CN113373227A

CN113373227A - Use of VAV2 in predicting sensitivity and prognosis of radiotherapy in a patient

Info

Publication number: CN113373227A
Application number: CN202110668446.1A
Authority: CN
Inventors: 林东昕; 吴晨; 苗传望; 刘伟玲; 席奕轶; 陈新杰; 牛香洁; 谭文
Original assignee: Cancer Hospital and Institute of CAMS and PUMC
Current assignee: Cancer Hospital and Institute of CAMS and PUMC
Priority date: 2021-06-16
Filing date: 2021-06-16
Publication date: 2021-09-10
Anticipated expiration: 2041-06-16
Also published as: CN113373227B

Abstract

The present invention provides for the novel use of the biomarker VAV2 in predicting the sensitivity to radiation therapy in a patient or predicting the prognosis of a patient, and provides for the use of an inhibitor of VAV2 in treating a patient. Preferably, the patient is diagnosed with cancer; more preferably, the patient is diagnosed with esophageal cancer. Preferably, the treatment comprises improving prognosis and increasing sensitivity to radiotherapy.

Description

Use of VAV2 in predicting sensitivity and prognosis of radiotherapy in a patient

Technical Field

The invention relates to the field of biotechnology, in particular to application of VAV2 in predicting radiotherapy sensitivity and prognosis of a patient.

Background

Esophageal cancer is one of the most serious malignant tumors worldwide, and has the defects of difficult early diagnosis, high malignancy degree, poor prognosis and five-year survival rate of only 25-40%. Early symptoms of esophageal cancer are not obvious, most patients mostly see a middle-late stage at the time of treatment, the chance of operation is lost, and comprehensive treatment mainly based on radiotherapy has important significance. However, due to the resistance of esophageal cancer radiotherapy, most patients have poor final curative effect and poor clinical benefit. In addition, the individual radiotherapy curative effect and prognosis of esophageal cancer also have great difference. However, no effective marker can well predict the radiotherapy curative effect and clinical prognosis of esophageal cancer at present. The discovery of new biomarkers to accurately predict and evaluate the sensitivity of esophageal cancer radiotherapy so as to adjust the treatment scheme in time is an important aspect of individualized and precise treatment.

In the research, a novel esophageal cancer radiotherapy curative effect prediction marker VAV2 is analyzed and found by constructing a PDX (PDX) mouse model and combining with sequencing data of a Patient, the VAV2 gene is found to influence the radiotherapy sensitivity of esophageal cancer cells and the prognosis of the Patient for the first time, and the gene serving as a novel biomarker has a prediction effect on the radiotherapy sensitivity and the prognosis of the esophageal cancer Patient, and the targeted molecule has a good radiotherapy sensitivity enhancing effect and an anti-tumor curative effect.

Disclosure of Invention

Predicting patient sensitivity to radiation therapy or predicting patient prognosis

In one aspect, the invention provides the use of an agent for detecting the expression level of VAV2 in the preparation of a product for predicting the sensitivity of a patient to radiation therapy or predicting the prognosis of a patient.

Preferably, the patient is diagnosed with cancer.

Preferably, the cancer comprises cervical cancer, seminoma, testicular lymphoma, prostate cancer, ovarian cancer, lung cancer, rectal cancer, breast cancer, cutaneous squamous cell carcinoma, colon cancer, liver cancer, pancreatic cancer, gastric cancer, esophageal cancer, thyroid cancer, transitional epithelial carcinoma of the bladder, leukemia, brain tumor, gastric cancer, peritoneal cancer, head and neck cancer, endometrial cancer, kidney cancer, cancer of the female reproductive tract, carcinoma in situ, neurofibroma, bone cancer, skin cancer, gastrointestinal stromal tumor, mast cell tumor, multiple myeloma, melanoma, glioma, and sarcoma.

Preferably, the cancer is esophageal cancer.

Preferably, the esophageal cancer includes, but is not limited to, esophageal squamous carcinoma and esophageal adenocarcinoma.

Preferably, the indicators of prognosis include Objective Remission Rate (ORR), Overall survival Rate (Overall survival Rate, OS), progression-free survival (PFS), Time To Progression (TTP), Disease-free survival (DFS), time to failure To Treat (TTF), Response Rate (RR), Complete Response (CR), Partial Response (PR).

Preferably, the indicator of prognosis is overall survival.

Preferably, the prognostic indicator is overall survival at 1-100 months.

Preferably, the prognostic indicator is overall survival of 1-50 months.

Preferably, the evaluation criteria for sensitivity to radiotherapy is in terms of solid tumor RECIST evaluation criteria that can evaluate recent efficacy of a patient as a chemoradiotherapy sensitive group (PR) and a resistant group (SD).

Preferably, the sensitivity to radiotherapy refers to the degree of death, injury or other effects of the body or cells, tissues, organs in radiotherapy.

Preferably, the radiation comprises ionizing radiation, particle beam radiation.

Preferably, the particle beam comprises electrons, protons, neutrons, heavy ions such as carbon ions or mesons.

Preferably, the ionizing radiation comprises x-ray radiation, ultraviolet radiation, infrared radiation, gamma-ray radiation or microwave radiation.

Preferably, the VAV2 is highly expressed in patients resistant to radiotherapy.

Preferably, the VAV2 is highly expressed in patients with poor prognosis.

Preferably, the expression comprises mRNA expression and/or protein expression.

Preferably, the reagent for detecting the expression level of VAV2 comprises a reagent for detecting the expression level of VAV2 mRNA and/or the expression level of VAV2 protein.

Preferably, the reagent for detecting the expression level of VAV2 mRNA comprises the following reagents used in the following methods: PCR-based detection methods, Southern hybridization, Northern hybridization, dot hybridization, Fluorescence In Situ Hybridization (FISH), DNA microarrays, ASO methods, high throughput sequencing platforms.

Preferably, the PCR-based quantitative detection method includes a step of reverse-transcribing mRNA into cDNA and/or a step of measuring the content of cDNA.

Preferably, the method of measuring the content of cDNA includes, but is not limited to, PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM.

Preferably, the reagent for detecting the expression level of VAV2 mRNA comprises a specific primer and/or a probe.

Preferably, the reagent for detecting the mRNA expression amount comprises a reagent required by q-PCR (qPCR) detection;

preferably, the reagents required for the q-PCR detection include an upstream primer with a sequence shown as SEQ ID NO. 1 and a downstream primer with a sequence shown as SEQ ID NO. 2.

Preferably, the reagent for detecting the expression level of the VAV2 protein comprises the reagents used in the following methods: enzyme-linked immunosorbent assay (ELISA), Radioimmunoassay (RIA), sandwich assay, western blot, flow cytometry, Fluorescence Assisted Cell Sorting (FACS), enzyme substrate chromogenic assay and antigen-antibody aggregation, mass spectrometry, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, flow cytofluorimetry, and protein chips.

Preferably, the reagent for detecting the expression level of the VAV2 protein comprises a reagent used for immunohistochemical staining.

Preferably, the reagent for detecting the expression level of the VAV2 protein comprises an antibody or a fragment of VAV2, and the antibody or the fragment of VAV2 can be specifically combined with the VAV2 protein.

Preferably, the reagent for detecting the expression level of the VAV2 protein further comprises a secondary antibody, and the secondary antibody can be combined with the antibody of the VAV2 or the fragment thereof and develops color.

Preferably, the chromogenic color-developing agent comprises fluorescein, enzyme, metal ions and isotopes.

Preferably, the antibody or fragment thereof to VAV2 also binds to a marker that is detected to indicate both expression of VAV2 protein.

Preferably, the label comprises a fluorescent molecule and a chemiluminescent label.

Preferably, the fluorescent molecule comprises FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC Red 460.

Preferably, the chemiluminescent label comprises peroxidase, alkaline phosphatase, luciferase, aequorin, a functionalized iron-porphyrin derivative, luminol, isoluminol, acridinium ester, sulfonamide.

Preferably, reagents and/or instruments for collecting and processing the sample are also included in the product.

Preferably, the sample comprises: tissue (tissue specimen), blood, serum, plasma, urine, saliva, semen, milk, cerebrospinal fluid, tears, sputum, mucus, lymph, cytosol, ascites, pleural effusion, amniotic fluid, bladder irrigation fluid and bronchoalveolar lavage fluid.

Preferably, the sample is a tissue.

Preferably, the tissue may also contain other compounds, such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics.

Preferably, the tissue may be a preserved tissue sample, such as a formalin-fixed, paraffin-embedded tissue sample or a frozen tissue sample.

Preferably, the marker VAV2 of the present invention can be used in combination with γ H2AX, and the expression level of VAV2 is inversely correlated with the expression level of γ H2 AX.

Preferably, the marker VAV2 of the present invention can be used in combination with other cancer markers.

Use for treating patients

In a further aspect the present invention provides the use of an inhibitor of VAV2 in the manufacture of a product for the treatment of a patient, said patient being in accordance with the foregoing.

Preferably, the inhibitor can knock out the VAV2 gene or reduce the expression level of VAV 2.

Preferably, the knockout VAV2 gene may be a knockout of all or part of VAV2 gene, or may be a knockout of regulatory elements such that VAV2 gene is not expressed or is expressed in a reduced amount.

Preferably, the regulatory elements include promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylation sequences, and selectable marker genes.

Preferably, the inhibitor comprises an agent used in siRNA interference, CRISPR/cas9 method, homologous recombination, gene knockout, gene replacement, gene silencing, site-directed mutagenesis, chemical drug method.

Preferably, the inhibitor is an agent used in a siRNA interference method.

Preferably, the interfering fragment used by the siRNA interference comprises one or more of SEQ ID NO 3-5.

Preferably, the treatment includes reducing the rate of disease progression, halting disease progression, ameliorating a condition, curing a condition, improving prognosis, increasing radiation sensitivity (sensitivity to radiation therapy), preventing relapse, prolonging survival, and the like.

Preferably, the treatment comprises increasing sensitivity to radiation therapy and/or improving prognosis.

Preferably, the prognosis is in accordance with the foregoing.

Preferably, the radiotherapy sensitivity is in accordance with the foregoing.

Cell line construction method

In another aspect, the invention provides a method of constructing a cell with reduced radiation resistance and low cell proliferation.

Preferably, the method comprises interfering with the VAV2 gene using siRNA.

Preferably, the cell is a cancer cell.

Preferably, the cell is an esophageal cancer cell.

Preferably, the cells are derived from a patient with esophageal cancer.

In another aspect, the present invention provides a method of constructing a cell having improved radiation resistance and high cell proliferation ability.

Preferably, the method comprises constructing a vector carrying the VAV2 gene, which vector, when introduced into a cell, can overexpress the VAV2 gene.

Preferably, the VAV2 gene includes the full length of the VAV2 gene sequence, a functional fragment thereof, or a mutant with the same function.

Preferably, the vectors include plasmids (expression plasmids, cloning vectors, minicircles, microcarriers, double minichromosomes) and viral vectors.

Preferably, the viral vector comprises a lentiviral vector, an adenoviral vector, an adeno-associated viral expression vector or other type of viral vector.

Preferably, the viral vector is a lentiviral vector.

Preferably, the lentiviral vector includes, but is not limited to, pLKO 0.1-puro, pLKO 0.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO 0.1-CMV-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.l-puro-CMV-TagFP, pLKO.1-puro-CMV-TagFP, pLKO.l-puro-UbFP 635, pLKO-puro-1 xLacO, pLKO-puro-IPTG-3xLacO, pLpLpPcppLP34, pLtDNA56-56-dDNAw, pLKO-3975, pLKO-35/29-LernIJV, pLKO-LJV-Leu-3-Leu-3-L-LR-3-LR-, pGCSIL-GFP and Lenti 6.2/N-Lumio/V5-GW/lacZ.

Preferably, the cell is a cancer cell.

Preferably, the cell is an esophageal cancer cell.

Preferably, the cells are derived from a patient with esophageal cancer.

Method for determining cell proliferation ability

In another aspect the invention provides a method for determining the proliferative capacity of a cell for non-diagnostic purposes, said method comprising detecting the amount of expression of VAV 2.

Preferably, the expression amount of VAV2 includes mRNA expression amount and/or protein expression amount.

Preferably, the method for detecting the expression level of mRNA is as described above.

Preferably, the method for detecting the expression level of the protein is as described above.

Application in detecting cell proliferation capacity

In another aspect, the invention provides the use of a reagent for detecting the expression level of VAV2 in the detection of cell proliferative capacity.

Method

In another aspect, the present invention provides a method for detecting radiation susceptibility in a patient, comprising detecting the amount of expression of VAV2 in the patient.

In another aspect, the invention provides a method of predicting the prognosis of a patient, the method comprising detecting the amount of expression of VAV2 in the patient.

In another aspect the invention provides a method of treating a patient, the method comprising knocking down the VAV2 gene in the patient.

General definitions

The term "marker" or "biomarker" generally refers to a molecule, including a gene, mRNA, protein, that is expressed or secreted in/on a tissue or cell that can be detected by known methods (or methods disclosed herein) and that can predict patient prognosis or predict patient sensitivity to radiation therapy. The marker in the present invention is VAV 2.

The terms "level of expression" or "expression level" are generally used interchangeably and generally refer to the amount of a polynucleotide, mRNA or amino acid product or protein in a biological sample.

The term "expression" generally refers to the process by which information encoded by a gene is converted into structures present and operating in a cell. Thus, according to the present invention, "expression" of a gene may refer to transcription into a polynucleotide, translation into a protein, or even post-translational modification of a protein. Fragments of the transcribed polynucleotide, of the translated protein, or of the post-translationally modified protein should also be considered expressed, whether they are derived from transcripts generated or degraded by alternative splicing, or from post-translational processing of the protein (e.g., by proteolysis).

An "elevated" or "higher" amount or level of a biomarker refers to an amount equal to or greater than the level of expression of the biomarker in a healthy control population that is at least 1.1 fold, e.g., at least 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.3 fold, 2.4 fold, 2.5 fold, 2.6 fold, 2.7 fold, 2.8 fold, 2.9 fold, 3.0 fold, 3.1 fold, 3.2 fold, 3.3 fold, 3.4 fold, or 3.5 fold or more over the level of expression of the biomarker relative to the level of control expression.

By "reduced" or "lower" amount or level of a biomarker is meant that the amount is less than the median amount of the biomarker in a healthy control population, the biomarker is underexpressed relative to the control expression level by at least 1.1 fold, e.g., at least 1.1 fold, 1.2 fold, 1.3 fold, 1.4 fold, 1.5 fold, 1.6 fold, 1.7 fold, 1.8 fold, 1.9 fold, 2.0 fold, 2.1 fold, 2.2 fold, 2.3 fold, 2.4 fold, 2.5 fold, 2.6 fold, 2.7 fold, 2.8 fold, 2.9 fold, 3.0 fold, 3.1 fold, 3.2 fold, 3.3 fold, 3.4 fold, or 3.5 fold or more.

Drawings

FIG. 1 is a Heatmap visual clustering Heatmap comparing transcriptome sequencing data of sensitive versus resistant groups.

Figure 2 is a visual enrichment bar graph of differentially expressed genes using the GO database.

FIG. 3 is a visual enrichment bar graph of differentially expressed genes using the TRRUST database.

FIG. 4 is a graph of comparative experimental results for over-expressing cells and control cells: a is a plate formed by over-expressing cells and control cells after different doses of radiation are irradiated, B is a comparison graph of cell survival curves of the over-expressing cells and the control cells, and p is less than 0.05; c is a graph showing the results of a western experiment conducted on the expression levels of VAV2 in the overexpressing cells and the control cells, and the expression of VAV2 was increased in the cell line overexpressing VAV 2.

FIG. 5 is a graph showing the results of cell proliferation potency measurement using the CCK-8 method.

FIG. 6 is a graph showing the results of comparing the clonogenic capacities of VAV 2-overexpressing cells and control cells using the limiting dilution method, wherein A is a graph showing the results in the absence of radiotherapy and B is a graph showing the results in the presence of radiotherapy.

FIG. 7 is a construction flowchart of the esophageal cancer cell line NCCE 1.

FIG. 8 is a plot of cell proliferation for the NCCE1 cell line and the VAV2 knockdown cell line with and without radiation therapy.

FIG. 9 is a graph comparing the expression of VAV2 in VAV2 knockdown and control cells.

FIG. 10 is a graph showing the results of limiting dilution method for measuring sensitivity to radiotherapy of cells in the case of no radiotherapy and in the case of radiotherapy.

FIG. 11 is a graph showing the results of 3D tumor sphere culture for detecting sensitivity to radiotherapy of cells, wherein A is an image under a microscope, and B is a graph showing the results of comparison of diameters of tumor spheres.

FIG. 12 is a graph showing the comparison of the expression levels of VAV2 in radiotherapy-sensitive and radiotherapy-resistant tissues, A is a comparison of mRNA expression levels, and B is a comparison of immunohistochemical tissue staining results.

Figure 13 is a graph of immunohistochemistry, imaging and HE staining results for VAV2, γ H2AX in radiation sensitive and resistant patients.

FIG. 14 is a graph showing the effect of differentiating between radiotherapy sensitivity and radiotherapy resistance using VAV2, where A is the differential expression data in VAV2 radiotherapy-sensitive patients and radiotherapy-resistant patients, and B is the ROC plot of VAV2 at the time of diagnosis.

FIG. 15 is a graph of the results of a spaerman correlation analysis of immunohistochemical scores for VAV2 and gamma H2 AX.

FIG. 16 is a graph comparing the expression levels of VAV2 in a VAV2 knock-out cell and a control cell in a western experiment.

FIG. 17 is a graph comparing the cell proliferation and metastatic capacity of a cell line knock-out VAV2 with that of a control cell.

FIG. 18 is a graph of VAV2 expression versus prognosis for esophageal cancer patients.

Detailed Description

The present invention will be further described with reference to the following examples, which are intended to be illustrative only and not to be limiting of the invention in any way, and any person skilled in the art can modify the present invention by applying the teachings disclosed above and applying them to equivalent embodiments with equivalent modifications. Any simple modification or equivalent changes made to the following embodiments according to the technical essence of the present invention, without departing from the technical spirit of the present invention, fall within the scope of the present invention.

General procedure

Immunohistochemical staining

(1) Putting the paraffin section into a high-temperature (55-65 ℃) baking oven in advance, and treating the baking oven for at least 1-2 hours to melt the redundant wax.

(2) The melted paraffin sections were immediately put into the dewaxing agent Histo-clear for 15 minutes for dewaxing treatment, and transferred again to a new dewaxing agent Histo-clear solution for 15 minutes to increase the dewaxing efficiency, at which time the sections were seen to be transparent.

(3) And (3) adopting an alkali repairing mode for microwave repairing, adding about 250ml of prepared EDTA antigen repairing liquid into a staining jar, and immersing the section. Firstly, the repairing liquid is heated to boiling for about 3-5 minutes by using high fire, then the repairing liquid is adjusted to microwave low fire for continuously boiling for 15 minutes, and then the dyeing vat is put into water for natural cooling.

(4) And cleaning the cooled section with deionized water for 3 times, wiping water with paper, drawing a closed range around the specimen with a crayon immediately without touching the specimen surface, dripping a peroxidase sealing solution to completely cover the specimen surface, and sealing at room temperature for 10-20 minutes.

(4) Washing the section for 3 times by TBST, wiping off water, dropping the diluted primary antibody on the surface of the specimen without touching the surface of the specimen, adjusting the dosage of the primary antibody according to the area of the specimen to completely cover the specimen, and incubating at 4 ℃ overnight.

(5) The sections were washed 3 times with TBST, wiped dry, and the secondary antibody was dropped onto the surface of the specimen without touching the specimen surface, so that it completely covered the specimen, and incubated at room temperature for 20 minutes.

(6) And washing the slices for 3 times by TBST, wiping off water, adding diluted DAB color development solution, and placing the slices into deionized water to stop color development when the brown change of the specimen appears by naked eyes. The color development process is timed, and the color development time of each slice is kept consistent.

(7) And putting the slices into hematoxylin staining solution for 1-5 minutes, and washing the slices with deionized water.

(5) The slices were placed in a color separation solution (1% ethanol hydrochloride) for 30 seconds and rinsed clean with deionized water.

(6) The slices were placed in a bluing solution for 1.5 minutes and rinsed with deionized water.

(7) The stained sections are sequentially put into gradient alcohol (the alcoholic strength is gradually increased), and paraffin removal agent Histo-clear is used for 20 minutes.

(8) And (3) putting the slices into a ventilation kitchen for naturally airing, sealing the slices by using neutral resin, and carrying out picture scanning and result analysis after air-drying.

Hematoxylin-eosin staining

Hematoxylin-eosin staining is called H & E staining for short, is one of staining methods commonly used in pathological techniques, and is also a cell morphology staining method used in pathological diagnosis.

(2) And immediately putting the melted paraffin sections into a xylene solution as a dewaxing reagent for dewaxing for 15 minutes, and repeating the operation to improve the dewaxing efficiency, wherein the sections are transparent at the moment.

(3) And (3) sequentially putting the dewaxed slices into gradient alcohol (the alcohol content is gradually reduced), respectively soaking the slices for 5 minutes, and then washing the slices with deionized water for 2 times to remove the alcohol.

(4) And putting the slices into hematoxylin staining solution for 3-5 minutes, and washing the slices with deionized water.

(6) And putting the slices into eosin staining solution for 3-5 minutes, and washing the slices with deionized water.

(7) The stained sections were sequentially placed in graded alcohol (alcohol content was gradually increased).

(8) And (4) putting the dyed and dehydrated paraffin sections into dimethylbenzene for 15 minutes, then taking out, putting into a ventilation kitchen, and naturally airing.

(9) And sealing the slices by using neutral resin, air-drying, and then scanning pictures and analyzing results.

3D tumor sphere culture

The 3D tumor ball culture is to culture cells in Matrigel with a three-dimensional support structure by using an in vitro cell culture technology. Compared with a common two-dimensional culture mode, the 3D tumor sphere can model a three-dimensional cell structure and the interaction between cells, and further more reliably reflects the pathophysiology characteristics of tumor tissues. At present, 3D tumor ball culture and culture are widely applied to researches such as tumor efficacy evaluation, stem cell and toxicity screening, and the specific operations of 3D tumor ball culture in the research are as follows:

(1) matrigel (Matrigel matrix) was thawed overnight in a 4 degree freezer the day before use. During the operation, articles possibly contacting the matrigel are all placed into a 4-degree refrigerator for precooling.

(2) Cells were trypsinized, washed three times with PBS, and the cell density was adjusted to 3000-.

(3) Mu.l matrigel was mixed with 250. mu.l cell suspension, mainly without air bubbles, and this step was performed on ice.

(4) And (3) dropping the matrigel mixed with the cells in the step (3) into a 6-hole plate, wherein 3 drops of the matrigel are dropped into each hole. The 6-well plate was inverted and placed in a 37-degree cell incubator to allow the matrigel to solidify.

(5) The 6-well plate is inclined, a proper amount of culture medium is injected along the plate wall gently, the plate is transferred gently, and the plate is placed into a cell culture box for continuous culture.

(6) The culture is continued for 10-14 days, and the liquid is changed every 3 days, so that the single cells can gradually grow into tumor balls.

(7) The morphology of the 3D tumor spheres was observed using a microscope, photographed and tumor volume measured, and analyzed statistically.

Comet assay

Comet assay is also called single cell gel electrophoresis assay, and is a technique for detecting DNA damage degree at single cell level. When a cell is damaged endogenously or exogenously, its DNA structure is destroyed. The cells are fixed in the low-melting-point agarose gel, DNA fragments can leave the positions of cell nuclei to form a tail in the gel under the action of an electric field, the cell nuclei and the tail shapes such as comet can be seen through fluorescent staining, and the DNA damage degree is in direct proportion to the comet tail fluorescence intensity, so the comet experiment common usage reflects the DNA damage degree. The comet method DNA damage detection kit (Kakiji biology) used in the research comprises the following specific steps:

(1) pancreatin of the cells to be detected, washing the cells for 2 times by precooled PBS and resuspending, and adjusting the cell density to 1-3 multiplied by 10⁵One per ml.

(2) Preparing a glass slide and a cover glass, uniformly spreading a first layer of glue on the frosted surface of the glass slide by using a proper amount of agarose gel with a normal melting point (90-100 ℃), immediately covering the glass slide to spread the glue, putting the glass slide into a 4-DEG refrigerator, and slightly sliding the cover glass after the glue is solidified to finish the first layer of glue spreading.

(3) And (3) uniformly mixing 10-15 mu l of cells and a proper amount of low-melting-point (60-80 ℃) gel, dripping the mixture on the first layer of glue finished in the step (3), uniformly spreading the glue, and putting the glue into a 4 ℃ refrigerator again to finish spreading the glue on the second layer.

(4) And continuously spreading 75 mul of low-melting-point (60-80 ℃) agarose gel on the third layer of glue on the second layer of glue, uniformly spreading the glue, and putting the glue into a 4-DEG refrigerator to finish glue spreading.

(5) The slide with gel was placed in a precooled Lysis Buffer (10% DMSO was added in proportion), lysed at 4 ℃ for 2 hours, and gently rinsed with PBS to prevent degumming.

(6) Putting the glass slide into an electrophoresis tank, so that the liquid is not slightly overloaded by 2-3mm, and soaking for 30-60 minutes to ensure that the DNA is easy to denature and migrate. Voltage 25V, electrophoresis for 25-35 minutes.

(7) Slides were removed and rinsed three times in pre-cooled Tris-HCl (pH 7.5) buffer.

(8) Each gel was stained with 20-30. mu.l PI or EB in the dark.

(9) The cover glass was covered, and the excitation light at a wavelength of 515 and 560nm was examined using a fluorescence microscope. The nuclear DNA (comet) and the DNA fragments (comet tail) can be clearly seen, the lengths of the comet tail and the comet head are counted by using Image J software, and the DNA damage degree is indirectly reflected by quantitative analysis.

Example 1 screening of Gene involved in radiotherapy sensitivity in esophageal cancer

In order to find genes related to radiotherapy sensitivity in esophageal cancer, a PDX (PDX) mouse model Derived from esophageal cancer patients is used. The curative effect of radiotherapy of a patient is divided into sensitivity and resistance by carrying out the irradiation treatment on PDX with the same dose. Subsequently, in combination with patient gene sequencing data, differentially expressed genes affecting radiation efficacy were found. And the reliability of the experiment was verified using GO enrichment analysis. The accuracy of the data in the study was verified by enrichment analysis of transcription factors in the TRRUST database.

FIG. 1 is transcriptome sequencing data comparing sensitive versus resistant groups, and a Heatmap visual clustering Heatmap formed using R software for differential genes. Fig. 2 is a visual enrichment analysis bar graph formed by using GO database for differentially expressed genes, and the most significant GO characteristics of the radiotherapy resistant group are found to be extracellular matrix, angiogenesis and the like, which is consistent with the current research report of reducing resistance. FIG. 3 is a bar graph of a TRRUST database visualized enrichment analysis of differentially expressed genes, which shows that transcription factors related to sensitivity to radiation therapy, such as SP1 and HIF1 a.

The above experimental results verify the reliability of the data of the present study.

Example 2 lentivirus construction of VAV2 overexpression cell line validation

We subsequently established by lentivirus construction of VAV2 overexpressing cell lines whether VAV2 is genetically related to radioresistance.

FIG. 4 results of comparative experiments on control cells and cell lines overexpressing VAV2, increased expression of VAV2 in cell lines overexpressing VAV2 was demonstrated by experiments on clonogenic experiments comparing control cells and cell lines overexpressing VAV2, A is a plate formed after irradiation with different doses of radiation, B is a cell survival curve plotted against clonogenic capacity, p <0.05, and C is a graph of the results of western experiments performed on the expression levels of VAV2 in two cells.

FIG. 5 shows the measurement of cell proliferation potency by the CCK-8 method. Experiments show that the proliferation capacity of cells in a control group is obviously inhibited after irradiation, the proliferation of over-expression cells is not obviously influenced by irradiation, and p is less than 0.001.

FIG. 6 shows that the clone forming ability of VAV2 over-expression cell is higher than that of control cell, and the over-expression VAV2 improves the radiation resistance of esophagus cancer.

The above experimental results show that over-expression of VAV2 can improve the radiation resistance of cells.

Example 3 validation of knockdown VAV2 by siRNA interference technique

To further verify that VAV2 is related to radiosensitivity in gene function, we constructed an esophageal cancer primary cell line, designated NCCE1, using tumor tissue derived from esophageal cancer patients, the construction procedure is shown in fig. 7.

Knock-down of VAV2 by siRNA interference technique, siRNA interference sequence: gggacgacaucuacgagga (SEQ ID NO:5) the specific steps were as follows:

(1) cells with good growth state are transferred to a 6-well plate on the day before transfection, 35-55 ten thousand cells per well ensure that the cell growth density is 40-60% during transfection.

(2) Cells were washed 3 times in PBS before transfection and 1ml of Opti-MEM medium was added to wait for transfection.

(3) An appropriate amount of siRNA was first added to 250. mu.l of Opti-MEM, gently mixed and incubated for 5 minutes at room temperature.

(4) This was gently mixed with 250. mu.l of Opti-MEM using the transfection reagent Lipofectamine (TM) 2000 and incubated for 5 minutes at room temperature.

(5) Mixing the step 3 and the step 4 together, gently and uniformly blowing, and incubating for 20 minutes at room temperature.

(6) And (3) uniformly dripping the transfection solution in the step (5) into a 6-hole plate, putting the plate into an incubator for 6-8 hours, and then replacing a normal culture medium.

After the cells were attached, the irradiated groups received 4Gy of radiation. Cell proliferation capacity was measured every 24 hours and cell proliferation curves were plotted, with the results shown in figure 8, p <0.01, p <0.001, p < 0.0001. The experimental result proves that compared with the cells of the control group, the VAV2 knocked-down cells have more obvious inhibition of the proliferation capacity after being irradiated.

In addition, we used limiting dilution method to verify that the experimental results are shown in a western result chart of fig. 9 and fig. 10 (without radiotherapy and radiotherapy), and the experimental results prove that the expression level of VAV2 of the VAV2 knock-down group is reduced, and the clonogenic capacity of the cells is remarkably reduced after VAV2 knock-down.

Finally, the same phenomenon was observed in the 3D tumor spheronization experiments, verifying the reliability of the results (fig. 11, 3D tumor spheroids culture tested for sensitivity to cellular radiotherapy,. p <0.01,. p < 0.001).

The above experiments demonstrate that VAV2 is functionally related to radiosensitivity in gene, knocking down increased radiosensitivity of VAV2 esophageal cancer. Targeting or inhibiting VAV2 may have a clinical effect of radiosensitization.

Example 4 comparison of VAV2 expression levels in radiotherapy-sensitive and resistant patients

To clarify whether VAV2 could act as a biomarker of resistance to radiotherapy, we compared the expression levels of VAV2 mRNA in patients with sensitivity to radiotherapy and PDX tissue:

the mRNA detection method comprises the following steps: RNA from a patient tumor tissue sample was extracted and reverse transcribed to cDNA using the PrimeScriptTM RT Reagent Kit. Q-PCR quantitative analysis is carried out by a SYBRGreen dye method, the primer sequence adopted by the ABI 7900HT real-time quantitative PCR instrument for carrying out experimental operation is (F: TCAGGCCTTTTCCCTCAGAG; R: TGCACCTCCACCTTGATGAT), and the relative expression quantity of the VAV2 gene mRNA is finally calculated by analyzing the experimental result by SDS 2.3 software.

Detection of protein levels was performed using immunohistochemical staining in a general procedure. The results demonstrated that the mRNA of VAV2 was significantly increased in the radiation-resistant group (fig. 12A, p ═ 0.039). Immunohistochemical staining of radiation resistant groups developed greater levels of VAV2 (fig. 12B).

The experiments prove that in the tissues of a patient resistant to radiotherapy, the mRNA level and the protein level of VAV2 are remarkably increased, and VAV2 can be used as a biomarker resistant to radiotherapy.

Example 5 clinical validation of VAV2 expression differences

To further verify that VAV2 can be used as a biomarker for clinical radiotherapy resistance of patients with esophageal cancer. The invention collects 31 patients with esophageal cancer new-auxiliary radiotherapy, all the patients receive the operation treatment after the preoperative new-auxiliary radiotherapy and chemotherapy, and the recent curative effect of the patients is evaluated into a radiotherapy and chemotherapy sensitive group (PR) and a resistant group (SD) according to the RECIST evaluation standard of solid tumors by analyzing the CT image review results of the 31 patients with esophageal cancer after the radiotherapy and chemotherapy.

The results of the immunohistochemical staining with VAV2 were performed on the preoperative and postoperative specimens of 31 patients, respectively, as shown in fig. 13 (results of immunohistochemical, imaging and HE staining for radiotherapy-sensitive and resistant VAV2 and γ H2AX of patients).

The difference of VAV2 expression between radiotherapy sensitive group and resistant group patients was further statistically analyzed by using immunohistochemical score, and as a result, it was found that VAV2 expression of radiotherapy resistant patients was significantly increased, and the difference was statistically significant, and Fisher test statistical analysis data p-0.017 (fig. 14A) was used for ROC curve graph of VAV2 in diagnosis as shown in fig. 14B, and AUC-0.79, which indicates good diagnosis effect.

In addition, there is a significant negative correlation between VAV2 and the classical radiotherapeutic sensitivity marker γ H2AX (fig. 15, r ═ 0.431, p ═ 0.015), patients with high γ H2AX expression had low expression of VAV2, and patients with low γ H2AX expression had high expression of VAV 2.

The data indicate that the VAV2 can be used as a biomarker for radiotherapy resistance to predict the radiotherapy curative effect of esophageal cancer patients.

Example 6 verification of tumor proliferation and metastasis Capacity

To further investigate whether VAV2 plays an oncogenic role in tumors. We used esophageal cancer cell lines to construct Cas9 knock-out cell lines of VAV 2: the kit is constructed by using CRISPR-Cas9 technology, plasmids used comprise PBase, VAV2 sgRNA and PB-U6-sgRNA-Neo, and G418 is used for screening cells after the plasmids are transfected to construct a VAV2 knockout cell line.

As shown in FIG. 16, the expression level was very low after the VAV2 knock-out. It was subsequently found experimentally that knocking out VAV2 significantly inhibited tumor proliferation, metastatic ability (fig. 17).

Furthermore, analysis of the sequencing data from 245 patients revealed that high expression of VAV2 was associated with poor prognosis in patients with esophageal cancer (esophageal squamous cell carcinoma), high expression of VAV2, and poor prognosis in patients with esophageal cancer (p 0.0024, HR 1.756, fig. 18).

The data indicate that VAV2 is an important oncogene in esophageal cancer promoting the malignant phenotype of tumors. Targeting or inhibiting VAV2 can improve the radiotherapy sensitivity of esophageal cancer and obtain the dual effect of antitumor therapy, and is an important clinical treatment target.

Sequence listing

<110> tumor hospital of Chinese medical science institute

<120> use of VAV2 for predicting sensitivity and prognosis of radiotherapy in a patient

<141> 2021-06-16

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcaggccttt tccctcagag 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgcacctcca ccttgatgat 20

<210> 3

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ucacagaggc caagaaauu 19

<210> 4

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaagucugc cacgauaaa 19

<210> 5

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gggacgacau cuacgagga 19

Claims

1. The application of the reagent for detecting the expression quantity of the VAV2 in preparing a product for predicting the radiotherapy sensitivity of a patient or predicting the prognosis of the patient;

preferably, the patient is a patient diagnosed with esophageal cancer;

preferably, the esophageal cancer includes, but is not limited to, esophageal squamous carcinoma and esophageal adenocarcinoma;

preferably, the prognostic indicator is overall survival of 1-50 months;

preferably, the evaluation criterion of radiotherapy sensitivity is according to the RECIST evaluation criterion of solid tumors.

2. The use of claim 1, wherein said VAV2 is highly expressed in a patient resistant to radiotherapy; the VAV2 is highly expressed in patients with poor prognosis.

3. The use according to claim 1, wherein the reagent for detecting the expression level of VAV2 comprises a reagent for detecting the expression level of VAV2 mRNA and/or the expression level of VAV2 protein;

preferably, the reagent for detecting the expression level of VAV2 mRNA comprises the following reagents used in the following methods: PCR-based detection method, Southern hybridization, Northern hybridization, dot hybridization, fluorescence in situ hybridization, DNA microarray, ASO method, high-throughput sequencing platform;

preferably, the reagent for detecting the expression level of the VAV2 protein comprises the reagents used in the following methods: enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, western blot, flow cytometry, fluorescence assisted cell sorting, enzyme substrate chromogenic assay and antigen-antibody aggregation, mass spectrometry, immunohistochemical staining, immunoprecipitation analysis, complement fixation analysis, flow cytofluorimetry and protein chips.

4. The use of claim 1, wherein the reagent for detecting the mRNA expression level comprises an upstream primer with a sequence shown as SEQ ID NO. 1 and a downstream primer with a sequence shown as SEQ ID NO. 2.

5. The use according to claim 1, wherein the reagent for detecting the expression level of VAV2 protein comprises a reagent used for immunohistochemical staining.

Use of an inhibitor of VAV2 for the manufacture of a product for the treatment of a patient, said inhibitor being capable of knocking out the VAV2 gene or reducing the expression level of VAV 2;

preferably, the patient is a patient diagnosed with esophageal cancer;

preferably, the inhibitor comprises an agent used in siRNA interference, CRISPR/cas9 method, homologous recombination, gene knockout, gene replacement, gene silencing, site-directed mutagenesis, chemical drug method;

preferably, the inhibitor is an agent used in a siRNA interference method;

preferably, the interfering fragment used by the siRNA interference comprises one or more of SEQ ID NO 3-5;

preferably, the treatment comprises increasing sensitivity to radiation therapy and/or improving prognosis;

preferably, the prognosis is consistent with the prognosis of claim 1;

preferably, the radiotherapeutic sensitivity is in accordance with the radiotherapeutic sensitivity of claim 1.

7. A method of constructing a cell having reduced radiation resistance and reduced cell proliferation;

preferably, the cell is a cancer cell;

preferably, the cell is an esophageal cancer cell;

preferably, the cells are derived from an esophageal cancer patient;

preferably, the method comprises interfering with the VAV2 gene using siRNA;

8. A method for constructing a cell having an improved radiation resistance and an improved cell proliferation ability;

preferably, the cell is a cancer cell;

preferably, the cell is an esophageal cancer cell;

preferably, the cells are derived from an esophageal cancer patient;

preferably, the method comprises constructing a vector carrying the VAV2 gene;

preferably, the vector is a lentiviral vector.

9. A method for determining the proliferative capacity of a cell for non-diagnostic purposes, said method comprising detecting the amount of VAV2 expressed;

10. The application of a reagent for detecting the expression level of VAV2 in detecting the cell proliferation capacity;