn Lys Leu Glu Gly Glu Glu Leu Lys Asn Ile Leu Leu Leu Ile Gly Tyr ThrAla Ile Ser Ser Ile Asp Ala Leu Leu Met Cys Gly Met Gly Leu Gly Leu Phe Gln Gly Val Asn Lys Met Glu Val AlaArg Ala Arg Val Leu Thr Leu Val His Lys Leu Lys Ala Ser Cys Met Leu Leu Asp His Ile Ser Lys Lys Glu Glu Phe Phe Ser Met His Asp Val Val Arg Asp Val Ala Ile Ser Ile Ala Ser Arg Glu Gln Asn Ala Leu Thr Ala Thr Asn Glu Gln Val Asp Gly Phe Arg Glu Trp Ser Asp Glu Ser Ala Val Lys Arg Tyr Thr Ser Ile Val Leu His Asp Val Arg ThrAsn Val Leu Pro Glu Val Val Glu Cys Pro Gln Leu Lys Leu Leu Phe Ile SerAlaAsp Lys Glu Ser Ser Ser Leu Thr Ile Pro AsnAsn Phe Phe Lys Arg Met Ile Gln Val Arg Val Ile Asn Leu Thr Tyr Met Asn Leu Leu Ser Leu Pro Ser Thr Leu Gly Phe Leu LeuAsn LeuArgAla Leu Ser Leu Cys Tyr Cys Lys Leu LeuAsp Ile Ser Val Ile Gly Gly Leu Asn Lys Leu Glu Ile Leu Cys Leu Arg Gly Ser Asp Ile Lys Gln Leu Pro Thr GluVal Gly Gln Leu Thr Trp Leu Thr Leu LeuAsp LeuArg Glu Cys Arg Lys Leu Glu Val Ile Pro Pro Asn Val Leu Ser Asn Leu Ser His Leu Glu Glu Leu Tyr Ile Ser Cys Arg Ser Phe Gln Lys Trp Glu Val Glu Val Glu Gly Val Lys Asn Ala Ser Val Glu Glu Leu Lys His Leu Pro Asn Leu Thr Ser Leu Glu Leu Asp Ile His Asp ValAsn Thr Leu Pro Arg Gly Leu Phe Leu Glu Lys Leu Glu Lys TyrArg Ile Arg Ile Gly Asp Trp Tyr Trp Glu Ser ThrAsn Ile Trp Arg Arg Glu Phe Arg Leu Arg Leu Asn Asn Lys Ile Cys Leu Lys Asp Trp Leu Ile Val Gln Leu Gln Gly Ile Glu Asp Leu Glu Leu Arg Glu Leu Gln Glu GlnAsp Val Asn Tyr Phe AlaAsn Glu Leu Gly Lys Val Gly Ser Ser Glu Leu Lys Phe Leu Arg Ile His Gly Cys SeraSP Ala Leu Asn Pro Pro Ala Glu Ser Lys Arg Gln Glu Glu SeraAsnAsnAsnAsnAsn Met Gln SeraSn Glu Ile Ile Leu Glu Asp Asn Val Asn Ile Ser Asn Thr Leu Phe Ile Glu Lys Val Ala Leu Pro Lys Leu Glu Lys Leu AlaValArg Ser Ile Asn Ile GluArg Ile Trp GlnAsn Gln ValAlaAla Met Thr Cys Gly Ile GluAsn Leu Thr His Leu Thr Leu TyrAsn Cys MetAsn LeuArg Cys Leu Phe Ser Ser Ser Thr Val SeraAsn Ile Phe ValArg Leu Gln Tyr Ile Glu Ile Glu Lys Cys His Val Leu Glu Glu Leu Ile Val MetAsp Asn Gln Glu Glu Glu Arg Lys Asn Asn Ile Val Met Phe Pro Gln Leu Gln Tyr Leu Lys Met TyrAsp Leu Glu Lys Leu Thr Ser Phe Ser Thr Gly Asp Val His Met Phe Glu Phe Pro Ser Leu Lys Glu Leu Trp Ile Ser Arg Cys Pro Glu Phe Met ValArg Phe Lys Arg Thr ThrAsnAsp Leu Thr Lys Lys Val Phe Pro Asn Leu Glu Glu Leu Ile ValAspAla Lys Tyr Ile Ile ThrAsn Lys Phe Ile Phe Ser Glu Asp Leu Leu Cys Lys Leu Lys Cys LeuAsp Val Phe ValAsp Glu Leu Thr Thr Ile Leu Ser LeuAspAsp Phe Leu GlnArg Phe His Thr Leu Lys Val Leu Gln Ile Glu Gly Tyr Ser Asp Trp Leu Pro Lys Glu Lys Val Glu Asn Gly Met Glu Val Ile Ile Arg Arg Val Phe Arg Cys TyrAsp Leu Lys Tyr Ile Leu Lys Gln Glu Ser Ser Ser Ile Met Asn Asp Leu Val Ile Leu His Val Thr Asn Cys His Arg Leu Ile Asn Leu Val Pro Ser Ser Thr Ser Phe GlnAsn Leu Thr Ser Leu Glu Ile Ser Tyr Cys Asn Gly Leu Lys Asn Val Leu Thr Phe Ser Ile Ala Lys Thr Leu Val Arg Leu Arg Glu Met Lys Ile Glu Ser Cys Ala Met Ile Thr Glu Ile Val LeuAlaAsp Asp Asp Asp Asp Arg Asp AlaAla Lys Asp Glu Val Ile Ala Phe Ser Glu Leu Lys Glu Leu Lys Leu LeuAsn Leu Lys Ser Leu Arg Ser Phe Tyr Pro GlyAsnArg Ala Leu Phe Pro Ser Leu GluArg Leu ValAsp Cys ThrAsn Met Lys Ser Phe SerArg Gly Glu Leu Ser Thr Pro Val Leu His Lys Val Gln LeuAsnArg Trp Asp GluAla Cys TrpAla Trp Lys Glu Gly Leu Asn Thr Thr Ile Glu Gln Val Asn Leu Gln Lys Glu Gly Phe Leu Lys Lys Arg Arg GluAla Pro Pro Ser Gln Gln Phe Leu Ser PheAla Pro Ala Pro Asn LeuAsn Leu Gln ThrArg Leu Glu Ile Leu Pro Ala Met ValAla Gly Val Trp SerAsrAsp Asp AsnAsn Leu Gln Leu Glu Ala Thr Gln PheArg Lys Leu Leu SerAsrAsn GluArg Ser Leu Pro Thr x.
The invention provides a primer pair for amplifying the gene, wherein the primer pair comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID No. 3: CTGCCCCATTTTGTTGCAGTCAC, respectively; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4: CTAAGAAATGAATCTGGCTACGGC are provided. The primer pair of the invention is designed and amplified by spanning an initiation codon and a termination codon, and the coding sequence of the gene can be amplified more accurately.
The invention provides a silencing vector comprising the gene. In the present invention, the base vector preferably includes pTRV1 and pTRV 2; the sources of the pTRV1 and pTRV2 are not particularly limited, and the pTRV1 and pTRV2 can be obtained by conventional purchase of technicians in the field, and in the specific embodiment of the invention, the pTRV1 is preferably purchased from vast-Ling plasmid platform with the product number of P0428; the pTRV2 is preferably purchased from the vast-spirit plasmid platform under the accession number P1181.
The invention provides a preparation method of the silencing vector, which comprises the following steps:
inserting a specific fragment of an FcCGA 1 gene between BamHI and Sma I enzyme cutting sites of pTRV2 to obtain a silencing vector;
the nucleotide sequence of the specific fragment of the FcCGA 1 gene is shown as SEQ ID No. 5.
The invention connects a specific fragment of an FcCGA 1 gene between BamHI and Sma I enzyme cutting sites of pTRV2 to obtain a silencing vector, namely an FcCGA 1-pTRV2 vector. In the invention, the nucleotide sequence of the specific fragment of the FcCGA 1 gene is shown as SEQ ID No. 5: GGTTTCAGGGAATGGTCAGACGAAAGTGCAGTAAAGCGTTACACTTCGATCGTCTTACATGATGTCAGGACTAATGTGCTTCCTGAAGTAGTGGAATGTCCTCAACTCAAACTTCTTTTTATAAGTGCGGATAAGGAATCTTCATCATTAACCATTCCAAACAATTTTTTCAAGAGGATGATACAGGTCAGAGTTATAAACTTGACTTACATGAATCTACTGTCACTGCCTTCAACACTTGGTTTTCTGTTAAACCTTCGAGCACTGAGTTTGTGTTATTGCAAATTGCTAGATATAAGTGTTATAGGAGGCTTGAATAAACTAGAAATCCTTTGTTTAAGAGGCTCTGACATTAAGCAGCTGCCAACAGAAGTAGGT are provided. The source of pTRV2 is not particularly limited in the present invention, and in the specific examples of the present invention, pTRV2 is preferably purchased from vast-plasmid platform under the accession number P1181.
The invention also provides a primer for amplifying the specific fragment of the FcCGA 1 gene, wherein the nucleotide sequence of FcCGA 1-TRV 2F in the primer is shown as SEQ ID No. 6: 5' -AGAAGGCCTCCATGGGGATCCGGTTTCAGGGAATGGTCAGACG-3', wherein the underlined part is the cleavage site BamHI, the nucleotide sequence of FcCGA 1-TRV 2R is shown in SEQ ID No. 7: 5' -TGTCTTCGGGACATGCCCGGGACCTACTTCTGTTGGCAGCTG-3', wherein the underlined part is the restriction enzyme site Sma I; the system of amplification is preferably table 3; the procedure for the amplification is preferably as set forth in Table 4. The present invention is not limited in any way to the recovery and connection, and may be carried out in a manner known to those skilled in the art.
The resistance of the citrus to canker is obviously reduced by silencing the FcCGA 1 gene, and the gene can be used for canker resistant breeding of the citrus.
The invention provides the application of the gene or the primer pair or the silencing vector prepared by the preparation method in cultivating new varieties of citrus plants. In the present invention, the citrus plant preferably includes kumquat.
The silent FcCGA 1 gene can reduce the resistance of citrus to canker, and the over-expression material of the FcCGA 1 gene is created, so that the resistance of citrus to canker can be enhanced, and the direct economic loss of canker to the citrus industry each year can be reduced.
The invention provides application of the gene or the primer pair in improving disease resistance of citrus plants. In the present invention, the disease resistance preferably includes resistance to bacterial diseases, more preferably ulcer diseases.
To further illustrate the present invention, an FcRGA1 gene, a primer set, a silencing vector and use thereof related to citrus disease resistance provided by the present invention are described in detail below with reference to the accompanying drawings and examples, which should not be construed as limiting the scope of the present invention.
Example 1
Acquisition of FcRGA1 Gene
1. RNA extraction:
the experimental RNA Extraction method refers to an Easy Plant RNA Extraction Kit of bioscience, Inc. of Yiside, Zhejiang, and the Extraction method is operated according to the instruction, and comprises the following specific steps:
(1) taking 100-200 mg kumquat leaf tissue, fully grinding the kumquat leaf tissue in liquid nitrogen to powder, putting the powder into a 2mL RNase-free centrifuge tube frozen by liquid nitrogen in advance, adding 1mL Buffer PR1, and fully swirling for 1min to crack cells.
(2) Adding 200 μ L nucleic acid extract (24:1 chloroform isoamyl alcohol), vortexing thoroughly, and centrifuging at 13000g for 5min at 4 deg.C.
(3) The supernatant was pipetted into a new 2mL RNase free centrifuge tube and an equal volume of absolute ethanol was added. After mixing by thoroughly inverting, the mixture was transferred to a Hipure RNA adsorption column housed in a 2mL collection tube and centrifuged at 13000g for 1min at 4 ℃.
(4) Discarding the waste liquid, adding 600 μ LBufferPR2, centrifuging for 1min at 13000g at 4 ℃, discarding the waste liquid, and repeatedly washing for 1 time;
(5) the adsorption column was returned to the collection tube and centrifuged at 13000g for 1min at 4 ℃.
(6) Putting the adsorption column into a clean 1.5mL RNase-free centrifuge tube, slowly and uniformly adding 20-30 μ L RNA Elution Buffer into the center of the adsorption column membrane, standing at room temperature for 2-3 min, centrifuging at 13000g at 4 ℃ for 1min, wherein the eluent is the extracted RNA, and storing at-80 ℃.
2. Synthesis of cDNA
In the cDNA synthesis of the experiment, TaKaRa reverse transcription kit PrimeScript is usedTMThe RT reagent Kit with gDNA Eraser completes the operation steps as follows:
(1) the stored RNA was taken out from the freezer at-80 ℃ and dissolved on ice. A reverse transcription reagent 1 reaction system was configured as shown in table 1:
TABLE 1 preparation of reverse transcription reagent 1
| Reaction reagent | Amount of the composition used | |
| | 1μL | |
| 5×gDNAEraserBuffer | 2μL | |
| TotalRNA | 2μL | |
| RNaseFreeddH2O | 5μL | |
| Total volume | 10μL |
(2) All reagents in table 1 were mixed and incubated at 42 ℃ for 2 min;
(3) a reverse transcription reagent 2 reaction system was configured as shown in table 2:
TABLE 2 preparation of reverse transcription reagent 2
(4) Mixing the reverse transcription reagent 1 which is incubated at 42 ℃ with the prepared reverse transcription reagent 2, incubating for 15min at 37 ℃, and then incubating for 15s at 85 ℃ to obtain a product, namely kumquat cDNA;
(5) the cDNA obtained by detecting the concentration of kumquat cDNA by using an ultramicro nucleic acid protein tester can be used for cloning and subsequent quantitative analysis of kumquat genes, and the obtained cDNA is stored at-20 ℃.
3. FcCGA 1 gene sequence determination
(1) PCR amplification
Amplification primers were designed based on the sequence information of the FcCGA 1 gene obtained from the plant genome database Phytozome 12.1(https:// Phytozome.jgi. doe. gov/pz/port. html). Forward primer FcCGA 1F (SEQ ID No: 3): 5'-CTGCCCCATTTTGTTGCAGTCAC-3', reverse primer FcCGA 1R (SEQ ID No: 4): 5'-CTAAGAAATGAATCTGGCTACGGC-3' are provided.
And (3) carrying out PCR amplification by using kumquat leaf cDNA as a template. The PCR reaction system is shown in Table 3.
TABLE 3PCR reaction System
| Reaction reagent | Amount of the composition used |
| PrimeSTARMaxPremix(2×) | 25μL |
| Forward primer | 2μL |
| Reverse primer | 2μL |
| cDNA | 12μL |
| ddH2O | 19μL |
| Total volume | 50μL |
The PCR amplification procedure was performed according to the conditions listed in Table 4.
TABLE 4 Gene amplification PCR program
(2) Connection carrier
And (3) purifying and recovering the amplified product by adopting an AxyPrep-96 DNA gel recovery kit, connecting the purified product with an intermediate vector pTOPO (pTOPO), wherein the connection system is shown in table 5, and transforming escherichia coli competence DH5 alpha after incubating for 5min at room temperature.
TABLE 5pTOPO vector ligation System
After overnight culture at 37 ℃, selecting a monoclonal for amplification culture, identifying the monoclonal as a positive band by PCR of a bacterial solution, and sending the positive band to Wuhan engine company for sequencing. The sequencing results are shown in figure 1, and the correct FcRGA1 sequence was obtained after alignment.
Example 2
Analysis of induced expression of FcCGA 1 gene by ulcer pathogen
(1) Kumquat material: the kumquat seeds are adopted to plant seedlings, and the inoculation of canker pathogen (manufacturer: China center for culture Collection of microbial strains, cat # bio-33588) can be carried out after about 3 months.
(2) Activation of ulcer germ strains: taking out the preserved canker bacterial strain from-80 deg.C before inoculation, streaking and activating NA solid culture medium (manufacturer: Beijing Luqiao technology corporation, Cat.: CM107-01), culturing in 28 deg.C incubator for 2d, picking out monoclonal, streaking and enlarging culture in new NA culture medium, scraping canker bacterial strain (Xcc bacterial strain) after 2d, diluting with sterile water, and adjusting to 5 × 107cfu/mL of bacterial suspension.
(3) Inoculating the kumquat leaves with canker germs: the prepared bacterial suspension was injected into the back of kumquat leaves using a small syringe (1mL), with two inoculation spots per leaf. The control group was inoculated with an equal amount of distilled water. The leaves inoculated for 0h, 1h, 3h, 6h, 12h and 24h were collected and subjected to qRT-PCR, and the results are shown in Table 6 and FIG. 2 as follows:
FcActin F(SEQ ID No:8)：5’-CCGACCGTATGAGCAAGGAAA-3’；
FcActin R(SEQ ID No:9)：5’-TTCCTGTGGACAATGGATGGA-3’；
FcRGA1 QRTF(SEQ ID No:10)：5’-TCGATAGCAAGGGATGTGGC-3’；
FcRGA1 QRT R(SEQ ID No:11)：5’-CCAAGGTCAGTACTCGAGCTC-3’；
TABLE 6 analysis of the inducible expression of the FcCGA 1 Gene under ulcerative conditions
| 0h | 1h | 3h | 6h | | 24h | |
| 1 | 1.7879621 | 2.343329801 | 7.879112446 | 12.3346777 | 6.4422311 |
Results of the analysis of the FcRGA1 gene induced expression under ulcer disease are shown in table 6 and fig. 2, and the FcRGA1 gene was continuously induced up-regulated after inoculation of canker pathogen and reached the maximum expression level at 12h, indicating that the FcRGA1 gene may be related to the high resistance of kumquat under ulcer disease.
Example 3
Construction of FcCGA 1 Gene silencing vector
According to the FcCGA 1 gene sequence, a specific silent fragment Primer is designed by utilizing Primer 5.0 software, kumquat cDNA is taken as a template, a silent fragment, namely a specific fragment (SEQ ID No:5) of the FcCGA 1 gene is amplified, an amplification system is shown in table 3, an amplification program is shown in table 4 (the extension time at 72 ℃ is adjusted to be 1min), and the recovery is recovered by adopting an AxyPrep-96 DNA gel recovery kit in a conventional mode. After the amplification product is recovered, the amplification product is connected between BamHI and Sma I enzyme cutting sites of a vector pTRV2 (purchased from vast Ling plasmid platform, with the code of P1181) by using a prokaryote Sosoo ligase (with the code of TSV-S1), and a connection system is shown in Table 7. After the connection is finished, the escherichia coli competence is transformed, a single clone is selected for carrying out bacteria liquid PCR identification and then sent to a company for sequencing, and the FcCGA 1-pTRV2 vector is obtained after the comparison is correct.
FcRGA1-TRV2 F(SEQ ID No:6)：5’-AGAAGGCCTCCATGGGGATCCGGTTTCAGGGAATGGTCAGACG-3’
FcRGA1-TRV2 R(SEQ ID No:7)：5’-TGTCTTCGGGACATGCCCGGGACCTACTTCTGTTGGCAGCTG-3’。
TABLE 7Sosoo ligation System
Example 4
Silencing FcCGA 1 gene in kumquat by using silencing vector
1. Obtaining of silencing material:
after plasmids are extracted by adopting positive FcCGA 1-pTRV2 escherichia coli, agrobacterium-infected GV3101 is transformed, pTRV1 (purchased from vast ling plasmid platform with the product number being P0428) and pTRV2 plasmids are transformed into GV3101, and positive agrobacterium strains are obtained through identification. Activating Agrobacterium single clones of pTRV1, pTRV2 and FcCGA 1-pTRV2 by shaking for overnight culture, centrifuging at 4000g for 5min to collect thallus, adding infection buffer (10mmol/L MES, 10mmol/L MgCl2200. mu. mol/L AS) suspension of the cells and adjustment of OD600The value was 0.8. The cell suspension of pTRV1 and FcCGA 1-pTRV2 was mixed at a ratio of 1:1, and pTRV1 and pTRV2 were mixed at the same ratio to prepare a control group. The control group and the silent group inoculum were injected into the back of the kumquat leaf using a small syringe (1 mL).
2. FcRGA1 gene silencing efficiency analysis:
after injection, leaf material of the control group and leaf material of the silent group were sampled at 1d, 2d, 3d, 4d, 5d, 6d and 7d, respectively, RNA was extracted, and expression change of FcRGA1 gene was analyzed after reverse transcription. The results are shown in Table 8 and FIG. 3.
TABLE 8VIGS silencing efficiency
| 0d | 1d | 2d | 3d | 4d | 5d | 6d | 7d |
| 1.0881872 | 0.850564992 | 0.407418909 | 0.11652564 | 0.082256676 | 0.100221592 | 0.092159277 | 0.091152379 |
As shown in Table 8 and FIG. 3, the expression level of 2d after inoculating the silencing vector to the leaf of kumquat was significantly reduced compared to the control group, and was stably maintained at about 0.1-fold at the 4d after inoculation until reaching the 7d, indicating that the FcCGA 1 gene of interest was effectively silenced.
Example 5
Canker germ inoculation silent kumquat leaf
According to the analysis result of the silencing efficiency, starting 4d after the silencing vector is selected and inoculated, respectively inoculating canker pathogenic bacteria to the blades of the control group and the silencing group (the steps are shown in example 2), in order to improve the accuracy of the experiment, injecting the control group and the silencing group on the left half side and the right half side of the same blade of the kumquat, and inoculating equal amount of canker pathogenic bacteria after 4 d.
Example 6
Identification of ulcer disease resistance in silencing material
1. Phenotypic observation of silencing materials
Phenotype observation is carried out on the kumquat leaves of the control group and the silencing group 2 weeks after the canker pathogenic bacteria are inoculated, the results are shown in figure 4, the half-edge kumquat leaves injected into the control group have lighter disease symptoms, and the range of disease spots is smaller; the half-edge kumquat leaf which silences the FcCGA 1 gene has obvious disease symptoms, green leaves, obvious lesion spots and large range.
2. Silencing Material ulcer germ colony growth count
The Control (Control) and silencing (FcCGA 1-VIGS) kumquat leaves were individually selected, perforated at the edges using a 6mm hollow diameter punch, ground thoroughly, added 200. mu.L sterile water, centrifuged at 3000g for 30s, the supernatant was pipetted onto a blood cell counting plate, observed under a microscope and the colony count was calculated, as shown in Table 9 and FIG. 5.
TABLE 9 number of colonies (. times.10)6cfu/mL)
| Control | FcRGA1-VIGS |
| 12.64 | 28 |
As a result, as shown in Table 9 and FIG. 5, the number of the ulcer disease bacteria in the control group was 1.264X 10 by counting the number of colonies7cfu/mL, significantly lower than 2.8X 10 of the silent group7cfu/mL, suggesting that silencing of FcRGA1 gene promotes the reproduction of ulcerative bacteria.
3. Relative conductivity determination
Washing the control group and the silencing group kumquat leaves, wiping the leaves to dry, putting the leaves into a 50mL centrifuge tube, adding 30mL deionized water, placing the centrifuge tube in a rotary shaking table, slowly shaking the centrifuge tube for 1h at room temperature, and measuring the electric conductivity E1 at the moment. After that, the sample was boiled at 95 ℃ for 10min and taken out, and after cooling to room temperature, the electric conductivity was measured again and recorded as E2. The conductivity of the blank deionized water was also measured and recorded as E01 and E02, respectively. According to the formula: (E1-E01)/(E2-E02) × 100%, formula i, and the corresponding relative conductivities of each group were calculated, and the results are shown in table 10 and a in fig. 6.
TABLE 10 relative conductivity (%)
| Control | FcRGA1-VIGS |
| 47.24044449 | 81.97191085 |
The results are shown in table 10 and a in fig. 6: the relative conductivity of the control group is 47.24%, which is obviously lower than 81.97% of the silent group, and the results show that after the FcCGA 1 gene is silenced, the cell membrane permeability of kumquat leaves is increased under the infection of canker pathogen, and the injury degree is heavier.
4. Chlorophyll content determination
0.1g of kumquat leaves of the control group and the silencing group are taken and added into 1.9mL of distilled water ice to be ground into homogenate. After vortexing 200. mu.L of homogenate and adding 4.8mL of 80% acetone, centrifuging the resulting mixture for 5min at 4000g, collecting the supernatant and detecting the absorbance at 645nm (denoted as A645), the total chlorophyll (Ct) content was calculated according to the formula Ct (mg/L) ═ A645X 1000/34.5, formula II, and the results are shown in Table 11 and B in FIG. 6.
TABLE 11 chlorophyll content (mg/g FW)
| Ca | Cb | Ct | |
| Control | 1.919479333 | 0.456375333 | 2.375854667 |
| FcRGA1-VIGS | 0.245231 | 0.202533667 | 0.447764667 |
The results are shown in table 11 and B in fig. 6: the chlorophyll content of the control group is 2.38mg/g, which is obviously higher than that of the silent group by 0.45mg/g, which indicates that the light and efficiency of kumquat leaves under the infection of canker pathogen are weaker after the FcCGA 1 gene is silenced.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> university of Jiangxian teachers
<120> FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3954
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atggctgaaa tcattcttac tattgttgta gaagttgtaa agtgcttggc tcctcccgca 60
tatcgccaaa ttagctattt gcgtgagagc aagtacatga gcaacttaca gaatctcaag 120
attgaagttg acgatctgaa gtctgagagg gtgcgtacag agcaccaggt tgatgaggct 180
aaaagaaaag gagaagagat tgaagagaac gttgagaatt ggcttgcaac ggcaaataat 240
gtcattgttg aggcagttaa gtttacagac gatgaagcca ttgcaaataa gcgttgtttc 300
aaggggttat gtcctaattt gaagacccgc cgtcgactta gcaaggaagc agagaggcag 360
aaggaggctg ttgtcaaagt ccgagaagct cgaagatttg atagaatttc ctactgtact 420
gctccagagg atatacggct tatctctaac aaagactacg agcccttcga atcaagaatg 480
ttcactttga ggaatatact cagtgcacta gaagatcccg atgtcaatat acttgggatt 540
tatggtatgg gcggcatcgg aaagacgatg ctggcggaag aaattgctag gaaagtcaag 600
agcgacaaac tctttgatca ggtggttttt gttgaggtgt cccagaatca agacatacga 660
aagattcaag gagaaatcgg agataaacta ggcctgaagt ttcatgagga gagtgaatca 720
ggaagggcga acagcttatt tacacgtata aaagcagaga agaagatctt gataattcta 780
gacaacattt gggaaaatct tgatttgcgg gttgtcggaa ttccacatgg agatggtcat 840
aaaggttgta aagtactgtt gacggccaga agtcaagatg tattgtctgg gaagatggat 900
tctcgaccaa atttctcaat tggtgttcta aacggagaag aagcttggag tctattcaag 960
aagatggcag gtgattatat tgaagatagt gaattccaat cgatagcaag ggatgtggca 1020
aaggaatgtg caggtttgcc tatttccatt gtgacgatag cgagggcatt aaggaacaag 1080
agattatttg aatggaagga tgcgttggaa caactaagaa ggccatcctc aacgaatttc 1140
aaagacatac agccaactgc atataaagca atagagttga gttacaacaa attagaaggg 1200
gaggagctca agaacatcct tttgctaata ggatatacag ccatatcatc cattgatgcc 1260
ttgttaatgt gtggtatggg attgggttta tttcaaggtg tcaataagat ggaagtagca 1320
cgagctcgag tactgacctt ggtgcacaaa ctcaaagctt cttgcatgtt gctagaccat 1380
ataagcaaga aggaagagtt cttttccatg catgatgtcg ttcgcgatgt tgccatatca 1440
attgcatcta gagagcaaaa tgcattgaca gcgacaaatg agcaggttga tggtttcagg 1500
gaatggtcag acgaaagtgc agtaaagcgt tacacttcga tcgtcttaca tgatgtcagg 1560
actaatgtgc ttcctgaagt agtggaatgt cctcaactca aacttctttt tataagtgcg 1620
gataaggaat cttcatcatt aaccattcca aacaattttt tcaagaggat gatacaggtc 1680
agagttataa acttgactta catgaatcta ctgtcactgc cttcaacact tggttttctg 1740
ttaaaccttc gagcactgag tttgtgttat tgcaaattgc tagatataag tgttatagga 1800
ggcttgaata aactagaaat cctttgttta agaggctctg acattaagca gctgccaaca 1860
gaagtaggtc aattgacttg gctaaccttg cttgatttga gagaatgtag gaaactagaa 1920
gttatcccac caaatgtttt atcaaattta tcccatttag aagaactata cataagttgt 1980
agaagctttc aaaaatggga ggtggaggtg gaaggggtta agaatgctag cgttgaggag 2040
ttgaagcatt tgcctaactt gacctcttta gaattagaca tccatgatgt caacactctg 2100
cccagaggct tgttcttgga gaagctggaa aagtacagaa tacgtattgg agattggtat 2160
tgggagagca ccaacatttg gcgtagagaa ttcagactca ggctgaacaa caagatttgc 2220
ttgaaggatt ggctgatcgt gcaactgcag ggaattgaag accttgaatt acgtgaattg 2280
caagagcaag atgtcaatta ttttgctaat gaattaggca aagtgggttc ttcagaactc 2340
aagtttctca ggatccatgg ttgcagcgac gccctcaatc cgccggcaga gtcaaagaga 2400
caggaggaat cagcaaatga tatgcagtcg aatgaaatca ttttggagga caatgttaat 2460
atttctaata cacttttcat tgagaaggtt gcgttaccaa agttggagaa gttggcggtg 2520
cgttcaataa atattgagag aatttggcaa aaccaagttg cagccatgac ttgcggtatt 2580
gagaatttaa cgcacttgac gctgtacaac tgtatgaatt taagatgtct attttcatct 2640
tctacggtta gcgataacat ctttgttcga ctccaataca ttgagataga aaaatgtcat 2700
gtcttggaag agttaatagt catggacaac caagaagaag aaaggaagaa taatattgta 2760
atgtttcctc agttacaata tctgaagatg tatgatcttg aaaaactcac aagcttcagc 2820
acaggagatg tacatatgtt tgaatttcca tccttgaaag aattatggat atctcggtgt 2880
cctgagttca tggtgagatt taaaagaact actaatgact tgacaaaaaa ggtgtttccc 2940
aatttggagg agttgatagt agatgcaaag tatataataa caaataaatt tatattttca 3000
gaagacttgc tgtgcaaact taaatgcctt gatgttgtgt ttgttgatga gttgactact 3060
attttatcac ttgatgattt cctccagaga tttcacaccc tgaaagttct ccaaatagaa 3120
ggatatagtg attggttgcc aaaagaaaag gttgaaaatg ggatggaggt aatcataaga 3180
agagtgttca ggtgttatga cctgaagtac atcttgaaac aagagtcctc ctctattatg 3240
aacgatttgg ttattctaca tgtaacgaat tgtcaccgtt tgatcaatct agtgccatcc 3300
tcgacatcct ttcagaatct tacaagtttg gagatatcgt attgcaacgg attgaaaaac 3360
gtattaacat tctcaattgc aaagactctg gtgcgactca gagaaatgaa gatagaatca 3420
tgtgctatga taacagaaat agtcctggca gatgatgacg atgatcgtga tgcagcgaaa 3480
gatgaggtta ttgctttcag cgaattgaaa gagttgaagc ttttaaattt aaaaagtctg 3540
agaagcttct accccggcaa tcgtgccttg aatttcccat ctttggaaag attactggtg 3600
gatgattgca ccaatatgaa aagtttctct agaggagaat taagcacacc cgtgttacac 3660
aaagtgcagc tgaataggtg ggacgaagca tgttgggctt ggaaggaggg tttaaataca 3720
accattgaac aggtaaatct tcagaaggaa ggcttcctca agaagcgtcg tgaagctcct 3780
ccatcccagc aattcctttc tttcgctcct gcccccaatc tcaatctcca aactaggttg 3840
gaaattttgc ccgcgatggt tgctggcgtt tggtcagatg acaacaactt gcagctggaa 3900
gcaactactc agttccgaaa actgctttca aatgagagga gtctaccaac ttag 3954
<210> 2
<211> 1317
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Ala Glu Ile Ile Leu Thr Ile Val Val Glu Val Val Lys Cys Leu
1 5 10 15
Ala Pro Pro Ala Tyr Arg Gln Ile Ser Tyr Leu Arg Glu Ser Lys Tyr
20 25 30
Met Ser Asn Leu Gln Asn Leu Lys Ile Glu Val Asp Asp Leu Lys Ser
35 40 45
Glu Arg Val Arg Thr Glu His Gln Val Asp Glu Ala Lys Arg Lys Gly
50 55 60
Glu Glu Ile Glu Glu Asn Val Glu Asn Trp Leu Ala Thr Ala Asn Asn
65 70 75 80
Val Ile Val Glu Ala Val Lys Phe Thr Asp Asp Glu Ala Ile Ala Asn
85 90 95
Lys Arg Cys Phe Lys Gly Leu Cys Pro Asn Leu Lys Thr Arg Arg Arg
100 105 110
Leu Ser Lys Glu Ala Glu Arg Gln Lys Glu Ala Val Val Lys Val Arg
115 120 125
Glu Ala Arg Arg Phe Asp Arg Ile Ser Tyr Cys Thr Ala Pro Glu Asp
130 135 140
Ile Arg Leu Ile Ser Asn Lys Asp Tyr Glu Pro Phe Glu Ser Arg Met
145 150 155 160
Phe Thr Leu Arg Asn Ile Leu Ser Ala Leu Glu Asp Pro Asp Val Asn
165 170 175
Ile Leu Gly Ile Tyr Gly Met Gly Gly Ile Gly Lys Thr Met Leu Ala
180 185 190
Glu Glu Ile Ala Arg Lys Val Lys Ser Asp Lys Leu Phe Asp Gln Val
195 200 205
Val Phe Val Glu Val Ser Gln Asn Gln Asp Ile Arg Lys Ile Gln Gly
210 215 220
Glu Ile Gly Asp Lys Leu Gly Leu Lys Phe His Glu Glu Ser Glu Ser
225 230 235 240
Gly Arg Ala Asn Ser Leu Phe Thr Arg Ile Lys Ala Glu Lys Lys Ile
245 250 255
Leu Ile Ile Leu Asp Asn Ile Trp Glu Asn Leu Asp Leu Arg Val Val
260 265 270
Gly Ile Pro His Gly Asp Gly His Lys Gly Cys Lys Val Leu Leu Thr
275 280 285
Ala Arg Ser Gln Asp Val Leu Ser Gly Lys Met Asp Ser Arg Pro Asn
290 295 300
Phe Ser Ile Gly Val Leu Asn Gly Glu Glu Ala Trp Ser Leu Phe Lys
305 310 315 320
Lys Met Ala Gly Asp Tyr Ile Glu Asp Ser Glu Phe Gln Ser Ile Ala
325 330 335
Arg Asp Val Ala Lys Glu Cys Ala Gly Leu Pro Ile Ser Ile Val Thr
340 345 350
Ile Ala Arg Ala Leu Arg Asn Lys Arg Leu Phe Glu Trp Lys Asp Ala
355 360 365
Leu Glu Gln Leu Arg Arg Pro Ser Ser Thr Asn Phe Lys Asp Ile Gln
370 375 380
Pro Thr Ala Tyr Lys Ala Ile Glu Leu Ser Tyr Asn Lys Leu Glu Gly
385 390 395 400
Glu Glu Leu Lys Asn Ile Leu Leu Leu Ile Gly Tyr Thr Ala Ile Ser
405 410 415
Ser Ile Asp Ala Leu Leu Met Cys Gly Met Gly Leu Gly Leu Phe Gln
420 425 430
Gly Val Asn Lys Met Glu Val Ala Arg Ala Arg Val Leu Thr Leu Val
435 440 445
His Lys Leu Lys Ala Ser Cys Met Leu Leu Asp His Ile Ser Lys Lys
450 455 460
Glu Glu Phe Phe Ser Met His Asp Val Val Arg Asp Val Ala Ile Ser
465 470 475 480
Ile Ala Ser Arg Glu Gln Asn Ala Leu Thr Ala Thr Asn Glu Gln Val
485 490 495
Asp Gly Phe Arg Glu Trp Ser Asp Glu Ser Ala Val Lys Arg Tyr Thr
500 505 510
Ser Ile Val Leu His Asp Val Arg Thr Asn Val Leu Pro Glu Val Val
515 520 525
Glu Cys Pro Gln Leu Lys Leu Leu Phe Ile Ser Ala Asp Lys Glu Ser
530 535 540
Ser Ser Leu Thr Ile Pro Asn Asn Phe Phe Lys Arg Met Ile Gln Val
545 550 555 560
Arg Val Ile Asn Leu Thr Tyr Met Asn Leu Leu Ser Leu Pro Ser Thr
565 570 575
Leu Gly Phe Leu Leu Asn Leu Arg Ala Leu Ser Leu Cys Tyr Cys Lys
580 585 590
Leu Leu Asp Ile Ser Val Ile Gly Gly Leu Asn Lys Leu Glu Ile Leu
595 600 605
Cys Leu Arg Gly Ser Asp Ile Lys Gln Leu Pro Thr Glu Val Gly Gln
610 615 620
Leu Thr Trp Leu Thr Leu Leu Asp Leu Arg Glu Cys Arg Lys Leu Glu
625 630 635 640
Val Ile Pro Pro Asn Val Leu Ser Asn Leu Ser His Leu Glu Glu Leu
645 650 655
Tyr Ile Ser Cys Arg Ser Phe Gln Lys Trp Glu Val Glu Val Glu Gly
660 665 670
Val Lys Asn Ala Ser Val Glu Glu Leu Lys His Leu Pro Asn Leu Thr
675 680 685
Ser Leu Glu Leu Asp Ile His Asp Val Asn Thr Leu Pro Arg Gly Leu
690 695 700
Phe Leu Glu Lys Leu Glu Lys Tyr Arg Ile Arg Ile Gly Asp Trp Tyr
705 710 715 720
Trp Glu Ser Thr Asn Ile Trp Arg Arg Glu Phe Arg Leu Arg Leu Asn
725 730 735
Asn Lys Ile Cys Leu Lys Asp Trp Leu Ile Val Gln Leu Gln Gly Ile
740 745 750
Glu Asp Leu Glu Leu Arg Glu Leu Gln Glu Gln Asp Val Asn Tyr Phe
755 760 765
Ala Asn Glu Leu Gly Lys Val Gly Ser Ser Glu Leu Lys Phe Leu Arg
770 775 780
Ile His Gly Cys Ser Asp Ala Leu Asn Pro Pro Ala Glu Ser Lys Arg
785 790 795 800
Gln Glu Glu Ser Ala Asn Asp Met Gln Ser Asn Glu Ile Ile Leu Glu
805 810 815
Asp Asn Val Asn Ile Ser Asn Thr Leu Phe Ile Glu Lys Val Ala Leu
820 825 830
Pro Lys Leu Glu Lys Leu Ala Val Arg Ser Ile Asn Ile Glu Arg Ile
835 840 845
Trp Gln Asn Gln Val Ala Ala Met Thr Cys Gly Ile Glu Asn Leu Thr
850 855 860
His Leu Thr Leu Tyr Asn Cys Met Asn Leu Arg Cys Leu Phe Ser Ser
865 870 875 880
Ser Thr Val Ser Asp Asn Ile Phe Val Arg Leu Gln Tyr Ile Glu Ile
885 890 895
Glu Lys Cys His Val Leu Glu Glu Leu Ile Val Met Asp Asn Gln Glu
900 905 910
Glu Glu Arg Lys Asn Asn Ile Val Met Phe Pro Gln Leu Gln Tyr Leu
915 920 925
Lys Met Tyr Asp Leu Glu Lys Leu Thr Ser Phe Ser Thr Gly Asp Val
930 935 940
His Met Phe Glu Phe Pro Ser Leu Lys Glu Leu Trp Ile Ser Arg Cys
945 950 955 960
Pro Glu Phe Met Val Arg Phe Lys Arg Thr Thr Asn Asp Leu Thr Lys
965 970 975
Lys Val Phe Pro Asn Leu Glu Glu Leu Ile Val Asp Ala Lys Tyr Ile
980 985 990
Ile Thr Asn Lys Phe Ile Phe Ser Glu Asp Leu Leu Cys Lys Leu Lys
995 1000 1005
Cys Leu Asp Val Val Phe Val Asp Glu Leu Thr Thr Ile Leu Ser Leu
1010 1015 1020
Asp Asp Phe Leu Gln Arg Phe His Thr Leu Lys Val Leu Gln Ile Glu
1025 1030 1035 1040
Gly Tyr Ser Asp Trp Leu Pro Lys Glu Lys Val Glu Asn Gly Met Glu
1045 1050 1055
Val Ile Ile Arg Arg Val Phe Arg Cys Tyr Asp Leu Lys Tyr Ile Leu
1060 1065 1070
Lys Gln Glu Ser Ser Ser Ile Met Asn Asp Leu Val Ile Leu His Val
1075 1080 1085
Thr Asn Cys His Arg Leu Ile Asn Leu Val Pro Ser Ser Thr Ser Phe
1090 1095 1100
Gln Asn Leu Thr Ser Leu Glu Ile Ser Tyr Cys Asn Gly Leu Lys Asn
1105 1110 1115 1120
Val Leu Thr Phe Ser Ile Ala Lys Thr Leu Val Arg Leu Arg Glu Met
1125 1130 1135
Lys Ile Glu Ser Cys Ala Met Ile Thr Glu Ile Val Leu Ala Asp Asp
1140 1145 1150
Asp Asp Asp Arg Asp Ala Ala Lys Asp Glu Val Ile Ala Phe Ser Glu
1155 1160 1165
Leu Lys Glu Leu Lys Leu Leu Asn Leu Lys Ser Leu Arg Ser Phe Tyr
1170 1175 1180
Pro Gly Asn Arg Ala Leu Asn Phe Pro Ser Leu Glu Arg Leu Leu Val
1185 1190 1195 1200
Asp Asp Cys Thr Asn Met Lys Ser Phe Ser Arg Gly Glu Leu Ser Thr
1205 1210 1215
Pro Val Leu His Lys Val Gln Leu Asn Arg Trp Asp Glu Ala Cys Trp
1220 1225 1230
Ala Trp Lys Glu Gly Leu Asn Thr Thr Ile Glu Gln Val Asn Leu Gln
1235 1240 1245
Lys Glu Gly Phe Leu Lys Lys Arg Arg Glu Ala Pro Pro Ser Gln Gln
1250 1255 1260
Phe Leu Ser Phe Ala Pro Ala Pro Asn Leu Asn Leu Gln Thr Arg Leu
1265 1270 1275 1280
Glu Ile Leu Pro Ala Met Val Ala Gly Val Trp Ser Asp Asp Asn Asn
1285 1290 1295
Leu Gln Leu Glu Ala Thr Thr Gln Phe Arg Lys Leu Leu Ser Asn Glu
1300 1305 1310
Arg Ser Leu Pro Thr
1315
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ctgccccatt ttgttgcagt cac 23
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ctaagaaatg aatctggcta cggc 24
<210> 5
<211> 378
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggtttcaggg aatggtcaga cgaaagtgca gtaaagcgtt acacttcgat cgtcttacat 60
gatgtcagga ctaatgtgct tcctgaagta gtggaatgtc ctcaactcaa acttcttttt 120
ataagtgcgg ataaggaatc ttcatcatta accattccaa acaatttttt caagaggatg 180
atacaggtca gagttataaa cttgacttac atgaatctac tgtcactgcc ttcaacactt 240
ggttttctgt taaaccttcg agcactgagt ttgtgttatt gcaaattgct agatataagt 300
gttataggag gcttgaataa actagaaatc ctttgtttaa gaggctctga cattaagcag 360
ctgccaacag aagtaggt 378
<210> 6
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agaaggcctc catggggatc cggtttcagg gaatggtcag acg 43
<210> 7
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgtcttcggg acatgcccgg gacctacttc tgttggcagc tg 42
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccgaccgtat gagcaaggaa a 21
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ttcctgtgga caatggatgg a 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
<210> 11
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccaaggtcag tactcgagct c 21
Claims (9)
1. An FcCGA 1 gene related to citrus disease resistance, wherein the nucleotide sequence of the FcCGA 1 gene comprises a sequence shown as SEQ ID No. 1.
2. The gene of claim 1, wherein the protein encoded by the FcCGA 1 gene comprises the amino acid sequence shown in SEQ ID No. 2.
3. The primer set for amplifying the gene of claim 1 or 2, wherein the primer set comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown as SEQ ID No. 3; the nucleotide sequence of the reverse primer is shown as SEQ ID No. 4.
4. A silencing vector comprising the gene of claim 1 or 2.
5. A method of producing the silencing vector of claim 4, comprising the steps of:
connecting a specific fragment of the FcCGA 1 gene between BamHI and Sma I enzyme cutting sites of pTRV2 to obtain a silencing vector;
the nucleotide sequence of the specific fragment of the FcCGA 1 gene is shown as SEQ ID No. 5.
6. Use of the gene of claim 1 or 2, or the primer pair of claim 3, or the silencing vector of claim 4, or the silencing vector prepared by the preparation method of claim 5, for breeding a new citrus variety.
7. Use of the gene of claim 1 or 2 or the primer pair of claim 3 for increasing disease resistance in citrus.
8. The use of claim 7, wherein the disease resistance comprises resistance to bacterial disease.
9. Use according to claim 8, wherein the bacterial disease comprises an ulcer disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110776134.2A CN113388620B (en) | 2021-07-09 | 2021-07-09 | FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110776134.2A CN113388620B (en) | 2021-07-09 | 2021-07-09 | FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113388620A true CN113388620A (en) | 2021-09-14 |
| CN113388620B CN113388620B (en) | 2022-08-26 |
Family
ID=77625666
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110776134.2A Active CN113388620B (en) | 2021-07-09 | 2021-07-09 | FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113388620B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201210484D0 (en) * | 2012-06-13 | 2012-07-25 | Eberhard Karls Universitaet Tuebingen | A novel pattern recognition receptor in plants and chimeras thereof for use against bacterial infections |
| CN102770545A (en) * | 2010-02-24 | 2012-11-07 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and a method for making the same |
| CN103354715A (en) * | 2011-01-14 | 2013-10-16 | 双刃基金会 | Citrus trees with resistance to citrus canker |
| CN103882031A (en) * | 2014-01-03 | 2014-06-25 | 上海交通大学 | Citrus canker susceptible gene CsLOB |
| US20160227789A1 (en) * | 2015-02-06 | 2016-08-11 | University Of Florida Research Foundation, Inc. | Bacteria and method for improving plant health and growth |
| CN110283824A (en) * | 2019-07-25 | 2019-09-27 | 西南大学 | A method of using CsXTH04 gene silencing to improve citrus to canker resistance |
-
2021
- 2021-07-09 CN CN202110776134.2A patent/CN113388620B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102770545A (en) * | 2010-02-24 | 2012-11-07 | 巴斯夫植物科学有限公司 | Plants having enhanced yield-related traits and a method for making the same |
| CN103354715A (en) * | 2011-01-14 | 2013-10-16 | 双刃基金会 | Citrus trees with resistance to citrus canker |
| GB201210484D0 (en) * | 2012-06-13 | 2012-07-25 | Eberhard Karls Universitaet Tuebingen | A novel pattern recognition receptor in plants and chimeras thereof for use against bacterial infections |
| CN103882031A (en) * | 2014-01-03 | 2014-06-25 | 上海交通大学 | Citrus canker susceptible gene CsLOB |
| US20160227789A1 (en) * | 2015-02-06 | 2016-08-11 | University Of Florida Research Foundation, Inc. | Bacteria and method for improving plant health and growth |
| CN110283824A (en) * | 2019-07-25 | 2019-09-27 | 西南大学 | A method of using CsXTH04 gene silencing to improve citrus to canker resistance |
Non-Patent Citations (5)
| Title |
|---|
| JGI: ""Phytozome Gene Report: Ciclev10004102m.g https://phytozome-next.jgi.doe.gov/report/gene/Cclementi"", 《JGI PHYTOZOME 13》 * |
| NCBI: ""PREDICTED: Citrus sinensis disease resistance protein At4g27190-like (LOC102629151), mRNA"", 《GENBANK DATABASE》 * |
| YAO LIXIAO等: ""Function of Citrus Bacterial Canker Resistance-Related Transcription Factor CitMYB20"", 《SCIENTIA AGRICULTURA SINICA》 * |
| 戴文珊: ""金柑转录因子FcWRKY40抗逆功能鉴定及作用机制解析"", 《万方数据》 * |
| 梅鹏颖: ""CsrbohA/D与柑桔抗溃疡病相关性的研究"", 《万方数据》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113388620B (en) | 2022-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543228A (en) | Method for transforming rice into fragrant rice rapidly | |
| CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
| CN110028566B (en) | GhPRXR1 protein and application of coding gene thereof in regulating and controlling oil content of cottonseed | |
| Peng et al. | CsAKT1 is a key gene for the CeO 2 nanoparticle's improved cucumber salt tolerance: a validation from CRISPR-Cas9 lines | |
| CN110358776B (en) | Rhizoctonia solani pathogenic related gene and application thereof | |
| CN110862996A (en) | Application of isolated soybean gene in improving soybean cyst nematode resistance | |
| CN113388620B (en) | FcCGA 1 gene related to citrus disease resistance, primer pair, silencing vector and application | |
| CN113444734A (en) | Preparation method and application of salt-tolerant transgenic poplar | |
| CN116444636B (en) | Rice OsGLP3-6 for inhibiting sclerotinia and application thereof | |
| CN116355067B (en) | Rice OsGLP8-12 for inhibiting sclerotinia and application thereof | |
| CN110627886B (en) | Method for cultivating transgenic leguminous plant with increased root nodule size and application of transgenic leguminous plant | |
| CN110229223A (en) | Wheat anti-powdery mildew correlation BFR albumen and its encoding gene and application | |
| CN103215307B (en) | Genetic transformation method of agrobacterium-induced plum blossom mature cotyledon regeneration system | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN113429467B (en) | Application of NPF7.6 protein in regulation and control of nitrogen tolerance of leguminous plant root nodule | |
| CN107987139A (en) | A kind of Dof transcription factors and its application in terms of plant salt tolerance is improved | |
| CN107602675B (en) | Nostoc flagelliforme Nfcuspin 1 drought-resistant gene and amino acid sequence and application thereof | |
| CN102533804A (en) | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application | |
| CN105950644A (en) | Chalcone isomerase gene of asparaguses, protein encoded by chalcone isomerase gene and application of chalcone isomerase gene | |
| CN106434742B (en) | Utilize the method for soybean expression canine distemper albumen | |
| CN111808832A (en) | Gene of cation transfer ATP enzyme of rhizoctonia solani, fragment Rscta thereof and application | |
| CN112266419B (en) | Artificially synthesized herbicide-resistant protein | |
| CN114181290B (en) | Protein for regulating and controlling plant nitrogen utilization efficiency and yield and application thereof | |
| CN117430682A (en) | Phenethyl alcohol synthesis related protein derived from roses, coding gene RrHX2G284700 and application thereof | |
| CN118108817A (en) | Protein derived from rose phenethyl alcohol synthesis and coding gene RrHX G119800 thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |