CN113373170A

CN113373170A - pFNCpfAb/pCrAb double-plasmid system and application thereof

Info

Publication number: CN113373170A
Application number: CN202110471497.5A
Authority: CN
Inventors: 王宇; 丁玥; 孔令保; 荣华
Original assignee: Jiangxi Agricultural University
Current assignee: Jiangxi Agricultural University
Priority date: 2021-04-29
Filing date: 2021-04-29
Publication date: 2021-09-10

Abstract

The invention provides a pFNCpfAb/pCrAb double-plasmid system and application thereof. The dual plasmid system of the present invention comprises a plasmid having the sequence of SEQ ID NO: 1 and the plasmid having the sequence of SEQ ID NO: 2 pCrAb-km plasmid. The pFNCpfAb/pCrAb double plasmid system can efficiently identify TTN (N represents any base of T/A/G/C) and CTV (V represents any base of A/G/C) sequences as PAM sites in the acinetobacter baumannii, and can efficiently identify target point sequences with the length of 19-25nt, thereby realizing efficient and traceless genome editing operation in the acinetobacter baumannii. The double-plasmid system greatly expands the selection range of the genome editing sites of acinetobacter baumannii, thereby promoting the screening of drug targets and the acceleration of new drug research and development.

Description

pFNCpfAb/pCrAb double-plasmid system and application thereof

Technical Field

The invention relates to a pFNCpfAb/pCrAb double-plasmid system and application thereof, belonging to the technical field of biology.

Background

Acinetobacter baumannii is an opportunistic pathogenic bacterium which is extremely harmful to human, can cause a series of serious infectious diseases, and poses great threat to human health. In recent years, with the widespread use of antibiotics, a multi-drug resistant (MDR), a pan-drug resistant (XDR) or even a pan-drug resistant (PDR) acinetobacter baumannii strain is continuously emerging, and severe infection and death cases of patients caused by the strain are increasing day by day, emphasizing the severity of human infection caused by drug-resistant acinetobacter baumannii and the importance of developing novel therapeutic means.

The development of novel therapeutic approaches is not free from screening new drug targets, and the screening of drug targets is not free from convenient genome editing operations. The current methods for editing the genome of acinetobacter baumannii mainly comprise a non-replication-permissive plasmid method, an exogenous recombinant enzyme method, a CBE single base editing method and a CRISPR-Cas9 genome editing method. The non-copy permissive plasmid method and the exogenous recombinant enzyme method belong to traditional genetic operation tools, and have the defects of more complex operation, longer experimental period, low gene knockout efficiency, difficulty in realizing accurate traceless genome editing and the like; the CBE single base editing method can convert cytosine base (C) in a target point editing window into thymine base (T), but can not realize deletion and insertion of genes; although the CRISPR-Cas9 genome editing method can realize precise traceless genome editing of Acinetobacter baumannii, the method is limited by the property of Cas9 nuclease from Streptococcus pyogenes, the system can only recognize a PAM site with 20bp target adjacent to a 3' end sequence of NGG (N represents any base of A/T/G/C), and the target selection range of the system in the Acinetobacter baumannii genome is limited.

The CRISPR-Cpf1 system reported in 2015 is a more recent genome editing tool than the CRISPR-Cas9 system, has similar working principle with the CRISPR-Cas9 system, but has some unique characteristics. The CRISPR-Cpf1 system consists of two parts, Cpf1 nuclease and crRNA. Wherein the crRNA is only 42-44 nucleotides in length, which is more beneficial to multi-gene editing. The PAM site recognized by the Cpf1 nuclease is a sequence which is adjacent to the 5' end of the target and is rich in thymine base (T), and the recognizable target has variable length, so that the selection range of the target can be greatly expanded compared with the CRISPR-Cas9 system. The CRISPR-Cpf1 tool mainly used at present has three sources, which are respectively from Francisella novaculeatus (Francisella novicida) U112 strain, aminoacidococcus sp (aidamicoccus sp.) BV3L6 strain and drospiraceae (Lachnospiraceae bacteria) ND2006 strain, wherein the Cpf1 nuclease (hereinafter referred to as FnCpf1) from Francisella novaculeatus (Francisella novicida) U112 strain has the widest PAM site recognition range, and can effectively improve the target selection range of the system in a target genome.

The CRISPR-Cpf1 system has achieved high efficiency of genome editing in a variety of eukaryotic and prokaryotic organisms, such as mammalian cells, maize, wheat, yeast, and corynebacterium glutamicum, among others. However, the existing CRISPR-Cpf1 tool has great limitations and cannot be directly applied to genome editing of acinetobacter baumannii.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: the existing CRISPR-Cpf1 tool has great limitation and cannot be directly applied to genome editing of Acinetobacter baumannii.

In order to solve the technical problem, the invention provides a pFNCpfAb/pCrAb double-plasmid system, which comprises a plasmid with the sequence of SEQ ID NO: 1 and the plasmid having the sequence of SEQ ID NO: 2, the pFnCpfAb-apr plasmid is capable of expressing FnCpf1 nuclease and RecAb recombinase, and the pCrAb-km plasmid is capable of expressing crRNA.

Preferably, the pFnCpfAb-apr plasmid comprises the FnCpf1 gene fragment, RecAb recombinase system, lacI galactose-inducible promoter repressor protein, and the gram-negative tube host replicon RSF 1010; the pCrAb-km plasmid contains a gene crRNA, a ribozyme HDV with self-cleavage activity, a site BsaI _ spacer for subsequent insertion of a target sequence, an Escherichia coli plasmid replicon rep and an Acinetobacter baumannii plasmid replicon WH1266\ origin.

Preferably, the pFNCpfAb-apr plasmid and the pCrAb-km plasmid both contain the sucrose sensitive selection marker gene sacB.

The invention also provides application of the pFNCpfAb/pCrAb double-plasmid system in genome editing in acinetobacter baumannii.

Preferably, the use comprises use in the preparation of a genome editing tool and/or a genome editing kit.

Preferably, the genome editing comprises knocking out the uspA gene.

Preferably, the sequence of the genome-edited PAM site is a TTN sequence and/or a CTV sequence, N in the TTN sequence is any base, V in the CTV sequence is any base except for base T, and the length of the genome-edited target sequence is 19 to 25 nt.

The invention also provides a cell comprising either or both plasmids of the above-described pFCpfAb/pCrAb two-plasmid system.

The invention also provides a strain containing any one plasmid or two plasmids in the pFNCpfAb/pCrAb double-plasmid system.

Preferably, the strain is Escherichia coli TOP10 strain, the Escherichia coli TOP10 strain contains pFNCpfAb-apr plasmid and pCrAb-km plasmid, and the preservation numbers are as follows: CCTCC M2021056.

The Escherichia coli TOP10 strain containing pFnCpfAb-apr plasmid and pCrAb-km plasmid is classified and named as follows: escherichia coli; latin literature name: escherichia coli TOP 10; the preservation unit: china Center for Type Culture Collection (CCTCC); address: eight Lopa in Wuchang region of Wuhan city, Hubei province; the preservation date is as follows: 14/1/2021 with the deposition number: CCTCC M2021056.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention explores and modifies the existing CRISPR-Cpf1 system through molecular biological operation, and the constructed pFNCpfAb/pCrAb double-plasmid system can be suitable for genome editing of acinetobacter baumannii, thereby greatly expanding the selection range of the genome editing sites of the acinetobacter baumannii and further promoting the screening of drug targets and the acceleration of new drug research and development.

2. The pFNCpfAb/pCrAb double-plasmid system can efficiently identify TTN (N represents any base of T/A/G/C) and CTV (V represents any base of A/G/C) sequences as PAM sites in the acinetobacter baumannii, and can efficiently identify target point sequences with the length of 19-25nt, thereby realizing efficient and traceless genome editing operation in the acinetobacter baumannii.

Drawings

FIG. 1 is a structural composition diagram of a pFNCpfAb/pCrAb two-plasmid system;

wherein, FIG. 1A is pFnCpfAb-apr plasmid map, FnCpf 1: FnCpf1 nuclease expression gene, RecAb: RecAb recombinase expression gene, sacB: sucrose sensitive selectable marker gene (for subsequent plasmid elimination), AprR: apramycin resistance protein expression gene, RSF 1010: gram negative broad host plasmid replicon, lacI: a galactose-inducible promoter repressor;

FIG. 1B is a pCrAb-km plasmid map, WH1266\ origin: acinetobacter baumannii plasmid replicon, sacB: sucrose sensitive selection marker gene (for subsequent plasmid elimination), J23119: constitutive promoter, crRNA: FnCpf1 nuclease-recognized leader sequence, BsaI _ spacer: site for subsequent insertion of target sequence, HDV: ribozyme with self-cleaving activity (for subsequent self-processing maturation of crRNA), metZWV: gene transcription terminator, rep (pMB 1): escherichia coli plasmid replicon, kmR: a kanamycin resistance gene;

FIG. 2 shows the PAM site sequence that can be efficiently recognized by screening FnCpf1 nuclease in Acinetobacter baumannii, wherein the left figure shows the screening result in the oxyR gene, and the right figure shows the screening result in the adeB gene;

FIG. 3 shows the length of target sequence that can be efficiently recognized by screening FnCpf1 nuclease in Acinetobacter baumannii, wherein the left figure shows the screening result in the oxyR gene, and the right figure shows the screening result in the hscB gene;

FIG. 4 shows the knock-out of uspA gene in A.baumannii using the pFNCpfAb/pCrAb two-plasmid system; wherein A is a PCR verification result picture of the colonies subjected to the uspA gene knockout, and the knockout success rate is 6/7; b is the DNA sequencing result comparison of the uspA gene knockout strain.

Detailed Description

In order to make the invention more comprehensible, preferred embodiments are described in detail below with reference to the accompanying drawings.

In each of the following examples, the sources of biological material used were as follows:

pCasAb plasmid was purchased from addgene, usa under the cat number: 121998, respectively; the pSGAb plasmid was purchased from Addgene, USA, Cat No.: 121999, respectively; pUC57-FnCpf1-Amp plasmid was purchased from Jinzhi Biotechnology GmbH and subjected to gene synthesis; acinetobacter baumannii ATCC17978 strain was purchased from American ATCC company, cat #: ATCC 17978; competent cells of the E.coli TOP10 strain were purchased from Shanghai Tulo harbor Biotech Co., Ltd., Cat. No.: CC 96105-01; coli TOP10 strain containing pFnCpfAb-apr and pCrAb-km plasmids, under the taxonomic nomenclature: escherichia coli; latin literature name: escherichia coli TOP 10; the preservation unit: china Center for Type Culture Collection (CCTCC); address: eight Lopa in Wuchang region of Wuhan city, Hubei province; the preservation date is as follows: 14/1/2021 with the deposition number: CCTCC M2021056.

The LB liquid medium used in each example was a premixed LB liquid medium (dry powder) prepared by adding distilled water in a certain ratio according to the instructions for use, the premixed LB liquid medium (dry powder) was purchased from beijing solibao technologies ltd, cat #: l1010; the LB solid medium used in each example was prepared by adding 1.5% agar powder to an LB liquid medium, the agar powder was purchased from bio-engineering (shanghai) gmbh, cat #: a505255-0250; apramycin was purchased from bio-engineering (shanghai) gmbh, cat #: a600090-0001; kanamycin was purchased from bio-engineering (shanghai) gmbh, cat no: a506636-0025.

Example 1

Construction of pFNCpfAb-apr plasmid:

(1) and respectively amplifying a bacrbone fragment and a sacB gene fragment from the pCasab plasmid through PCR reaction, wherein the sequences of PCR primers for amplifying the bacrbone fragment are as follows:

pAT-bb-F：5’-GGTTCATGTGCAGCTCCATCA-3’(SEQ ID NO：3)

pAT-bb-R：5’-GGATCCAGGGTTATTGTCTCATG-3’(SEQ ID NO：4)

the backbone fragment was amplified using 2 × Phanta Max Master Mix of nozak in the following reaction scheme: 25 μ L of 2 × Phanta Max Master Mix, 1 μ L of pCasaB plasmid template (1 ng/. mu.L), 2 μ L of pAT-bb-F (10 μ M), 2 μ L of pAT-bb-R (10 μ M), 20 μ L of ddH₂And O. After the reaction system is configured, carrying out amplification reaction in a PCR instrument, wherein the amplification parameters are as follows: pre-denaturation at 95 ℃ for 30 s; then denaturation at 95 ℃ for 15s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 5min for 30 cycles; then fully extending for 5min at 72 ℃; finally, the temperature is kept at 12 ℃.

After completion of the amplification reaction, Quickcut by Baori doctor's technology (Beijing) Ltd was used^TMThe DpnI restriction endonuclease eliminates a pCasab plasmid template in a PCR reaction system, and the specific operation is as follows: adding 1 mu L of QuickCut into the PCR reaction system after the amplification is finished^TMAnd D, sucking DpnI by using a pipette, mixing uniformly, centrifuging for a short time, and placing the mixture in a constant temperature incubator at 37 ℃ for reaction and digestion for 0.5-1 h. Next, the reaction product was purified and recovered using a SanPrep column PCR product purification kit from Biotechnology engineering (Shanghai) Ltd, and the procedure was carried out according to the instruction manual provided in the kit. The purified and recovered backbone fragment was stored in a refrigerator at-20 ℃.

Wherein, the PCR primer sequence for amplifying the sacB gene fragment is as follows:

sacB-F：5’-GAGACAATAACCCTGGATCCGCAACTTTATGCCCATGCAAC-3’(SEQ ID NO：5)

sacB-R：5’-GATGGAGCTGCACATGAACCGTATCCGTGAATTGACGCGTATT-3’(SEQ ID NO：6)

the sacB gene fragment was amplified using 2 x Phanta Max Master Mix from Novozan, in the following reaction scheme: 25 μ L of 2 XPPhanta Max Master Mix, 1 μ L of pCasaB plasmid template (1 ng/. mu.L), 2 μ L of sacB-F (10 μ M), 2 μ L of sacB-R (10 μ M), 20 μ L of ddH₂And O. After the reaction system is configured, carrying out amplification reaction in a PCR instrument, wherein the amplification parameters are as follows: pre-denaturation at 95 ℃ for 30 s; then changed to 95 DEG CSex 15s, annealing at 55 ℃ for 15s, extending at 72 ℃ for 1min, and 30 cycles; then fully extending for 5min at 72 ℃; finally, the temperature is kept at 12 ℃.

After completion of the amplification reaction, Quickcut by Baori doctor's technology (Beijing) Ltd was used^TMThe DpnI restriction endonuclease eliminates a pCasab plasmid template in a PCR reaction system, and the specific operation is as follows: adding 1 mu L of QuickCut into the PCR reaction system after the amplification is finished^TMAnd D, sucking DpnI by using a pipette, mixing uniformly, centrifuging for a short time, and placing the mixture in a constant temperature incubator at 37 ℃ for reaction and digestion for 0.5-1 h. Next, the reaction product was purified and recovered using a SanPrep column PCR product purification kit from Biotechnology engineering (Shanghai) Ltd, and the procedure was carried out according to the instruction manual provided in the kit. The purified and recovered sacB gene fragment is stored in a refrigerator at the temperature of-20 ℃.

(2) The backbone fragment and sacB gene fragment obtained in step (1) were assembled into a circular plasmid by the Gibson seamless cloning method, which was designated as pAT-sacB plasmid.

The assembly of the two fragments was carried out using the one-step rapid cloning kit of assist in san Biotechnology (Shanghai) Ltd as follows: 10 μ L of 2 × Hieff Clone Enzyme Premix, 4 μ L of backbone fragment (25 ng/. mu.L), 2 μ L of sacB gene fragment (80 ng/. mu.L), 4 μ L of ddH₂And O. After the reaction system is configured, Gibson seamless cloning reaction is executed in a PCR instrument, and the reaction parameters are as follows: incubate at 50 ℃ for 20min, then place the reaction tube on ice to cool for 5 min.

mu.L of the above-described seamless cloned product was taken and added to 100. mu.L of E.coli TOP10 competent cells (Shanghai Tulo harbor Biotech Co., Ltd.) to be heat-shocked, and the transformation procedure was carried out according to the instructions attached to the competent cells. After the conversion is finished, 100L of resuscitation solution is coated on an LB solid culture medium plate containing apramycin with the concentration of 100 mug/mL, and after the resuscitation solution is absorbed by the solid culture medium, the plate is placed in an incubator at 37 ℃ upside down to be cultured overnight until a single colony grows out. Several single colonies were randomly picked with a sterile inoculating loop and inoculated into 5mL LB liquid tubes containing 100. mu.g/mL apramycin, and the tubes were placed in an inclined position on a 37 ℃ constant temperature shaker for overnight shaking culture. Plasmids were extracted using a small plasmid extraction kit from Tiangen Biochemical technology (Beijing) Ltd, and the extraction steps were carried out according to the instructions provided in the kit. The extracted plasmid is sent to a biotechnology limited company in the new industry of Beijing Optimalaceae for DNA sequencing verification, and the correct plasmid is pAT-sacB plasmid which can be used for the next plasmid construction.

(3) The FnCpf1 gene was synthesized by King Kong Biotech Co., Ltd according to the codon preference of Acinetobacter baumannii, and then cloned into the EcoRV cleavage site of pUC57-Amp plasmid in the vector library of the Co., Ltd, thereby obtaining pUC57-FnCpf1-Amp plasmid. The pUC57-Amp plasmid original sequence is found in the website of Jinzhi Biotechnology, Inc. The synthetic FnCpf1 gene sequence is as follows (SEQ ID NO: 7):

5’-GGGCTTATCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGAATTCATGTCCATCTACCAAGAGTTTGTGAATAAATACTCCCTGTCCAAGACCCTCCGTTTTGAGCTGATCCCCCAAGGCAAGACCCTCGAAAACATCAAGGCACGCGGCCTCATCCTGGATGACGAAAAGCGCGCTAAGGATTACAAGAAGGCAAAGCAGATCATCGACAAGTACCACCAGTTCTTCATCGAAGAGATCCTGTCCTCCGTGTGCATCTCCGAGGACCTGCTCCAGAACTACTCCGATGTCTACTTCAAGCTCAAGAAGTCCGATGACGATAACCTGCAGAAGGACTTCAAGTCCGCTAAGGATACCATCAAGAAGCAGATCTCCGAATACATCAAGGATTCCGAGAAGTTCAAGAACCTCTTCAACCAGAACCTGATCGACGCAAAGAAGGGCCAGGAATCCGATCTCATCCTGTGGCTCAAGCAGTCCAAGGATAACGGCATCGAGCTCTTCAAGGCCAACTCCGACATCACCGACATCGATGAAGCTCTGGAGATCATCAAGTCCTTCAAGGGCTGGACCACCTACTTCAAGGGCTTCCACGAAAACCGCAAGAACGTGTACTCCTCCAACGATATCCCAACCTCTATCATCTACCGCATCGTCGACGATAACCTGCCAAAGTTCCTCGAAAACAAGGCAAAGTACGAGTCCCTGAAGGATAAGGCCCCAGAAGCTATCAACTACGAGCAGATCAAGAAGGACCTGGCCGAAGAGCTCACCTTCGACATCGATTACAAGACCTCTGAAGTGAACCAGCGCGTCTTCTCCCTCGATGAAGTGTTCGAGATCGCCAACTTCAACAACTACCTGAACCAGTCCGGCATCACCAAGTTCAACACCATCATCGGCGGCAAGTTCGTCAACGGCGAAAACACCAAGCGCAAGGGCATCAACGAGTACATCAACCTCTACTCCCAGCAGATCAACGATAAGACCCTGAAGAAGTACAAGATGTCCGTGCTCTTCAAGCAGATCCTGTCCGACACCGAATCCAAGTCCTTCGTCATCGACAAGCTGGAGGACGATTCCGATGTGGTCACCACCATGCAGTCCTTCTACGAACAGATCGCAGCCTTCAAGACCGTGGAAGAGAAGTCCATCAAGGAGACCCTCTCCCTGCTCTTCGACGATCTGAAGGCTCAGAAGCTGGATCTCTCCAAGATCTACTTCAAGAACGACAAGTCCCTGACCGATCTCTCCCAGCAGGTCTTCGACGATTACTCCGTGATCGGCACCGCAGTCCTGGAATACATCACCCAGCAGATCGCCCCAAAGAACCTCGATAACCCATCCAAGAAGGAACAGGAGCTGATCGCCAAGAAGACCGAAAAGGCTAAGTACCTGTCCCTCGAGACCATCAAGCTGGCTCTCGAAGAGTTCAACAAGCACCGCGACATCGATAAGCAGTGCCGCTTCGAAGAGATCCTCGCAAACTTCGCTGCAATCCCAATGATCTTCGACGAAATCGCACAGAACAAGGATAACCTGGCCCAGATCTCCATCAAGTACCAGAACCAGGGCAAGAAGGATCTGCTCCAGGCCTCCGCTGAGGACGATGTGAAGGCAATCAAGGACCTGCTCGATCAGACCAACAACCTGCTCCACAAGCTGAAGATCTTCCACATCTCCCAGTCCGAAGACAAGGCCAACATCCTCGACAAGGATGAGCACTTCTACCTGGTGTTCGAAGAGTGCTACTTCGAACTCGCTAACATCGTCCCACTGTACAACAAGATCCGCAACTACATCACCCAGAAGCCATACTCCGATGAAAAGTTCAAGCTCAACTTCGAGAACTCCACCCTGGCAAACGGCTGGGACAAGAACAAGGAACCAGATAACACCGCCATCCTCTTCATCAAGGACGATAAGTACTACCTGGGCGTGATGAACAAGAAGAACAACAAGATCTTCGACGATAAGGCCATCAAGGAAAACAAGGGCGAGGGCTACAAGAAGATCGTGTACAAGCTGCTCCCAGGCGCTAACAAGATGCTCCCAAAGGTCTTCTTCTCCGCAAAGTCCATCAAGTTCTACAACCCATCCGAAGATATCCTGCGCATCCGCAACCACTCCACCCACACCAAGAACGGCTCCCCACAGAAGGGCTACGAAAAGTTCGAGTTCAACATCGAAGACTGCCGCAAGTTCATCGATTTCTACAAGCAGTCCATCTCCAAGCACCCAGAGTGGAAGGACTTCGGCTTCCGCTTCTCCGATACCCAGCGCTACAACTCCATCGATGAATTCTACCGCGAAGTGGAGAACCAGGGCTACAAGCTGACCTTCGAAAACATCTCCGAGTCCTACATCGATTCCGTGGTCAACCAGGGCAAGCTGTACCTCTTCCAGATCTACAACAAGGACTTCTCCGCTTACTCCAAGGGCCGCCCAAACCTGCACACCCTCTACTGGAAGGCACTCTTCGACGAACGCAACCTGCAGGATGTGGTCTACAAGCTCAACGGCGAAGCAGAGCTGTTCTACCGCAAGCAGTCCATCCCAAAGAAGATCACCCACCCAGCCAAGGAAGCAATCGCCAACAAGAACAAGGATAACCCAAAGAAGGAATCCGTGTTCGAGTACGACCTGATCAAGGATAAGCGCTTCACCGAGGACAAGTTCTTCTTCCACTGCCCAATCACCATCAACTTCAAGTCCTCCGGCGCCAACAAGTTCAACGATGAAATCAACCTGCTCCTGAAGGAGAAGGCTAACGACGTGCACATCCTGTCCATCGATCGCGGCGAACGCCACCTCGCCTACTACACCCTGGTCGACGGCAAGGGCAACATCATCAAGCAGGACACCTTCAACATCATCGGCAACGATCGCATGAAGACCAACTACCACGACAAGCTGGCCGCTATCGAGAAGGACCGCGATTCCGCTCGCAAGGATTGGAAGAAGATCAACAACATCAAGGAAATGAAGGAAGGCTACCTCTCCCAGGTGGTCCACGAAATCGCTAAGCTGGTGATCGAGTACAACGCAATCGTGGTCTTCGAAGACCTGAACTTCGGCTTCAAGCGCGGCCGCTTCAAGGTGGAGAAGCAGGTCTACCAGAAGCTGGAAAAGATGCTCATCGAGAAGCTGAACTACCTCGTGTTCAAGGACAACGAATTCGATAAGACCGGCGGCGTCCTCCGTGCATACCAGCTGACCGCCCCATTCGAGACCTTCAAGAAGATGGGCAAGCAGACCGGCATCATCTACTACGTGCCAGCTGGCTTCACCTCTAAGATCTGCCCAGTGACCGGCTTCGTCAACCAGCTCTACCCAAAGTACGAATCCGTCTCCAAGTCCCAGGAGTTCTTCTCCAAGTTCGACAAGATCTGCTACAACCTGGATAAGGGCTACTTCGAATTCTCCTTCGACTACAAGAACTTCGGCGATAAGGCAGCCAAGGGCAAGTGGACCATCGCATCCTTCGGCTCCCGCCTCATCAACTTCCGCAACTCCGACAAGAACCACAACTGGGATACCCGCGAAGTGTACCCAACCAAGGAACTGGAGAAGCTCCTGAAGGATTACTCCATCGAATACGGCCACGGCGAGTGCATCAAGGCTGCAATCTGCGGCGAATCCGACAAGAAGTTCTTCGCAAAGCTGACCTCTGTGCTCAACACCATCCTGCAGATGCGCAACTCCAAGACCGGCACCGAGCTGGATTACCTCATCTCCCCAGTGGCCGACGTCAACGGCAACTTCTTCGATTCCCGCCAGGCTCCAAAGAACATGCCACAGGACGCTGATGCAAACGGCGCCTACCACATCGGTCTGAAGGGTCTCATGCTCCTGGGTCGCATCAAGAACAACCAGGAAGGCAAGAAGCTGAATCTCGTCATTAAGAACGAAGAATACTTTGAATTTGTCCAGAACCGCAATAACTAAGTCGACCTGCAGGCATGC-3’

(4) the FnCpf1 gene fragment is obtained by amplifying the pUC57-FnCpf1-Amp plasmid through PCR reaction, and the sequence of the PCR primer for amplifying the FnCpf1 gene fragment is as follows:

FnCpf1-F：5’-GAGACAATAACCCTGGATCCGGGCTTATCGACTGCACG-3’(SEQ ID NO：8)

FnCpf1-R：5’-TGGGCATAAAGTTGCGCATGCCTGCAGGTCGA-3’(SEQ ID NO：9)

the FnCpf1 gene fragment was amplified using 2X Phanta Max Master Mix from Novozan, in the following reaction scheme: 25 μ L of 2 × Phanta Max Master Mix, 1 μ L of pUC57-FnCpf1-Amp plasmid template (1 ng/. mu.L), 2 μ L of FnCpf1-F (10 μ M), 2 μ L of FnCpf1-R (10 μ M), 20 μ L of ddH₂And O. After the reaction system is configured, carrying out amplification reaction in a PCR instrument, wherein the amplification parameters are as follows: pre-denaturation at 95 ℃ for 30 s; then denaturation at 95 ℃ for 15s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 2min for 30s for 30 cycles; then fully extending for 5min at 72 ℃; finally, the temperature is kept at 12 ℃.

After the amplification reaction was completed, the PCR reaction product was purified and recovered using SanPrep column PCR product purification kit from bio-engineering (shanghai) gmbh, and the operation steps were performed with reference to the operation instructions provided in the kit. The purified and recovered FnCpf1 gene fragment was stored in a refrigerator at-20 ℃.

(5) The pAT-sacB plasmid is subjected to a single cleavage, which converts the circular plasmid DNA into a linear DNA fragment.

Quickcut by Baori doctor Tech technology (Beijing) Ltd^TMThe plasmid pAT-sacB is cut by BamHI restriction endonuclease, and the reaction system is as follows: 10 μ L of pAT-sacB plasmid (100 ng/. mu.l), 1 μ L of QuickCut^TM BamHI，5μL 10×QuickCut Buffer，34μL ddH₂And O. After the reaction system is configured, the reaction system is placed in a constant temperature incubator at 37 ℃ for reaction for 1 h. Next, the enzyme-cleaved reaction product was purified and recovered using a SanPrep column PCR product purification kit from Biotechnology engineering (Shanghai) Ltd, and the procedure was carried out according to the instruction manual provided in the kit. The purified and recovered linearized pAT-sacB plasmid DNA fragment was stored in a-20 ℃ refrigerator.

(6) The FnCpf1 gene fragment obtained in step (4) and the linearized pAT-sacB plasmid DNA fragment obtained in step (5) were assembled into a circular plasmid by the Gibson seamless cloning method, which was designated as pFNCpfAb-apr plasmid.

The assembly of the two fragments was carried out using the one-step rapid cloning kit of assist in san Biotechnology (Shanghai) Ltd as follows: 10 μ L of 2 × Hieff Clone Enzyme Premix, 6 μ L of linearized pAT-sacB plasmid DNA fragment (20 ng/. mu.L), 1 μ L of FnCpf1 gene fragment (100 ng/. mu.L), 3 μ L ddH₂And O. After the reaction system is configured, Gibson seamless cloning reaction is executed in a PCR instrument, and the reaction parameters are as follows: incubate at 50 ℃ for 20min, then place the reaction tube on ice to cool for 5 min.

mu.L of the above-described seamless cloned product was taken and added to 100. mu.L of E.coli TOP10 competent cells (Shanghai Tulo harbor Biotech Co., Ltd.) to be heat-shocked, and the transformation procedure was carried out according to the instructions attached to the competent cells. After the conversion is finished, 100 mu L of resuscitation solution is coated on an LB solid culture medium plate containing apramycin with the concentration of 100 mu g/mL, and after the resuscitation solution is absorbed by the solid culture medium, the plate is placed in an incubator at 37 ℃ upside down to be cultured overnight until a single colony grows out. Several single colonies were randomly picked with sterile inoculating loop and inoculated into 5mL LB liquid tubes containing 100. mu.g/mL apramycin, and the tubes were placed in a slant in a 37 ℃ constant temperature shaker for overnight culture with shaking. Plasmids were extracted using a small plasmid extraction kit from Tiangen Biochemical technology (Beijing) Ltd, and the extraction steps were carried out according to the instructions provided in the kit. The extracted plasmid is sent to Beijing Optimalaceae New Biotechnology Limited company for DNA sequencing verification, the correct plasmid is pFNCpfAb-apr plasmid which is successfully constructed, the composition of the pFNCpfAb-apr plasmid is shown in figure 1A, the pFNCpf-apr plasmid comprises an FnCpf1 gene fragment, an aprR gene expression gene of apramycin, a RecAb recombinase system, a lacI-tac galactose induction system and a RSF1010 gram-negative bacteria tube host replicon, and the sequence of the pFNCpfAb-apr plasmid is shown in SEQ ID NO: 1, and the length is 16375 bp.

The pFNCpfAb-apr plasmid is characterized by being a gram-negative bacterium broad-host plasmid and can be replicated and passaged in various gram-negative bacteria including Escherichia coli and acinetobacter baumannii; the plasmid has apramycin resistance and can be used for screening host bacteria; the plasmid can express FnCpf1 nuclease and RecAB recombinase after the acinetobacter baumannii is induced by galactose or analogues thereof (such as TPTG), and is used for the recombination repair of genome DNA cutting and broken DNA; the plasmid contains a sucrose sensitive screening marker gene sacB and is used for eliminating pFNCpfAb-apr plasmid after the genome of the acinetobacter baumannii is edited.

Example 2

Construction of pCrAb-km plasmid:

(1) the committed Jinzhi Biotechnology Ltd synthesizes a crRNA expression gene by minigene mode, and the gene sequence is shown as follows (SEQ ID NO: 10):

5'-TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGTAATTTCTACTGTTGTAGATCGAGACCATTGGTCTCAGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGACCCAATTATTGAACACCCTAACGGGTGTTTTTTTGTTTCTGGTCTACC-3' (2) using the synthesized crRNA expression gene as a template, amplifying by PCR reaction to obtain a large number of crRNA gene segments containing overlapping linkers. The sequences of the PCR primers used for amplifying the crRNA gene fragment containing the overlapped adaptor are as follows:

crRNA-F：5’-ATAAAGTTGCAAGCTTGACAGCTAGCTCAGTCCTAGG-3’(SEQ ID NO：11)

crRNA-R：5’-CGGGCTGCAGGAATTCGGTAGACCAGAAACAAAAAAACACC-3’(SEQ ID NO：12)

the crRNA gene fragment was amplified using 2 × Phanta Max Master Mix of Novozan, in the following reaction scheme: 25 μ L of 2 × Phanta Max Master Mix, 1 μ L of synthetic crRNA-expressing Gene template (1 ng/. mu.L), 2 μ L of crRNA-F (10 μ M), 2 μ L of crRNA-R (10 μ M), 20 μ L of ddH₂And O. After the reaction system is configured, carrying out amplification reaction in a PCR instrument, wherein the amplification parameters are as follows: pre-denaturation at 95 ℃ for 30 s; then denaturation at 95 ℃ for 15s, annealing at 56 ℃ for 15s, and extension at 72 ℃ for 20s for 30 cycles; then fully extending for 5min at 72 ℃; finally, the temperature is kept at 12 ℃.

After the amplification reaction was completed, the reaction product was purified and recovered using a SanPrep column PCR product purification kit from bio-engineering (shanghai) gmbh, and the operation steps were performed with reference to the operation instructions provided in the kit. The purified and recovered crRNA gene fragment containing the overlapping linker was stored in a-20 ℃ refrigerator.

(3) And carrying out double enzyme digestion on the pSGAb plasmid, cutting the sgRNA expression gene fragment in the plasmid, and purifying and recovering the plasmid framework fragment. Quickcut by Baori doctor Tech technology (Beijing) Ltd^TMHindIII and Quickcut^TMEcoRI two restriction enzymes simultaneously cut the pSGAb plasmid, and the reaction system is as follows: 10 μ L of pSGAb plasmid (100 ng/. mu.L), 1 μ L of Quickcut^TM HindIII，1μL QuickCut^TM EcoRI，5μL 10×QuickCut Buffer，33μL ddH₂O。

After the reaction system is configured, the reaction system is placed in a constant temperature incubator at 37 ℃ for reaction for 1 h. Then, the plasmid backbone fragment in the enzyme-cleaved reaction product was purified and recovered using a SanPrep column DNA gel recovery kit from Biotechnology engineering (Shanghai) Ltd, and the procedure was performed according to the instruction manual provided in the kit. The purified and recovered pSGAb plasmid backbone fragment was stored in a-20 ℃ refrigerator.

(4) And (3) assembling the crRNA gene fragment obtained in the step (2) and the pSGAb plasmid skeleton fragment obtained in the step (3) into a circular plasmid by a Gibson seamless cloning method, and naming the circular plasmid as pCrAb-km.

The assembly of the two fragments was carried out using the one-step rapid cloning kit of assist in san Biotechnology (Shanghai) Ltd as follows: 10 μ L of 2 × Hieff Clone Enzyme Premix, 2 μ L of pSGAb plasmid backbone fragment (40 ng/. mu.L), 1 μ L of crRNA gene fragment (60 ng/. mu.L), 7 μ L of ddH₂And O. After the reaction system is configured, Gibson seamless cloning reaction is executed in a PCR instrument, and the reaction parameters are as follows: incubate at 50 ℃ for 20min, then place the reaction tube on ice to cool for 5 min.

mu.L of the above-described seamless cloned product was taken and added to 100. mu.L of E.coli TOP10 competent cells (Shanghai Tulo harbor Biotech Co., Ltd.) to be heat-shocked, and the transformation procedure was carried out according to the instructions attached to the competent cells. After the conversion is finished, 100 mu L of resuscitation solution is taken and coated on an LB solid culture medium plate containing kanamycin with the concentration of 50 mu g/mL, after the resuscitation solution is absorbed by the solid culture medium, the plate is placed upside down in a constant temperature incubator at 37 ℃ for culture overnight until a single colony grows out. Several single colonies were randomly picked with a sterile inoculating loop and inoculated into 5mL LB liquid tubes containing kanamycin at a concentration of 50. mu.g/mL, and the tubes were placed in a slant in a 37 ℃ constant temperature shaker for overnight shaking culture. Plasmids were extracted using a small plasmid extraction kit from Tiangen Biochemical technology (Beijing) Ltd, and the extraction steps were carried out according to the instructions provided in the kit. The extracted plasmid is sent to Beijing Optimalaceae New Biotechnology Limited company for DNA sequencing verification, the correct plasmid is a successfully constructed pCrAb-km plasmid, the composition of the pCrAb-km plasmid is shown in figure 1B, and the pCrAb-km plasmid comprises an acinetobacter baumannii plasmid replicon WH1266\ origin, a sucrose sensitive screening marker gene sacB (used for subsequent plasmid elimination), a constitutive promoter J23119, a guide sequence crRNA gene fragment recognized by Fncpf1 nuclease, a ribozyme HDV with self-cutting activity (used for subsequent self-processing maturation of crRNA), a gene transcription terminator metZWV, an escherichia coli plasmid rep (pMB1) and a kanamycin resistance gene kmR; the sequence of the pCrAb-km plasmid is shown as SEQ ID NO: 2, the length is 6110 bp. Coli TOP10 strain containing the correct pFnCpfAb-apr and pCrAb-km plasmids has been deposited microbiologically under the taxonomic nomenclature: escherichia coli; latin literature name: escherichia coli; the preservation unit: china Center for Type Culture Collection (CCTCC); address: eight Lopa in Wuchang region of Wuhan city, Hubei province; the preservation date is as follows: 14/1/2021 with the deposition number: CCTCC M2021056.

The pCrAb-km plasmid is characterized by being a shuttle plasmid which can be replicated and passaged in Escherichia coli and acinetobacter baumannii; the plasmid has kanamycin resistance and can be used for screening host bacteria; the plasmid can express crRNA containing an artificially inserted spacer sequence in acinetobacter baumannii, and is used for guiding FnCpf1 nuclease to be correctly positioned at the correct target position of the acinetobacter baumannii genome; the plasmid contains a sucrose sensitive screening marker gene sacB and is used for eliminating pCrAb-km plasmid after the genome of Acinetobacter baumannii is edited.

Example 3

Insert the spacer fragment into the pCrAb-km plasmid:

in order to make the crRNA and FnCpf1 nuclease complex be positioned at a specific target position of the Acinetobacter baumannii genome DNA for cutting, a specific target spacer sequence needs to be inserted into a crRNA expression gene, and the specific insertion method is as follows:

(1) selecting a base sequence which is close to the downstream of a PAM locus on the Acinetobacter baumannii genome. For Acinetobacter baumannii, the PAM site sequences which can be efficiently recognized by FnCpf1 nuclease are TTN (N represents any base of T/A/G/C) and CTV (V represents any base of A/G/C). The selected base sequence is a spacer sequence, the length of the base sequence can be between 19 and 25nt, the GC content of the sequence is controlled to be between 20 and 80 percent, and the PAM site sequence is not included in the spacer sequence. In order to enable the spacer fragment to be seamlessly inserted into the crRNA expression gene of the pCrAb-km plasmid, an agat joint is added at the 5 'end of the sense strand of the spacer sequence, and a ggcc joint is added at the 5' end of the antisense strand of the spacer sequence, and the specific primer design template is as follows:

sense strand primer: 5 '-agatnnnnnnnnnnnnnnnnnnnnnn-3' (N represents any one base of T/a/G/C, and the number is 19-25)

Antisense strand primer: 3 '-NNNNNNNNNNNNNNNNNNNnccgg-5' (N represents any one base of T/A/G/C, the number is 19-25)

After a target spot is selected in the genome sequence of the acinetobacter baumannii, a sense strand primer sequence and an antisense strand primer sequence of the target spot are designed according to the requirements, and then the sequences are sent to Beijing optimalist Biotech limited to perform primer synthesis.

(2) The synthesized sense and antisense strand primer is phosphorylated and then annealed into a double-stranded DNA fragment by means of base complementary pairing. The phosphorylation reaction of the positive and negative strand primers is carried out by using T4PNK polymerase of Baozi medical technology (Beijing) Co., Ltd, and the reaction system is as follows: mu.L of sense strand primer (10. mu.M), 5. mu.L of antisense strand primer (10. mu.M), 0.5. mu. L T4PNK polynucleotide kinase, 2.5. mu.L of 10 XT 4 DNA ligase Buffer, 12. mu.L of ddH₂And O. It should be noted that, since the phosphorylation reaction requires the consumption of ATP, T4 DNA ligase Buffer containing 10mM ATP is used herein instead of the ATP-containing T4PNK polyneotide kinase Buffer. After the reaction system is configured, the reaction system is placed in a constant temperature incubator at 37 ℃ for reaction for 1 h. Then taking out the reaction product, adding 0.5 mu L of 2.5M NaCl solution, uniformly mixing by using a pipette, placing in a PCR instrument for slow annealing after short-time centrifugation, wherein the annealing parameters are as follows: incubating at 95 ℃ for 3 min; every 10S, the temperature is reduced by 1 ℃ for 70 cycles; finally, the temperature is kept at 12 ℃. The sense-and-antisense strand primer at this time has been phosphorylated and forms a double-stranded DNA fragment by base complementary pairing.

(3) Diluting the double-stranded DNA fragment obtained in the step (2), and inserting the diluted double-stranded DNA fragment into a crRNA expression gene of a pCrAb-km plasmid through a Golden Gate cloning reaction. mu.L of the annealed product obtained in step (2) was taken and added to 9. mu.L of ddH₂And O, blowing and sucking by a liquid shifter, and uniformly mixing for later use. Then configuring a Golden Gate cloning reaction system: 1 μ L of pCrAb-km plasmid (50 ng/. mu.L), 1 μ L of tenfold diluted annealed product, 1 μ L of 10 XT 4 DNA ligase Buffer, 0.5 μ L of L T4 DNA ligase, 0.5 μ L of BsaI-HF, 6 μ L of ddH₂And O. T4 DNA ligase Buffer, T4 DNA ligase and BsaI-HF used in the Golden Gate cloning reaction were purchased from NEB (Beijing) Ltd. After the reaction system is configured, the cloning reaction is executed in a PCR instrument, and the reaction parameters are as follows: incubating at 37 ℃ for 3min and 16 ℃ for 3min for 25 cycles; incubation at 50 ℃ for 5min; incubating at 80 deg.C for 15 min; finally, the temperature is kept at 12 ℃.

(4) mu.L of the reaction product obtained in step (3) was added to 100. mu.L of E.coli TOP10 competent cells (Shanghai Tulo harbor Biotech Co., Ltd.) to carry out heat shock transformation, and the transformation step was carried out with reference to the instructions attached to the competent cells. After the conversion is finished, 100 mu L of resuscitation solution is taken and coated on an LB solid culture medium plate with the concentration of 50 mu g/mL kanamycin, after the resuscitation solution is absorbed by the solid culture medium, the plate is placed upside down in a constant temperature incubator at 37 ℃ for culture overnight until a single colony grows out. Several single colonies were randomly picked with a sterile inoculating loop and inoculated into 5mL LB liquid tubes containing kanamycin at a concentration of 50. mu.g/mL, and the tubes were placed in a slant in a 37 ℃ constant temperature shaker for overnight shaking culture. Plasmids were extracted using a small plasmid extraction kit from Tiangen Biochemical technology (Beijing) Ltd, and the extraction steps were carried out according to the instructions provided in the kit. The extracted plasmid is sent to Beijing Optimus department New industry biotechnology Limited company for DNA sequencing, and the correct insertion of the target spacer sequence into the crRNA expression gene is detected. The sequence of M13R was 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 13) using the universal primer M13R as a sequencing primer.

Example 4

Taking the wild type acinetobacter baumannii ATCC17978 strain as an example, wild type acinetobacter baumannii competent cells were prepared:

the cryopreservation tube of wild type Acinetobacter baumannii ATCC17978 strain was taken out from a refrigerator at-80 ℃ and placed in a clean bench. After the bacteria liquid in the frozen tube is dipped by using an aseptic inoculating loop, the bacteria liquid is streaked and inoculated on an LB solid culture medium flat plate without antibiotics. The streaked plates were placed upside down in a 37 ℃ incubator overnight until the cells grew out. And (3) selecting a single colony by using an aseptic inoculating loop, inoculating the single colony into a 3mL LB liquid test tube without antibiotics, and obliquely placing the test tube in a constant-temperature shaking table at 37 ℃ for shaking culture for more than 6h until the bacterial liquid is turbid. 0.5mL of the bacterial liquid is sucked from the test tube and inoculated into a50 mL LB liquid triangular flask without antibiotics, and the triangular flask is placed in a constant temperature shaking table at 37 ℃ for continuous shaking culture. When the OD600 value of the bacterial liquid reaches 0.6-0.8, the triangular flask is immediately taken out and ice bath is carried out for 15 min. Transferring the ice-cooled bacterial liquid into a sterile 50mL centrifuge tube, centrifuging for 5min in a centrifuge with the temperature precooled to 4 ℃ and the centrifugal force of 3200g, discarding the culture medium supernatant, and keeping the lower layer of thallus precipitate. Adding 25mL of sterile 10% glycerol solution precooled to 4 ℃ into the thallus sediment, resuspending the thallus by means of blowing and sucking by a pipette tip and the like, then centrifuging again by the same centrifugal parameters, removing supernatant and obtaining the thallus sediment again. The glycerol washing and centrifugation steps were repeated once. 1mL of a sterile 10% glycerol solution precooled to 4 ℃ is used for resuspending the thallus precipitate, and the prepared bacterial suspension is the wild Acinetobacter baumannii competent cells. The prepared competent cells were aliquoted in 50. mu.L aliquots into sterile EP tubes, snap frozen with liquid nitrogen and stored in a-80 ℃ freezer.

Competent cells of various wild-type A.baumannii strains can also be prepared, and the wild-type A.baumannii ATCC17978 strain is only used as an example here.

Example 5

Electrotransformation of DNA into acinetobacter baumannii competent cells:

one of the competent cells of the wild type A.baumannii strain ATCC17978 prepared in example 4 was taken and placed on ice for several minutes until it was thawed. The DNA solution not exceeding the competent volume 1/10 was added to the just thawed competent cells, and the mixture of competent cells and DNA solution was transferred by pipette into a 2mm electric rotor (Burley Co., USA) precooled on ice, and allowed to stand on ice for 1-5min with a lid on the cup. The electric rotor was taken out, and after the condensed water on the outer side of the electric rotor was wiped off, electric pulse conversion was performed using a GenePulser Xcell electric pulse converter (Berle Co.). The parameters of the electrical pulse for each transformation were: 2.5kV, 200 omega, 25 muF, the mode is exponential decay wave, and the electric pulse time is about 5 ms. After the instrument prompts that the electric pulse is finished, 1ml of LB liquid without antibiotics is added into the electric transfer cup immediately, a pipettor is used for blowing and sucking the heavy suspension bacteria, and then the bacteria liquid is transferred into a sterile EP tube. And placing the EP tube in a constant-temperature shaking table at 37 ℃ for shaking culture for 1-2h to resuscitate cells, then coating a certain volume of resuscitating bacterial liquid on an LB solid culture medium plate containing corresponding antibiotics, and after the bacterial liquid is absorbed by the solid culture medium, placing the plate in a constant-temperature incubator at 37 ℃ upside down for culture overnight until single colonies grow out. Only cells that have successfully transferred the corresponding DNA will grow a single colony on the plate. Any kind of circular plasmid DNA, linear DNA fragments or a mixture of both can be electrotransformed.

Example 6

Preparation of Acinetobacter baumannii competent cells containing pFNCpfAb-apr plasmid:

the pFNPfAb-apr plasmid was electrically transformed into competent cells of wild-type A.baumannii ATCC17978 strain according to the method of example 5, to obtain a single colony of a transformant of A.baumannii ATCC17978 strain containing the pFNPfAb-apr plasmid. A single colony is picked by using an aseptic inoculating loop and inoculated into a 3mL LB liquid test tube containing the apramycin with the concentration of 50 mug/mL, and the test tube is obliquely placed in a constant temperature shaking table at 37 ℃ for shaking culture for more than 6 hours until the bacterial liquid is turbid. 0.5mL of the cell suspension was aspirated from the test tube, and inoculated into a50 mL LB liquid flask containing 50. mu.g/mL apramycin, and the flask was placed in a 37 ℃ constant temperature shaking table for further shaking culture. After shaking culture for 1h, slight turbidity of the culture solution was observed, at which time 1mL of IPTG (isopropylthiogalactoside) solution at a concentration of 100. mu.M was added to the culture solution for inducing expression of the RecAB recombinase system in the pFNCpfAb-apr plasmid. After further shaking culture for 2h, the flask was taken out and ice-cooled for 15 min. Transferring the ice-cooled bacterial liquid into a sterile 50ml centrifuge tube, centrifuging for 5min in a centrifuge with the temperature precooled to 4 ℃ and the centrifugal force of 3200g, discarding the culture medium supernatant, and keeping the lower layer of thallus precipitate. Adding 25mL of sterile 10% glycerol solution precooled to 4 ℃ into the thallus sediment, sucking by using a pipette tip to resuspend the thallus sediment, then centrifuging again according to the same centrifugal parameters, removing supernatant, and obtaining the thallus sediment again. The glycerol washing and centrifugation steps were repeated once. 1mL of sterile 10% glycerol solution precooled to 4 ℃ is used for resuspending the thallus precipitate, and the prepared bacterial suspension is the acinetobacter baumannii competent cells containing pFNCpfAb-apr plasmid. The competent cells prepared were aliquoted in 50 μ L aliquots into sterile EP tubes for use.

Example 7

Identification of the PAM site recognized by FnCpf1 nuclease in acinetobacter baumannii:

the FnCpf1 nuclease can recognize sequences which are not completely identical and serve as PAM sites in different types of cells. To identify which sequences FnCpf1 nuclease can recognize as PAM sites in acinetobacter baumannii cells, a series of sequences were selected for testing in this example.

(1) 9 candidate PAM site sequences are respectively selected from the oxypR genes of the Acinetobacter baumannii ATCC17978 strain, and the corresponding sequences are GTTG, TTTA, ATTG, CTTG, TTTT, GCTC, CCTA, CCTT and AGAA.

Wherein, the target primer sequence corresponding to GTTG is as follows:

oxyR-Cpf-F1：5’-agatCATTTACATGAAGCTCAAAGT-3’(SEQ ID NO：14)

oxyR-Cpf-R1：5’-ggccACTTTGAGCTTCATGTAAATG-3’(SEQ ID NO：15)

wherein, the target primer sequence corresponding to TTTA is as follows:

oxyR-Cpf-F2：5’-agatCATGAAGCTCAAAGTGAGAAG-3’(SEQ ID NO：16)

oxyR-Cpf-R2：5’-ggccCTTCTCACTTTGAGCTTCATG-3’(SEQ ID NO：17)

wherein, the target primer sequence corresponding to ATTG is as follows:

oxyR-Cpf-F3：5’-agatTCCTTGCCCTACCTTTTGACA-3’(SEQ ID NO：18)

oxyR-Cpf-R3：5’-ggccTGTCAAAAGGTAGGGCAAGGA-3’(SEQ ID NO：19)

wherein, the target primer sequence corresponding to CTTG is as follows:

oxyR-Cpf-F4：5’-agatCCCTACCTTTTGACACAAGAA-3’(SEQ ID NO：20)

oxyR-Cpf-R4：5’-ggccTTCTTGTGTCAAAAGGTAGGG-3’(SEQ ID NO：21)

wherein, the target primer sequence corresponding to TTTT is:

oxyR-Cpf-F5：5’-agatGACACAAGAAGTTTAAAAGTA-3’(SEQ ID NO：22)

oxyR-Cpf-R5：5’-ggccTACTTTTAAACTTCTTGTGTC-3’(SEQ ID NO：23)

wherein, the target primer sequence corresponding to GCTC is:

oxyR-Cpf-F6：5’-agatAAAGTGAGAAGATTGTAGAGC-3’(SEQ ID NO：24)

oxyR-Cpf-R6：5’-ggccGCTCTACAATCTTCTCACTTT-3’(SEQ ID NO：25)

wherein, the target primer sequence corresponding to CCTA is as follows:

oxyR-Cpf-F7：5’-agatGAACATGGTAATTTGGACATG-3’(SEQ ID NO：26)

oxyR-Cpf-R7：5’-ggccCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：27)

wherein, the target primer sequence corresponding to CCTT is as follows:

oxyR-Cpf-F8：5’-agatGCCCTACCTTTTGACACAAGA-3’(SEQ ID NO：28)

oxyR-Cpf-R8：5’-ggccTCTTGTGTCAAAAGGTAGGGC-3’(SEQ ID NO：29)

wherein, the target primer sequence corresponding to the AGAA is as follows:

oxyR-Cpf-F9：5’-agatCATGGTAATTTGGACATGATT-3’(SEQ ID NO：30)

oxyR-Cpf-R9：5’-ggccAATCATGTCCAAATTACCATG-3’(SEQ ID NO：31)

(2) 9 candidate PAM site sequences are respectively selected from adeB genes of the Acinetobacter baumannii ATCC17978 strain, and the corresponding sequences are GTTC, TTTG, ATTA, CTTA, TTTT, GCTG, CCTT, ACTT and CAAA.

Wherein, the target primer sequence corresponding to GTTC is:

adeB-Cpf-F1：5’-agatCAATGATGGTGATCTTTTTAG-3’(SEQ ID NO：32)

adeB-Cpf-R1：5’-ggccCTAAAAAGATCACCATCATTG-3’(SEQ ID NO：33)

wherein, the target primer sequence corresponding to TTTG is as follows:

adeB-Cpf-F2：5’-agatCCGGAATGAAATATTGGCCAA-3’(SEQ ID NO：34)

adeB-Cpf-R2：5’-ggccTTGGCCAATATTTCATTCCGG-3’(SEQ ID NO：35)

wherein, the target primer sequence corresponding to ATTA is as follows:

adeB-Cpf-F3：5’-agatCCGGTATTACCTTTGCCGGAA-3’(SEQ ID NO：36)

adeB-Cpf-R3：5’-ggccTTCCGGCAAAGGTAATACCGG-3’(SEQ ID NO：37)

wherein, the target primer sequence corresponding to CTTA is as follows:

adeB-Cpf-F4：5’-agatAAATCATCAAACATACAGTTC-3’(SEQ ID NO：38)

adeB-Cpf-R4：5’-ggccGAACTGTATGTTTGATGATTT-3’(SEQ ID NO：39)

wherein, the target primer sequence corresponding to TTTT is:

adeB-Cpf-F5：5’-agatAGTAATTACCGGTATTACCTT-3’(SEQ ID NO：40)

adeB-Cpf-R5：5’-ggccAAGGTAATACCGGTAATTACT-3’(SEQ ID NO：41)

wherein, the target primer sequence corresponding to GCTG is:

adeB-Cpf-F6：5’-agatCTTAAAATCATCAAACATACA-3’(SEQ ID NO：42)

adeB-Cpf-R6：5’-ggccTGTATGTTTGATGATTTTAAG-3’(SEQ ID NO：43)

wherein, the target primer sequence corresponding to CCTT is as follows:

adeB-Cpf-F7：5’-agatTGCCGGAATGAAATATTGGCC-3’(SEQ ID NO：44)

adeB-Cpf-R7：5’-ggccGGCCAATATTTCATTCCGGCA-3’(SEQ ID NO：45)

wherein, the target primer sequence corresponding to ACTT is as follows:

adeB-Cpf-F8：5’-agatCGTTCCAGCTACCTTCAGATG-3’(SEQ ID NO：46)

adeB-Cpf-R8：5’-ggccCATCTGAAGGTAGCTGGAACG-3’(SEQ ID NO：47)

wherein, the target primer sequence corresponding to CAAA is as follows:

adeB-Cpf-F9：5’-agatCATACAGTTCCAATGATGGTG-3’(SEQ ID NO：48)

adeB-Cpf-R9：5’-ggccCACCATCATTGGAACTGTATG-3’(SEQ ID NO：49)

the 18 pairs of primer sequences in this example were sent to Beijing Optimalaceae New Biotechnology Co., Ltd for primer synthesis, after receiving the primers, each pair of primers was inserted into the crRNA expression gene of pCrAb-km plasmid according to the method in example 3, to obtain pCrAb-km plasmid containing the spacer sequence of each target. Aiming at each target point, several transformants are respectively selected, cultured by shake bacteria, extracted into plasmids and sent to Beijing Optimalaceae New industry biotechnology limited company for DNA sequencing verification. The plasmids with the correct sequencing were each electro-transformed into Acinetobacter baumannii competent cells containing pFNCpfAb-apr plasmid prepared according to the method of example 6, according to the method of example 5. After the completion of the recovery, 100. mu.L of recovery bacterial liquid of each sample is coated on an LB solid culture medium plate containing 50. mu.g/mL apramycin and 50. mu.g/mL kanamycin, after the bacterial liquid is absorbed by the solid culture medium, the plate is placed upside down in an incubator at 37 ℃ for overnight culture, and the number of single colonies of transformants on each plate is counted. This experiment was repeated three times. The number of single colonies of transformants grown on each plate was counted and shown in FIG. 2.

Acinetobacter baumannii lacks a Non-homologous end joining (NHEJ) repair mode, and in the absence of a homologous repair template, FnCpf1 nuclease cleaves double strands of Acinetobacter baumannii genomic DNA and causes bacterial death. Therefore, we can judge whether the FnCpf1 nuclease can recognize a sequence as a PAM site according to the number of single colonies of the transformant. If the FnCpf1 nuclease can efficiently recognize a certain sequence as a PAM site, a transformant single colony can not grow or grows sporadically; if FnCpf1 nuclease can only recognize a certain sequence inefficiently or can not recognize the sequence as a PAM site, a large number of single colonies of transformants can grow. Summarizing the data obtained in the example, the FnCpf1 nuclease can be finally identified to be capable of efficiently recognizing TTN (N represents any base of T/A/G/C) and CTV (V represents any base of A/G/C) sequences as PAM sites in Acinetobacter baumannii.

Example 8

Identification of target sequence length recognizable by FnCpf1 nuclease in acinetobacter baumannii:

the target sequence length recognized by FnCpf1 nuclease in different cells is not exactly the same. To identify the range of target lengths that FnCpf1 nuclease can recognize in acinetobacter baumannii cells, a series of target sequences of different lengths were selected for testing.

(1) CTA sequence is selected from Acinetobacter baumannii ATCC17978 strain oxyR gene as PAM locus, and 9 sequences with different lengths are respectively intercepted as target sequences.

Wherein, the primer sequence corresponding to the target spot with the length of 15nt is as follows:

oxyR-Cpf-F15nt：5’-agatGAACATGGTAATTTG-3’(SEQ ID NO：50)

oxyR-Cpf-R15nt：5’-ggccCAAATTACCATGTTC-3’(SEQ ID NO：51)

wherein, the primer sequence corresponding to the target spot with the length of 17nt is as follows:

oxyR-Cpf-F17nt：5’-agatGAACATGGTAATTTGGA-3’(SEQ ID NO：52)

oxyR-Cpf-R17nt：5’-ggccTCCAAATTACCATGTTC-3’(SEQ ID NO：53)

wherein, the primer sequence corresponding to the target spot with the length of 19nt is as follows:

oxyR-Cpf-F19nt：5’-agatGAACATGGTAATTTGGACA-3’(SEQ ID NO：54)

oxyR-Cpf-R19nt：5’-ggccTGTCCAAATTACCATGTTC-3’(SEQ ID NO：55)

wherein, the primer sequence corresponding to the target spot with the length of 20nt is as follows:

oxyR-Cpf-F20nt：5’-agatGAACATGGTAATTTGGACAT-3’(SEQ ID NO：56)

oxyR-Cpf-R20nt：5’-ggccATGTCCAAATTACCATGTTC-3’(SEQ ID NO：57)

wherein, the primer sequence corresponding to the target spot with the length of 21nt is as follows:

oxyR-Cpf-F21nt：5’-agatGAACATGGTAATTTGGACATG-3’(SEQ ID NO：26)

oxyR-Cpf-R21nt：5’-ggccCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：27)

wherein, the primer sequence corresponding to the target spot with the length of 22nt is as follows:

oxyR-Cpf-F22nt：5’-agatGAACATGGTAATTTGGACATGA-3’(SEQ ID NO：58)

oxyR-Cpf-R22nt：5’-ggccTCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：59)

wherein, the primer sequence corresponding to the target spot with the length of 23nt is as follows:

oxyR-Cpf-F23nt：5’-agatGAACATGGTAATTTGGACATGAT-3’(SEQ ID NO：60)

oxyR-Cpf-R23nt：5’-ggccATCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：61)

wherein, the primer sequence corresponding to the target spot with the length of 25nt is as follows:

oxyR-Cpf-F25nt：5’-agatGAACATGGTAATTTGGACATGATTG-3’(SEQ ID NO：62)

oxyR-Cpf-R25nt：5’-ggccCAATCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：63)

wherein, the primer sequence corresponding to the target point with the length of 30nt is as follows:

oxyR-Cpf-F30nt：5’-agatGAACATGGTAATTTGGACATGATTGTCCTT-3’(SEQ ID NO：64)

oxyR-Cpf-R30nt：5’-ggccAAGGACAATCATGTCCAAATTACCATGTTC-3’(SEQ ID NO：65)

(2) TTC sequences are selected from the hscB genes of the Acinetobacter baumannii ATCC17978 strain to be used as PAM sites, and 9 sequences with different lengths are respectively intercepted to be used as target sequences.

hscB-Cpf-F15nt：5’-agatTACAATCCGCTTTAG-3’(SEQ ID NO：66)

hscB-Cpf-R15nt：5’-ggccCTAAAGCGGATTGTA-3’(SEQ ID NO：67)

hscB-Cpf-F17nt：5’-agatTACAATCCGCTTTAGAA-3’(SEQ ID NO：68)

hscB-Cpf-R17nt：5’-ggccTTCTAAAGCGGATTGTA-3’(SEQ ID NO：69)

hscB-Cpf-F19nt：5’-agatTACAATCCGCTTTAGAACT-3’(SEQ ID NO：70)

hscB-Cpf-R19nt：5’-ggccAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：71)

hscB-Cpf-F20nt：5’-agatTACAATCCGCTTTAGAACTT-3’(SEQ ID NO：72)

hscB-Cpf-R20nt：5’-ggccAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：73)

hscB-Cpf-F21nt：5’-agatTACAATCCGCTTTAGAACTTC-3’(SEQ ID NO：74)

hscB-Cpf-R21nt：5’-ggccGAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：75)

hscB-Cpf-F22nt：5’-agatTACAATCCGCTTTAGAACTTCG-3’(SEQ ID NO：76)

hscB-Cpf-R22nt：5’-ggccCGAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：77)

hscB-Cpf-F23nt：5’-agatTACAATCCGCTTTAGAACTTCGT-3’(SEQ ID NO：78)

hscB-Cpf-R23nt：5’-ggccACGAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：79)

hscB-Cpf-F25nt：5’-agatTACAATCCGCTTTAGAACTTCGTGA-3’(SEQ ID NO：80)

hscB-Cpf-R25nt：5’-ggccTCACGAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：81)

wherein, the primer sequence corresponding to the target spot with the length of 30nt is as follows:

hscB-Cpf-F30nt：5’-agatTACAATCCGCTTTAGAACTTCGTGAACAAC-3’(SEQ ID NO：82)

hscB-Cpf-R30nt：5’-ggccGTTGTTCACGAAGTTCTAAAGCGGATTGTA-3’(SEQ ID NO：83)

the 17 pairs of primer sequences in this example (wherein the oxyR-Cpf-F21nt and the oxyR-Cpf-F21nt primers were synthesized in example 7) were sent to Beijing Optimalaceae New Biotechnology Co., Ltd for primer synthesis, and after receiving the primers, each pair of primers was inserted into the crRNA expression gene of pCrAb-km plasmid according to the method in example 3 to obtain pCrAb-km plasmids with different target sequence lengths. Aiming at each target point, several transformants are respectively selected, cultured by shake bacteria, extracted into plasmids and sent to Beijing Optimalaceae New industry biotechnology limited company for DNA sequencing verification. The plasmids with the correct sequencing were each electro-transformed into Acinetobacter baumannii competent cells containing pFNCpfAb-apr plasmid prepared according to the method of example 6, according to the method of example 5. After the completion of the recovery, 100. mu.L of recovery bacterial liquid of each sample is coated on an LB solid culture medium plate containing 50. mu.g/mL apramycin and 50. mu.g/mL kanamycin, after the bacterial liquid is absorbed by the solid culture medium, the plate is placed upside down in an incubator at 37 ℃ for overnight culture, and the number of single colonies of transformants on each plate is counted. This experiment was repeated three times. The number of single colonies of transformants grown on each plate was counted and shown in FIG. 3.

Acinetobacter baumannii lacks a Non-homologous end joining (NHEJ) repair mode, and in the absence of a homologous repair template, FnCpf1 nuclease cleaves double strands of Acinetobacter baumannii genomic DNA and causes bacterial death. Therefore, we can judge whether the FnCpf1 nuclease can recognize a target sequence with a certain length according to the number of single colonies of the transformant. If the FnCpf1 nuclease can efficiently recognize a target sequence with a certain length, the target sequence is cut, so that a transformant single colony does not grow or grows sporadically on a plate; if FnCpf1 nuclease does not recognize or recognizes target sequences of a certain length inefficiently, it will cut little or no cleavage, resulting in a large number of single colonies of transformants on the plate. Summarizing the data obtained in the example, FnCpf1 nuclease is finally identified to be capable of efficiently recognizing the target sequence with the length ranging from 19nt to 25nt in the acinetobacter baumannii.

Example 9

pFNCpfAb/pCrAb two-plasmid system realizes efficient genome editing of Acinetobacter baumannii:

this example selects the uspA gene of acinetobacter baumannii ATCC17978 strain, which was subjected to traceless knockout using pFnCpfAb/pCrAb two-plasmid system. The PCR verification result of the uspA gene knockout is shown in FIG. 4A, and the DNA sequencing result of the uspA gene knockout strain is shown in FIG. 4B.

Wherein the step of knocking out the uspA gene is as follows:

(1) selecting a target point from the uspA gene, wherein the PAM site sequence of the selected target point is TTA, and the target point sequence is as follows: 5'-AGACGGGGCAAACCAATGA-3' (SEQ ID NO: 84), the corresponding sense and antisense strand primer sequences being:

uspA-Cpf-F19nt：5’-agatAGACGGGGCAAACCAATGA-3’(SEQ ID NO：85)

uspA-Cpf-R19nt：5’-ggccTCATTGGTTTGCCCCGTCT-3’(SEQ ID NO：86)

the positive and negative strand primer sequence was sent to Beijing Optimalaceae New Biotechnology Co., Ltd for primer synthesis, and inserted into crRNA expression gene of pCrAb-km plasmid according to the method in example 3, and the pCrAb-km-uspA plasmid was obtained by DNA sequencing verification.

(2) 40nt DNA sequences are selected from the upstream and downstream of the uspA target point respectively to serve as upstream homologous sequences of a homologous repair template, and the DNA sequences between the upstream and downstream homologous sequences are deleted.

The upstream sequences selected here are:

5’-ATTCTTGTACCAATTGACGGTTCTGAAACTTCTATGGTTG-3’(SEQ ID NO：87)

the downstream sequence is:

5’-GGACTTAGTGTAGAAACCAAATTACTTGAAGGTTTTGTTG-3’(SEQ ID NO：88)。

the upstream and downstream sequences were spliced to a complete 80nt sequence, uspA-ssDNA, whose sequence was 5'-ATTCTTGTACCAATTGACGGTTCTGAAACTTCTATGGTTGGGACTTAGTGTAGAAACCAAATTACTTGAAGGTTTTGTTG-3' (SEQ ID NO: 89). The 80nt sequence is sent to Beijing Optimalaceae new biotechnology limited company for ssDNA synthesis, and the synthesized uspA-ssDNA is used as a homologous repair template for uspA gene knockout.

(3) Selecting a sense strand sequence as a colony PCR amplification forward primer and a DNA sequencing primer at the upstream of the upstream homologous sequence of the uspA gene, wherein the selected sequence is uspA-seq-F: 5'-ATTGTTGGTGGCGTACCTG-3' (SEQ ID NO: 90). And (2) selecting an antisense chain sequence at the downstream of the downstream homologous sequence of the uspA gene as a colony PCR amplification reverse primer, wherein the selected sequence is uspA-seq-R: 5'-TAATTGCCTGCCTTGCTGT-3' (SEQ ID NO: 91). The sequence of uspA-seq-F and the sequence of uspA-seq-R are sent to Beijing Optigugaku New Biotechnology Co., Ltd for primer synthesis for subsequent experiments. In the step, the selected colony PCR amplification primer is positioned at the outer side of the homologous repair template, and no matter whether the target gene is knocked out successfully or not, the target band can be obtained through PCR amplification. When the gene knockout operation is carried out, if the size of a target band obtained by PCR amplification is consistent with that of a target band obtained by amplification by taking a wild strain as a template, the target gene is not knocked out; if the target band obtained by PCR amplification is smaller than the target band obtained by amplification with the wild strain as a template, the target gene knockout is preliminarily considered to be successful.

(4) mu.L of pCrAb-km-uspA plasmid (100-200 ng/. mu.L) constructed in step (1) and 3. mu.L of uspA-ssDNA (100. mu.M) synthesized in step (2) were aspirated and mixed, followed by electrotransformation into acinetobacter baumannii competent cells containing pFNCpfAb-apr plasmid prepared in example 6 according to the method described in example 5. After the completion of the recovery, 100. mu.L of the recovery bacterial liquid was pipetted and spread on an LB solid medium plate containing 50. mu.g/mL apramycin and 50. mu.g/mL kanamycin, and after the bacterial liquid was absorbed by the solid medium, the plate was placed upside down in a 37 ℃ incubator and cultured overnight until transformants grew out.

(5) Randomly picking a single colony of the acinetobacter baumannii transformant obtained in the step (4), and performing colony PCR by using 2 XEs Taq MasterMix (Dye) of century Biotechnology GmbH to preliminarily identify whether the uspA gene is successfully knocked out. The reaction system of colony PCR is as follows: 10 μ L of 2 × Es Taq MasterMix (Dye), 0.5 μ L uspA-seq-F (10 μ M), 0.5 μ L uspA-seq-R (10 μ M), 9 μ L ddH₂And O, respectively dipping single colonies of the acinetobacter baumannii transformants by using a sterile pipette tip to each tube of the reaction system to serve as an amplification template. In addition, the wild type A.baumannii ATCC17978 strain is selected to be subjected to the same colony PCR amplification and used as a control group. After the system configuration is finished, carrying out short-time centrifugation, and then placing the system in a PCR instrument to execute amplification reaction, wherein the amplification parameters are as follows: pre-denaturation at 95 ℃ for 10 min; then denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; then fully extending for 5min at 72 ℃; finally, the temperature is kept at 12 ℃.

After completion of colony PCR amplification, 2. mu.L of product was aspirated from each tube of colony PCR sample for agarose gel electrophoresis analysis. The agarose gel concentration used here was 0.8%. The electrophoresis buffer liquid was 1 XTAE. And after the electrophoresis is finished, taking out the agarose gel, performing ultraviolet light color development photographing in a gel imager, and recording the size of a strip of the PCR amplification product. As can be seen from FIG. 4A, 6 of the single colonies of the picked 7 transformants amplified a smaller PCR target band than that of the wild-type strain, and it was preliminarily considered that the uspA gene knockout was successful in the single colonies of the 6 transformants.

(6) And (3) sending the PCR amplification product of the single colony of the 6 transformants which are successfully subjected to the preliminary identification in the step (5) and knock-out of the uspA gene to Beijing Optimalaceae New Biotechnology Limited for DNA sequencing verification, and using uspA-seq-F as a sequencing primer. The results of DNA sequencing confirmed that the uspA gene in these 6 strains had indeed been successfully knocked out, and that the knocked-out DNA fragment was consistent with the design expectation of step (2).

Therefore, pFNCpfAb/pCrAb two plasmid system can in a variety of Acinetobacter baumannii strains in its genome high efficiency editing, here only with the Acinetobacter baumannii ATCC17978 strain of uspA gene as an example.

Example 10

Elimination of pFNCpfAb-apr plasmid and pCrAb-km plasmid in Acinetobacter baumannii:

after the required Acinetobacter baumannii genome editing is completed, pFNCpfAb-apr plasmid and pCrAb-km plasmid contained in the successfully edited target strain need to be eliminated, and the specific operation steps are as follows:

inoculating the target strain into a 5mL LB liquid test tube without antibiotics by using a sterile inoculating loop, and obliquely placing the test tube in a constant temperature shaking table at 37 ℃ for shaking culture for 12-18 h. The bacterial solution in the test tube is dipped by a new sterile inoculating loop, three-zone lineation is carried out on an LB solid medium plate which does not contain antibiotics and contains 5 percent of cane sugar, and then the plate is placed upside down in an incubator at 37 ℃ for culture overnight until the thalli grow out. Theoretically, the thalli which can grow on an LB solid medium plate containing 5% of sucrose has eliminated both pFNCpfAb-apr plasmid and pCrAb-km plasmid, because both the pFNCpfAb-apr plasmid and the pCrAb-km plasmid contain a sucrose sensitive screening marker gene sacB, the expression product of the gene, sucrose levan, can catalyze the hydrolysis of sucrose into fructose and glucose, and polymerize fructose into high molecular fructosan which is lethal to bacteria.

To confirm that both the pFNCpfAb-apr plasmid and the pCrAb-km plasmid were eliminated from the bacterial cells, a single colony was picked up on an LB solid medium plate containing 5% sucrose using a sterile inoculating loop, streaked successively on an LB solid medium plate containing only 50. mu.g/mL apramycin, an LB solid medium plate containing only 50. mu.g/mL kanamycin, and an LB solid medium plate containing no antibiotic, and these streaked plates were then placed upside down in an incubator at 37 ℃ for overnight culture to observe the growth of the bacterial cells. If a single colony can only grow on an LB solid medium plate without antibiotics after streaking, but can not grow on an LB solid medium plate only containing 50. mu.g/mL apramycin and an LB solid medium plate only containing 50. mu.g/mL kanamycin, it is indicated that both the pFNCpfAb-apr plasmid and the pCrAb-km plasmid in the somatic cells of the single colony have been successfully eliminated. At this time, the target strain in which the plasmid is successfully eliminated can be preserved or used for other downstream experiments.

The above-described embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention in any way and substantially, it should be noted that those skilled in the art may make several modifications and additions without departing from the scope of the present invention, which should also be construed as a protection scope of the present invention.

Sequence listing

<120> pFNCpfAb/pCrAb double-plasmid system and application thereof

<141> 2021-03-19

<160> 91

<170> SIPOSequenceListing 1.0

<210> 1

<211> 16375

<212> DNA

<213> Artificial Sequence

<400> 1

agcttggctg ttttggcgga tgagagaaga ttttcagcct gatacagatt aaatcagaac 60

gcagaagcgg tctgataaaa cagaatttgc ctggcggcag tagcgcggtg gtcccacctg 120

accccatgcc gaactcagaa gtgaaacgcc gtagcgccga tggtagtgtg gggtctcccc 180

atgcgagagt agggaactgc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg 240

gcctttcgtt ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg 300

ggagcggatt tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca 360

taaactgcca ggcatcaaat taagcagaag gccatcctga cggatggcct ttttgcgttt 420

ctacaaactc ttttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca 480

ataaccctgg atccgggctt atcgactgca cggtgcacca atgcttctgg cgtcaggcag 540

ccatcggaag ctgtggtatg gctgtgcagg tcgtaaatca ctgcataatt cgtgtcgctc 600

aaggcgcact cccgttctgg ataatgtttt ttgcgccgac atcataacgg ttctggcaaa 660

tattctgaaa tgagctgttg acaattaatc atcggctcgt ataatgtgtg gaattgtgag 720

cggataacaa tttcacacag gaaacagaat tcatgtccat ctaccaagag tttgtgaata 780

aatactccct gtccaagacc ctccgttttg agctgatccc ccaaggcaag accctcgaaa 840

acatcaaggc acgcggcctc atcctggatg acgaaaagcg cgctaaggat tacaagaagg 900

caaagcagat catcgacaag taccaccagt tcttcatcga agagatcctg tcctccgtgt 960

gcatctccga ggacctgctc cagaactact ccgatgtcta cttcaagctc aagaagtccg 1020

atgacgataa cctgcagaag gacttcaagt ccgctaagga taccatcaag aagcagatct 1080

ccgaatacat caaggattcc gagaagttca agaacctctt caaccagaac ctgatcgacg 1140

caaagaaggg ccaggaatcc gatctcatcc tgtggctcaa gcagtccaag gataacggca 1200

tcgagctctt caaggccaac tccgacatca ccgacatcga tgaagctctg gagatcatca 1260

agtccttcaa gggctggacc acctacttca agggcttcca cgaaaaccgc aagaacgtgt 1320

actcctccaa cgatatccca acctctatca tctaccgcat cgtcgacgat aacctgccaa 1380

agttcctcga aaacaaggca aagtacgagt ccctgaagga taaggcccca gaagctatca 1440

actacgagca gatcaagaag gacctggccg aagagctcac cttcgacatc gattacaaga 1500

cctctgaagt gaaccagcgc gtcttctccc tcgatgaagt gttcgagatc gccaacttca 1560

acaactacct gaaccagtcc ggcatcacca agttcaacac catcatcggc ggcaagttcg 1620

tcaacggcga aaacaccaag cgcaagggca tcaacgagta catcaacctc tactcccagc 1680

agatcaacga taagaccctg aagaagtaca agatgtccgt gctcttcaag cagatcctgt 1740

ccgacaccga atccaagtcc ttcgtcatcg acaagctgga ggacgattcc gatgtggtca 1800

ccaccatgca gtccttctac gaacagatcg cagccttcaa gaccgtggaa gagaagtcca 1860

tcaaggagac cctctccctg ctcttcgacg atctgaaggc tcagaagctg gatctctcca 1920

agatctactt caagaacgac aagtccctga ccgatctctc ccagcaggtc ttcgacgatt 1980

actccgtgat cggcaccgca gtcctggaat acatcaccca gcagatcgcc ccaaagaacc 2040

tcgataaccc atccaagaag gaacaggagc tgatcgccaa gaagaccgaa aaggctaagt 2100

acctgtccct cgagaccatc aagctggctc tcgaagagtt caacaagcac cgcgacatcg 2160

ataagcagtg ccgcttcgaa gagatcctcg caaacttcgc tgcaatccca atgatcttcg 2220

acgaaatcgc acagaacaag gataacctgg cccagatctc catcaagtac cagaaccagg 2280

gcaagaagga tctgctccag gcctccgctg aggacgatgt gaaggcaatc aaggacctgc 2340

tcgatcagac caacaacctg ctccacaagc tgaagatctt ccacatctcc cagtccgaag 2400

acaaggccaa catcctcgac aaggatgagc acttctacct ggtgttcgaa gagtgctact 2460

tcgaactcgc taacatcgtc ccactgtaca acaagatccg caactacatc acccagaagc 2520

catactccga tgaaaagttc aagctcaact tcgagaactc caccctggca aacggctggg 2580

acaagaacaa ggaaccagat aacaccgcca tcctcttcat caaggacgat aagtactacc 2640

tgggcgtgat gaacaagaag aacaacaaga tcttcgacga taaggccatc aaggaaaaca 2700

agggcgaggg ctacaagaag atcgtgtaca agctgctccc aggcgctaac aagatgctcc 2760

caaaggtctt cttctccgca aagtccatca agttctacaa cccatccgaa gatatcctgc 2820

gcatccgcaa ccactccacc cacaccaaga acggctcccc acagaagggc tacgaaaagt 2880

tcgagttcaa catcgaagac tgccgcaagt tcatcgattt ctacaagcag tccatctcca 2940

agcacccaga gtggaaggac ttcggcttcc gcttctccga tacccagcgc tacaactcca 3000

tcgatgaatt ctaccgcgaa gtggagaacc agggctacaa gctgaccttc gaaaacatct 3060

ccgagtccta catcgattcc gtggtcaacc agggcaagct gtacctcttc cagatctaca 3120

acaaggactt ctccgcttac tccaagggcc gcccaaacct gcacaccctc tactggaagg 3180

cactcttcga cgaacgcaac ctgcaggatg tggtctacaa gctcaacggc gaagcagagc 3240

tgttctaccg caagcagtcc atcccaaaga agatcaccca cccagccaag gaagcaatcg 3300

ccaacaagaa caaggataac ccaaagaagg aatccgtgtt cgagtacgac ctgatcaagg 3360

ataagcgctt caccgaggac aagttcttct tccactgccc aatcaccatc aacttcaagt 3420

cctccggcgc caacaagttc aacgatgaaa tcaacctgct cctgaaggag aaggctaacg 3480

acgtgcacat cctgtccatc gatcgcggcg aacgccacct cgcctactac accctggtcg 3540

acggcaaggg caacatcatc aagcaggaca ccttcaacat catcggcaac gatcgcatga 3600

agaccaacta ccacgacaag ctggccgcta tcgagaagga ccgcgattcc gctcgcaagg 3660

attggaagaa gatcaacaac atcaaggaaa tgaaggaagg ctacctctcc caggtggtcc 3720

acgaaatcgc taagctggtg atcgagtaca acgcaatcgt ggtcttcgaa gacctgaact 3780

tcggcttcaa gcgcggccgc ttcaaggtgg agaagcaggt ctaccagaag ctggaaaaga 3840

tgctcatcga gaagctgaac tacctcgtgt tcaaggacaa cgaattcgat aagaccggcg 3900

gcgtcctccg tgcataccag ctgaccgccc cattcgagac cttcaagaag atgggcaagc 3960

agaccggcat catctactac gtgccagctg gcttcacctc taagatctgc ccagtgaccg 4020

gcttcgtcaa ccagctctac ccaaagtacg aatccgtctc caagtcccag gagttcttct 4080

ccaagttcga caagatctgc tacaacctgg ataagggcta cttcgaattc tccttcgact 4140

acaagaactt cggcgataag gcagccaagg gcaagtggac catcgcatcc ttcggctccc 4200

gcctcatcaa cttccgcaac tccgacaaga accacaactg ggatacccgc gaagtgtacc 4260

caaccaagga actggagaag ctcctgaagg attactccat cgaatacggc cacggcgagt 4320

gcatcaaggc tgcaatctgc ggcgaatccg acaagaagtt cttcgcaaag ctgacctctg 4380

tgctcaacac catcctgcag atgcgcaact ccaagaccgg caccgagctg gattacctca 4440

tctccccagt ggccgacgtc aacggcaact tcttcgattc ccgccaggct ccaaagaaca 4500

tgccacagga cgctgatgca aacggcgcct accacatcgg tctgaagggt ctcatgctcc 4560

tgggtcgcat caagaacaac caggaaggca agaagctgaa tctcgtcatt aagaacgaag 4620

aatactttga atttgtccag aaccgcaata actaagtcga cctgcaggca tgcgcaactt 4680

tatgcccatg caacagaaac tataaaaaat acagagaatg aaaagaaaca gatagatttt 4740

ttagttcttt aggcccgtag tctgcaaatc cttttatgat tttctatcaa acaaaagagg 4800

aaaatagacc agttgcaatc caaacgagag tctaatagaa tgaggtcgaa aagtaaatcg 4860

cgcgggtttg ttactgataa agcaggcaag acctaaaatg tgtaaagggc aaagtgtata 4920

ctttggcgtc accccttaca tattttaggt ctttttttat tgtgcgtaac taacttgcca 4980

tcttcaaaca ggagggctgg aagaagcaga ccgctaacac agtacataaa aaaggagaca 5040

tgaacgatga acatcaaaaa gtttgcaaaa caagcaacag tattaacctt tactaccgca 5100

ctgctggcag gaggcgcaac tcaagcgttt gcgaaagaaa cgaaccaaaa gccatataag 5160

gaaacatacg gcatttccca tattacacgc catgatatgc tgcaaatccc tgaacagcaa 5220

aaaaatgaaa aatatcaagt tcctgagttc gattcgtcca caattaaaaa tatctcttct 5280

gcaaaaggcc tggacgtttg ggacagctgg ccattacaaa acgctgacgg cactgtcgca 5340

aactatcacg gctaccacat cgtctttgca ttagccggag atcctaaaaa tgcggatgac 5400

acatcgattt acatgttcta tcaaaaagtc ggcgaaactt ctattgacag ctggaaaaac 5460

gctggccgcg tctttaaaga cagcgacaaa ttcgatgcaa atgattctat cctaaaagac 5520

caaacacaag aatggtcagg ttcagccaca tttacatctg acggaaaaat ccgtttattc 5580

tacactgatt tctccggtaa acattacggc aaacaaacac tgacaactgc acaagttaac 5640

gtatcagcat cagacagctc tttgaacatc aacggtgtag aggattataa atcaatcttt 5700

gacggtgacg gaaaaacgta tcaaaatgta cagcagttca tcgatgaagg caactacagc 5760

tcaggcgaca accatacgct gagagatcct cactacgtag aagataaagg ccacaaatac 5820

ttagtatttg aagcaaacac tggaactgaa gatggctacc aaggcgaaga atctttattt 5880

aacaaagcat actatggcaa aagcacatca ttcttccgtc aagaaagtca aaaacttctg 5940

caaagcgata aaaaacgcac ggctgagtta gcaaacggcg ctctcggtat gattgagcta 6000

aacgatgatt acacactgaa aaaagtgatg aaaccgctga ttgcatctaa cacagtaaca 6060

gatgaaattg aacgcgcgaa cgtctttaaa atgaacggca aatggtatct gttcactgac 6120

tcccgcggat caaaaatgac gattgacggc attacgtcta acgatattta catgcttggt 6180

tatgtttcta attctttaac tggcccatac aagccgctga acaaaactgg ccttgtgtta 6240

aaaatggatc ttgatcctaa cgatgtaacc tttacttact cacacttcgc tgtacctcaa 6300

gcgaaaggaa acaatgtcgt gattacaagc tatatgacaa acagaggatt ctacgcagac 6360

aaacaatcaa cgtttgcgcc tagcttcctg ctgaacatca aaggcaagaa aacatctgtt 6420

gtcaaagaca gcatccttga acaaggacaa ttaacagtta acaaataaaa acgcaaaaga 6480

aaatgccgat tatggtgcac tctcagtaca atctgctctg atgccgtatc gataccgtcg 6540

acctcgaggg ggggcccggt accatcccaa tacgcgtcaa ttcacggatc cggttcatgt 6600

gcagctccat cagcaaaagg ggatgataag tttatcacca ccgactattt gcaacagtgc 6660

cgttgatcgt gctatgatcg actgatgtca tcagcggtgg agtgcaatgt cgtgcaatac 6720

gaatggcgaa aagccgagct catcggtcag cttctcaacc ttggggttac ccccggcggt 6780

gtgctgctgg tccacagctc cttccgtagc gtccggcccc tcgaagatgg gccacttgga 6840

ctgatcgagg ccctgcgtgc tgcgctgggt ccgggaggga cgctcgtcat gccctcgtgg 6900

tcaggtctgg acgacgagcc gttcgatcct gccacgtcgc ccgttacacc ggaccttgga 6960

gttgtctctg acacattctg gcgcctgcca aatgtaaagc gcagcgccca tccatttgcc 7020

tttgcggcag cggggccaca ggcagagcag atcatctctg atccattgcc cctgccacct 7080

cactcgcctg caagcccggt cgcccgtgtc catgaactcg atgggcaggt acttctcctc 7140

ggcgtgggac acgatgccaa cacgacgctg catcttgccg agttgatggc aaaggttccc 7200

tatggggtgc cgagacactg caccattctt caggatggca agttggtacg cgtcgattat 7260

ctcgagaatg accactgctg tgagcgcttt gccttggcgg acaggtggct caaggagaag 7320

agccttcaga aggaaggtcc agtcggtcat gcctttgctc ggttgatccg ctcccgcgac 7380

attgtggcga cagccctggg tcaactgggc cgagatccgt tgatcttcct gcatccgcca 7440

gaggcgggat gcgaagaatg cgatgccgct cgccagtcga ttggctgact gtcagaccaa 7500

gtttactcat atatacttta gattgatttc tgaaagcgac caggtgctcg gcgtggcaag 7560

actcgcagcg aacccgtaga aagccatgct ccagccgccc gcattggaga aattcttcaa 7620

attcccgttg cacatagccc ggcaattcct ttccctgctc tgccataagc gcagcgaatg 7680

ccgggtaata ctcgtcaacg atctgataga gaagggtttg ctcgggtcgg tggctctggt 7740

aacgaccagt atcccgatcc cggctggccg tcctggccgc cacatgaggc atgttccgcg 7800

tccttgcaat actgtgttta catacagtct atcgcttagc ggaaagttct tttaccctca 7860

gccgaaatgc ctgccgttgc tagacattgc cagccagtgc ccgtcactcc cgtactaact 7920

gtcacgaacc cctgcaataa ctgtcacgcc cccctgcaat aactgtcacg aacccctgca 7980

ataactgtca cgcccccaaa cctgcaaacc cagcaggggc gggggctggc ggggtgttgg 8040

aaaaatccat ccatgattat ctaagaataa tccactaggc gcggttatca gcgcccttgt 8100

ggggcgctgc tgcccttgcc caatatgccc ggccagaggc cggatagctg gtctattcgc 8160

tgcgctaggc tacacaccgc cccaccgctg cgcggcaggg ggaaaggcgg gcaaagcccg 8220

ctaaacccca caccaaaccc cgcagaaata cgctggagcg cttttagccg ctttagcggc 8280

ctttccccct acccgaaggg tgggggcgcg tgtgcagccc cgcagggcct gtctcggtcg 8340

atcattcagc ccggctcatc cttctggcgt ggcggcagac cgaacaaggc gcggtcgtgg 8400

tcgcgttcaa ggtacgcatc cattgccgcc atgagccgat cctccggcca ctcgctgctg 8460

ttcaccttgg ccaaaatcat ggcccccacc agcaccttgc gccttgtttc gttcttgcgc 8520

tcttgctgct gttcccttgc ccgctcccgc tgaatttcgg cattgattcg cgctcgttgt 8580

tcttcgagct tggccagccg atccgccgcc ttgttgctcc ccttaaccat cttgacaccc 8640

cattgttaat gtgctgtctc gtaggctatc atggaggcac agcggcggca atcccgaccc 8700

tactttgtag gggagggcgc acttaccggt ttctcttcga gaaactggcc taacggccac 8760

ccttcgggcg gtgcgctctc cgagggccat tgcatggagc cgaaaagcaa aagcaacagc 8820

gaggcagcat ggcgatttat caccttacgg cgaaaaccgg cagcaggtcg ggcggccaat 8880

cggccagggc caaggccgac tacatccagc gcgaaggcaa gtatgcccgc gacatggatg 8940

aagtcttgca cgccgaatcc gggcacatgc cggagttcgt cgagcggccc gccgactact 9000

gggatgctgc cgacctgtat gaacgcgcca atgggcggct gttcaaggag gtcgaatttg 9060

ccctgccggt cgagctgacc ctcgaccagc agaaggcgct ggcgtccgag ttcgcccagc 9120

acctgaccgg tgccgagcgc ctgccgtata cgctggccat ccatgccggt ggcggcgaga 9180

acccgcactg ccacctgatg atctccgagc ggatcaatga cggcatcgag cggcccgccg 9240

ctcagtggtt caagcggtac aacggcaaga ccccggagaa gggcggggca cagaagaccg 9300

aagcgctcaa gcccaaggca tggcttgagc agacccgcga ggcatgggcc gaccatgcca 9360

accgggcatt agagcgggct ggccacgacg cccgcattga ccacagaaca cttgaggcgc 9420

agggcatcga gcgcctgccc ggtgttcacc tggggccgaa cgtggtggag atggaaggcc 9480

ggggcatccg caccgaccgg gcagacgtgg ccctgaacat cgacaccgcc aacgcccaga 9540

tcatcgactt acaggaatac cgggaggcaa tagaccatga acgcaatcga cagagtgaag 9600

aaatccagag gcatcaacga gttagcggag cagatcgaac cgctggccca gagcatggcg 9660

acactggccg acgaagcccg gcaggtcatg agccagacca agcaggccag cgaggcgcag 9720

gcggcggagt ggctgaaagc ccagcgccag acaggggcgg catgggtgga gctggccaaa 9780

gagttgcggg aggtagccgc cgaggtgagc agcgccgcgc agagcgcccg gagcgcgtcg 9840

cgggggtggc actggaagct atggctaacc gtgatgctgg cttccatgat gcctacggtg 9900

gtgctgctga tcgcatcgtt gctcttgctc gacctgacgc cactgacaac cgaggacggc 9960

tcgatctggc tgcgcttggt ggcccgatga agaacgacag gactttgcag gccataggcc 10020

gacagctcaa ggccatgggc tgtgagcgct tcgatatcgg cgtcagggac gcacccaccg 10080

gccagatgat gaaccgggaa tggtcagccg ccgaagtgct ccagaacacg ccatggctca 10140

agcggatgaa tgcccagggc aatgacgtgt atatcaggcc cgccgagcag gagcggcatg 10200

gtctggtgct ggtggacgac ctcagcgagt ttgacctgga tgacatgaaa gccgagggcc 10260

gggagcctgc cctggtagtg gaaaccagcc cgaagaacta tcaggcatgg gtcaaggtgg 10320

ccgacgccgc aggcggtgaa cttcgggggc agattgcccg gacgctggcc agcgagtacg 10380

acgccgaccc ggccagcgcc gacagccgcc actatggccg cttggcgggc ttcaccaacc 10440

gcaaggacaa gcacaccacc cgcgccggtt atcagccgtg ggtgctgctg cgtgaatcca 10500

agggcaagac cgccaccgct ggcccggcgc tggtgcagca ggctggccag cagatcgagc 10560

aggcccagcg gcagcaggag aaggcccgca ggctggccag cctcgaactg cccgagcggc 10620

agcttagccg ccaccggcgc acggcgctgg acgagtaccg cagcgagatg gccgggctgg 10680

tcaagcgctt cggtcatgac ctcagcaagt gcgactttat cgccgcgcag aagctggcca 10740

gccggggccg cagtgccgag gaaatcggca aggccatggc cgaggccagc ccagcgctgg 10800

cagagcgcaa gcccggccac gaagcggatt acatcgagcg caccgtcagc aaggtcatgg 10860

gtctgcccag cgtccagctt gcgcgggccg agctggcacg ggcaccggca ccccgccagc 10920

gaggcatgga caggggcggg ccagatttca gcatgtagtg cttgcgttgg tactcacgcc 10980

tgttatacta tgagtactca cgcacagaag ggggttttat ggaatacgaa aaaagcgctt 11040

cagggtcggt ctacctgatc aaaagtgaca agggctattg gttgcccggt ggctttggtt 11100

atacgtcaaa caaggccgag gctggccgct tttcagtcgc tgatatggcc agccttaacc 11160

ttgacggctg caccttgtcc ttgttccgcg aagacaagcc tttcggcccc ggcaagtttc 11220

tcggtgactg atatgaaaga ccaaaaggac aagcagaccg gcgacctgct ggccagccct 11280

gacgctgtac gccaagcgcg atatgccgag cgcatgaagg ccaaagggat gcgtcagcgc 11340

aagttctggc tgaccgacga cgaatacgag gcgctgcgcg agtgcctgga agaactcaga 11400

gcggcgcagg gcgggggtag tgaccccgcc agcgcctaac caccaactgc ctgcaaagga 11460

ggcaatcaat ggctacccat aagcctatca atattctgga ggcgttcgca gcagcgccgc 11520

caccgctgga ctacgttttg cccaacatgg tggccggtac ggtcggggcg ctggtgtcgc 11580

ccggtggtgc cggtaaatcc atgctggccc tgcaactggc cgcacagatt gcaggcgggc 11640

cggatctgct ggaggtgggc gaactgccca ccggcccggt gatctacctg cccgccgaag 11700

acccgcccac cgccattcat caccgcctgc acgcccttgg ggcgcacctc agcgccgagg 11760

aacggcaagc cgtggctgac ggcctgctga tccagccgct gatcggcagc ctgcccaaca 11820

tcatggcccc ggagtggttc gacggcctca agcgcgccgc cgagggccgc cgcctgatgg 11880

tgctggacac gctgcgccgg ttccacatcg aggaagaaaa cgccagcggc cccatggccc 11940

aggtcatcgg tcgcatggag gccatcgccg ccgataccgg gtgctctatc gtgttcctgc 12000

accatgccag caagggcgcg gccatgatgg gcgcaggcga ccagcagcag gccagccggg 12060

gcagctcggt actggtcgat aacatccgct ggcagtccta cctgtcgagc atgaccagcg 12120

ccgaggccga ggaatggggt gtggacgacg accagcgccg gttcttcgtc cgcttcggtg 12180

tgagcaaggc caactatggc gcaccgttcg ctgatcggtg gttcaggcgg catgacggcg 12240

gggtgctcaa gcccgccgtg ctggagaggc agcgcaagag caagggggtg ccccgtggtg 12300

aagcctaaga acaagcacag cctcagccac gtccggcacg acccggcgca ctgtctggcc 12360

cccggcctgt tccgtgccct caagcggggc gagcgcaagc gcagcaagct ggacgtgacg 12420

tatgactacg gcgacggcaa gcggatcgag ttcagcggcc cggagccgct gggcgctgat 12480

gatctgcgca tcctgcaagg gctggtggcc atggctgggc ctaatggcct agtgcttggc 12540

ccggaaccca agaccgaagg cggacggcag ctccggctgt tcctggaacc caagtgggag 12600

gccgtcaccg ctgaatgcca tgtggtcaaa ggtagctatc gggcgctggc aaaggaaatc 12660

ggggcagagg tcgatagtgg tggggcgctc aagcacatac aggactgcat cgagcgcctt 12720

tggaaggtat ccatcatcgc ccagaatggc cgcaagcggc aggggtttcg gctgctgtcg 12780

gagtacgcca gcgacgaggc ggacgggcgc ctgtacgtgg ccctgaaccc cttgatcgcg 12840

caggccgtca tgggtggcgg ccagcatgtg cgcatcagca tggacgaggt gcgggcgctg 12900

gacagcgaaa ccgcccgcct gctgcaccag cggctgtgtg gctggatcga ccccggcaaa 12960

accggcaagg cttccataga taccttgtgc ggctatgtct ggccgtcaga ggccagtggt 13020

tcgaccatgc gcaagcgccg caagcgggtg cgcgaggcgt tgccggagct ggtcgcgctg 13080

ggctggacgg taaccgagtt cgcggcgggc aagtacgaca tcacccggcc caaggcggca 13140

ggctgacccc ccccactcta ttgtaaacaa gacattttta tcttttatat tcaatggctt 13200

attttcctgc taattggtaa taccatgaaa aataccatgc tcagaaaagg cttaacaata 13260

ttttgaaaaa ttgcctactg agcgctgccg cacagctcca taggccgctt tcctggcttt 13320

gcttccagat gtatgctctt ctgctcccga acgccagcaa gacgtagccc agcgcgtcgg 13380

ccagcttgca attcgcgcta acttacatta attgcgttgc gctcactgcc cgctttccag 13440

tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt 13500

ttgcgtattg ggcgccaggg tggtttttct tttcaccagt gagacgggca acagctgatt 13560

gcccttcacc gcctggccct gagagagttg cagcaagcgg tccacgtggt ttgccccagc 13620

aggcgaaaat cctgtttgat ggtggttaac ggcgggatat aacatgagct gtcttcggta 13680

tcgtcgtatc ccactaccga gatatccgca ccaacgcgca gcccggactc ggtaatggcg 13740

cgcattgcgc ccagcgccat ctgatcgttg gcaaccagca tcgcagtggg aacgatgccc 13800

tcattcagca tttgcatggt ttgttgaaaa ccggacatgg cactccagtc gccttcccgt 13860

tccgctatcg gctgaatttg attgcgagtg agatatttat gccagccagc cagacgcaga 13920

cgcgccgaga cagaacttaa tgggcccgct aacagcgcga tttgctggtg acccaatgcg 13980

accagatgct ccacgcccag tcgcgtaccg tcttcatggg agaaaataat actgttgatg 14040

ggtgtctggt cagagacatc aagaaataac gccggaacat tagtgcaggc agcttccaca 14100

gcaatggcat cctggtcatc cagcggatag ttaatgatca gcccactgac gcgttgcgcg 14160

agaagattgt gcaccgccgc tttacaggct tcgacgccgc ttcgttctac catcgacacc 14220

accacgctgg cacccagttg atcggcgcga gatttaatcg ccgcgacaat ttgcgacggc 14280

gcgtgcaggg ccagactgga ggtggcaacg ccaatcagca acgactgttt gcccgccagt 14340

tgttgtgcca cgcggttggg aatgtaattc agctccgcca tcgccgcttc cactttttcc 14400

cgcgttttcg cagaaacgtg gctggcctgg ttcaccacgc gggaaacggt ctgataagag 14460

acaccggcat actctgcgac atcgtataac gttactggtt tcacattcac caccctgaat 14520

tgactctctt ccgggcgcta tcatgccata ccgcgaaagg ttttgcacca ttcgatggtg 14580

tcaacgtaaa tgccgcttcg ccttcgcgcg cgaattgcaa gctgatccgg gcttatcgac 14640

tgcacggtgc accaatgctt ctggcgtcag gcagccatcg gaagctgtgg tatggctgtg 14700

caggtcgtaa atcactgcat aattcgtgtc gctcaaggcg cactcccgtt ctggataatg 14760

ttttttgcgc cgacatcata acggttctgg caaatattct gaaatgagct gttgacaatt 14820

aatcatcggc tcgtataatg tgtggaattg tgagcggata acaatttcac acaggaaaca 14880

gaattcgagc tcggtaccag gaggaaacga tgaatgcgcc agtaaatgga acacttatta 14940

ctacacagat tgcaaacgtt gctgaaactc ttggcttggt taatgttaat ccacaagagt 15000

taaaggaaac actgattcaa acagctttcc gtactgaaac acctgcaact gatgcacaaa 15060

tggcttctct tttgattgtt gctggtcaat acaagctgaa cccatggacc aaagagattt 15120

acgctttccc agataaaaac aaagggatta ttccagttgt tggcgtggat ggttggtctc 15180

gaatcattaa tggaaactct aatttcaatg gtatggaatt taagttttct gaaaatatgg 15240

ttcagatgga aggcgcgaaa gttgctgcac ctgaatgggt tgaatgcatt atctatcgta 15300

aagatcgtga ccaccctact gttgttcgcg agtatttagc agagtgttat cgtgcaccat 15360

ttaagtcaaa aactggatat gtagttgaag gaccatggca gagtcaccct tctcgcttct 15420

tgcgccacaa agcaactatt cagtgtgcac gcttagcctt tggttttgtg ggtattcatg 15480

atcaggatga agcagaacgt atcgctgaaa gtggacaagc tattaaggat gtgactagtg 15540

aagtgccaga aggctaccaa gcctttgaag atgagcattt gcctacactc aaatcagaag 15600

ctcaatacgg cactgaacgc ttgcaagctg cttatgtggc aattccaaag ggaaatctta 15660

aaaagcacct ttgggaagtt cactcaatta gcttaaaaaa aattgctcag tttgcagacc 15720

aagctttaca gcgccaagga gaaacatatg aacattctcc agcgtagtga agattggcat 15780

tcggaacgct gtgggaaagt cacagcaagc cgtgtaaagg atttaaatgc aaagctcaat 15840

aaaggaaaag ctttaaatgc attgggttta actattctag ctgagcgcct cactggcgtt 15900

cagaaggaaa tcttcactaa ccaagctatg caatggggta tcgataacga gcctcatgca 15960

atagcagctt atgaaaatga aacgggtaac tttgtagtag gtacaggttt aattgaccat 16020

cctttcattg aaatgttcgg ggcttcacca gatgggcttg tgggcgacaa tgggcaaata 16080

gaagttaagt gcccagatac tacaacacac ttgaacaccc tgctgaccaa gcaagtacca 16140

gatgagtaca ttcctcaaat aactagtcag ttggcttgta ctcgtcgtga atggtgtgac 16200

tttgtgagtt atgacccacg tctaccagaa ggattacaga tcatcattat tcgtgtctat 16260

gccaaagacc tagcaataga agcacttgag caagatgttc gtaagttcaa caaagctata 16320

gatgacgcaa ttaaaacatt gaaggtggca gcatgagtcg acctgcaggc atgca 16375

<210> 2

<211> 6110

<212> DNA

<213> Artificial Sequence

<400> 2

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180

accataggat tttaacattt tgcgttgttc caaaagttat caacagccta gaacgtcata 240

ggaagcgatt acagacactt tatagctatc agcatgggaa cataagggca ggatgaaata 300

tgggtcttaa aacgcaaatg gtgaggtttt agaggtattt tttgaagatg attaaggcgg 360

tttgttttta aaatttttgg cggctctcag gctgcttaca ttttaaccag ttcagtgaaa 420

agttcttttt cagcaaattt ctgtttagca ccatagctaa aacttgcgtg gaacatatta 480

agaattgacc gaaatgacac aatctcaatt atattttttt tgaaaagttt tctttatcaa 540

atattttaaa tcattgattt atatataagt atacattcat tttaataatt aatctttatt 600

taacaatgat ttatctatat tcaattgttt aattattctt actaatatta tctctatatc 660

aatatttttt atttaaaaac atatgtttag tagtgctttt gattaaagta ccagagggag 720

ggagcagagc tgaatgggaa atactcaccc tagagcgatt cttaaaaatc accctaaagt 780

attcccattc gatgtaccgt cggtcggtcg ctttcgcatc agggatgaca tcactgtatc 840

aagctgccac tgttatgatt acgattgata gcaccgcctg aacacgctca taaccgccaa 900

ttaaatgact actcattgcg tccgctactc tgttcagttc ccctagtaat agcgtttttc 960

cgatgtgtgc tagcgtcact gtacctcatc acccacacat ggacagattg agttacagac 1020

attggctaaa tttttggggt ctatgcttga caaagcgagt taaaacctta gaatttaaga 1080

caggtacatt aagcccctgt ggtgaaatca ttagcggtcg tcaaacctta atgctttcga 1140

ttgccgatat gtcagtatcg aagatctgta ccccataaat tacggtaaag ccccaagcaa 1200

ttgcaagggg cttttatctt ttttaacaaa aaaaatttat aaatcaggat tttataacac 1260

taaataatcc aaagtacatg agtaagtcat gaccactcct gcgatgtgtg tagcactctg 1320

agtatccgta ttatatcagt gatgtcatat acaaccacat aatgcggatg tatcactaac 1380

tccctagtat ctttctgtct gcctgtgcgc cccatcagtc gattatcaac aagtaaatct 1440

gtcttttctt caattaaatc atcaatttca atagctgcta tagggttgcg ttcttcaaga 1500

taatcataga tatttctacg atcttggcta tgcggtgtga aataccgcac agatgcgtaa 1560

ggagaaaata ccgcatcagg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1620

gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc 1680

gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg 1740

aattgacgcg tattgggatg gtaccgggcc ccccctcgag gtcgacggta tcgatacggc 1800

atcagagcag attgtactga gagtgcacca taatcggcat tttcttttgc gtttttattt 1860

gttaactgtt aattgtcctt gttcaaggat gctgtctttg acaacagatg ttttcttgcc 1920

tttgatgttc agcaggaagc taggcgcaaa cgttgattgt ttgtctgcgt agaatcctct 1980

gtttgtcata tagcttgtaa tcacgacatt gtttcctttc gcttgaggta cagcgaagtg 2040

tgagtaagta aaggttacat cgttaggatc aagatccatt tttaacacaa ggccagtttt 2100

gttcagcggc ttgtatgggc cagttaaaga attagaaaca taaccaagca tgtaaatatc 2160

gttagacgta atgccgtcaa tcgtcatttt tgatccgcgg gagtcagtga acagatacca 2220

tttgccgttc attttaaaga cgttcgcgcg ttcaatttca tctgttactg tgttagatgc 2280

aatcagcggt ttcatcactt ttttcagtgt gtaatcatcg tttagctcaa tcataccgag 2340

agcgccgttt gctaactcag ccgtgcgttt tttatcgctt tgcagaagtt tttgactttc 2400

ttgacggaag aatgatgtgc ttttgccata gtatgctttg ttaaataaag attcttcgcc 2460

ttggtagcca tcttcagttc cagtgtttgc ttcaaatact aagtatttgt ggcctttatc 2520

ttctacgtag tgaggatctc tcagcgtatg gttgtcgcct gagctgtagt tgccttcatc 2580

gatgaactgc tgtacatttt gatacgtttt tccgtcaccg tcaaagattg atttataatc 2640

ctctacaccg ttgatgttca aagagctgtc tgatgctgat acgttaactt gtgcagttgt 2700

cagtgtttgt ttgccgtaat gtttaccgga gaaatcagtg tagaataaac ggatttttcc 2760

gtcagatgta aatgtggctg aacctgacca ttcttgtgtt tggtctttta ggatagaatc 2820

atttgcatcg aatttgtcgc tgtctttaaa gacgcggcca gcgtttttcc agctgtcaat 2880

agaagtttcg ccgacttttt gatagaacat gtaaatcgat gtgtcatccg catttttagg 2940

atctccggct aatgcaaaga cgatgtggta gccgtgatag tttgcgacag tgccgtcagc 3000

gttttgtaat ggccagctgt cccaaacgtc caggcctttt gcagaagaga tatttttaat 3060

tgtggacgaa tcgaactcag gaacttgata tttttcattt ttttgctgtt cagggatttg 3120

cagcatatca tggcgtgtaa tatgggaaat gccgtatgtt tccttatatg gcttttggtt 3180

cgtttctttc gcaaacgctt gagttgcgcc tcctgccagc agtgcggtag taaaggttaa 3240

tactgttgct tgttttgcaa actttttgat gttcatcgtt catgtctcct tttttatgta 3300

ctgtgttagc ggtctgcttc ttccagccct cctgtttgaa gatggcaagt tagttacgca 3360

caataaaaaa agacctaaaa tatgtaaggg gtgacgccaa agtatacact ttgcccttta 3420

cacattttag gtcttgcctg ctttatcagt aacaaacccg cgcgatttac ttttcgacct 3480

cattctatta gactctcgtt tggattgcaa ctggtctatt ttcctctttt gtttgataga 3540

aaatcataaa aggatttgca gactacgggc ctaaagaact aaaaaatcta tctgtttctt 3600

ttcattctct gtatttttta tagtttctgt tgcatgggca taaagttgca agcttgacag 3660

ctagctcagt cctaggtata atactagtaa tttctactgt tgtagatcga gaccattggt 3720

ctcaggccgg catggtccca gcctcctcgc tggcgccggc tgggcaacat gcttcggcat 3780

ggcgaatggg acccaattat tgaacaccct aacgggtgtt tttttgtttc tggtctaccg 3840

aattcctgca gcccggggga tccactagtt ctagagcggc cgccaccgcg gtggagctca 3900

tcccaatggc gcgccgagct tggctcgagc atggtcatag ctgtttcctg tgtgaaattg 3960

ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 4020

tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 4080

gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 4140

gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 4200

gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 4260

taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 4320

cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 4380

ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 4440

aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 4500

tctcccttcg ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt 4560

gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg 4620

cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 4680

ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 4740

cttgaagtgg tggcctaact acggctacac tagaagaaca gtatttggta tctgcgctct 4800

gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 4860

cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 4920

tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 4980

ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta 5040

aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttagaa 5100

aaactcatcg agcatcaaat gaaactgcaa tttattcata tcaggattat caataccata 5160

tttttgaaaa agccgtttct gtaatgaagg agaaaactca ccgaggcagt tccataggat 5220

ggcaagatcc tggtatcggt ctgcgattcc gactcgtcca acatcaatac aacctattaa 5280

tttcccctcg tcaaaaataa ggttatcaag tgagaaatca ccatgagtga cgactgaatc 5340

cggtgagaat ggcaaaagtt tatgcatttc tttccagact tgttcaacag gccagccatt 5400

acgctcgtca tcaaaatcac tcgcatcaac caaaccgtta ttcattcgtg attgcgcctg 5460

agcgagacga aatacgcgat cgctgttaaa aggacaatta caaacaggaa tcgaatgcaa 5520

ccggcgcagg aacactgcca gcgcatcaac aatattttca cctgaatcag gatattcttc 5580

taatacctgg aatgctgttt tcccagggat cgcagtggtg agtaaccatg catcatcagg 5640

agtacggata aaatgcttga tggtcggaag aggcataaat tccgtcagcc agtttagtct 5700

gaccatctca tctgtaacat cattggcaac gctacctttg ccatgtttca gaaacaactc 5760

tggcgcatcg ggcttcccat acaatcgata gattgtcgca cctgattgcc cgacattatc 5820

gcgagcccat ttatacccat ataaatcagc atccatgttg gaatttaatc gcggcctaga 5880

gcaagacgtt tcccgttgaa tatggctcat actcttcctt tttcaatatt attgaagcat 5940

ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 6000

aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat 6060

tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 6110

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 3

ggttcatgtg cagctccatc a 21

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 4

ggatccaggg ttattgtctc atg 23

<210> 5

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 5

gagacaataa ccctggatcc gcaactttat gcccatgcaa c 41

<210> 6

<211> 43

<212> DNA

<213> Artificial Sequence

<400> 6

gatggagctg cacatgaacc gtatccgtga attgacgcgt att 43

<210> 7

<211> 4179

<212> DNA

<213> Artificial Sequence

<400> 7

gggcttatcg actgcacggt gcaccaatgc ttctggcgtc aggcagccat cggaagctgt 60

ggtatggctg tgcaggtcgt aaatcactgc ataattcgtg tcgctcaagg cgcactcccg 120

ttctggataa tgttttttgc gccgacatca taacggttct ggcaaatatt ctgaaatgag 180

ctgttgacaa ttaatcatcg gctcgtataa tgtgtggaat tgtgagcgga taacaatttc 240

acacaggaaa cagaattcat gtccatctac caagagtttg tgaataaata ctccctgtcc 300

aagaccctcc gttttgagct gatcccccaa ggcaagaccc tcgaaaacat caaggcacgc 360

ggcctcatcc tggatgacga aaagcgcgct aaggattaca agaaggcaaa gcagatcatc 420

gacaagtacc accagttctt catcgaagag atcctgtcct ccgtgtgcat ctccgaggac 480

ctgctccaga actactccga tgtctacttc aagctcaaga agtccgatga cgataacctg 540

cagaaggact tcaagtccgc taaggatacc atcaagaagc agatctccga atacatcaag 600

gattccgaga agttcaagaa cctcttcaac cagaacctga tcgacgcaaa gaagggccag 660

gaatccgatc tcatcctgtg gctcaagcag tccaaggata acggcatcga gctcttcaag 720

gccaactccg acatcaccga catcgatgaa gctctggaga tcatcaagtc cttcaagggc 780

tggaccacct acttcaaggg cttccacgaa aaccgcaaga acgtgtactc ctccaacgat 840

atcccaacct ctatcatcta ccgcatcgtc gacgataacc tgccaaagtt cctcgaaaac 900

aaggcaaagt acgagtccct gaaggataag gccccagaag ctatcaacta cgagcagatc 960

aagaaggacc tggccgaaga gctcaccttc gacatcgatt acaagacctc tgaagtgaac 1020

cagcgcgtct tctccctcga tgaagtgttc gagatcgcca acttcaacaa ctacctgaac 1080

cagtccggca tcaccaagtt caacaccatc atcggcggca agttcgtcaa cggcgaaaac 1140

accaagcgca agggcatcaa cgagtacatc aacctctact cccagcagat caacgataag 1200

accctgaaga agtacaagat gtccgtgctc ttcaagcaga tcctgtccga caccgaatcc 1260

aagtccttcg tcatcgacaa gctggaggac gattccgatg tggtcaccac catgcagtcc 1320

ttctacgaac agatcgcagc cttcaagacc gtggaagaga agtccatcaa ggagaccctc 1380

tccctgctct tcgacgatct gaaggctcag aagctggatc tctccaagat ctacttcaag 1440

aacgacaagt ccctgaccga tctctcccag caggtcttcg acgattactc cgtgatcggc 1500

accgcagtcc tggaatacat cacccagcag atcgccccaa agaacctcga taacccatcc 1560

aagaaggaac aggagctgat cgccaagaag accgaaaagg ctaagtacct gtccctcgag 1620

accatcaagc tggctctcga agagttcaac aagcaccgcg acatcgataa gcagtgccgc 1680

ttcgaagaga tcctcgcaaa cttcgctgca atcccaatga tcttcgacga aatcgcacag 1740

aacaaggata acctggccca gatctccatc aagtaccaga accagggcaa gaaggatctg 1800

ctccaggcct ccgctgagga cgatgtgaag gcaatcaagg acctgctcga tcagaccaac 1860

aacctgctcc acaagctgaa gatcttccac atctcccagt ccgaagacaa ggccaacatc 1920

ctcgacaagg atgagcactt ctacctggtg ttcgaagagt gctacttcga actcgctaac 1980

atcgtcccac tgtacaacaa gatccgcaac tacatcaccc agaagccata ctccgatgaa 2040

aagttcaagc tcaacttcga gaactccacc ctggcaaacg gctgggacaa gaacaaggaa 2100

ccagataaca ccgccatcct cttcatcaag gacgataagt actacctggg cgtgatgaac 2160

aagaagaaca acaagatctt cgacgataag gccatcaagg aaaacaaggg cgagggctac 2220

aagaagatcg tgtacaagct gctcccaggc gctaacaaga tgctcccaaa ggtcttcttc 2280

tccgcaaagt ccatcaagtt ctacaaccca tccgaagata tcctgcgcat ccgcaaccac 2340

tccacccaca ccaagaacgg ctccccacag aagggctacg aaaagttcga gttcaacatc 2400

gaagactgcc gcaagttcat cgatttctac aagcagtcca tctccaagca cccagagtgg 2460

aaggacttcg gcttccgctt ctccgatacc cagcgctaca actccatcga tgaattctac 2520

cgcgaagtgg agaaccaggg ctacaagctg accttcgaaa acatctccga gtcctacatc 2580

gattccgtgg tcaaccaggg caagctgtac ctcttccaga tctacaacaa ggacttctcc 2640

gcttactcca agggccgccc aaacctgcac accctctact ggaaggcact cttcgacgaa 2700

cgcaacctgc aggatgtggt ctacaagctc aacggcgaag cagagctgtt ctaccgcaag 2760

cagtccatcc caaagaagat cacccaccca gccaaggaag caatcgccaa caagaacaag 2820

gataacccaa agaaggaatc cgtgttcgag tacgacctga tcaaggataa gcgcttcacc 2880

gaggacaagt tcttcttcca ctgcccaatc accatcaact tcaagtcctc cggcgccaac 2940

aagttcaacg atgaaatcaa cctgctcctg aaggagaagg ctaacgacgt gcacatcctg 3000

tccatcgatc gcggcgaacg ccacctcgcc tactacaccc tggtcgacgg caagggcaac 3060

atcatcaagc aggacacctt caacatcatc ggcaacgatc gcatgaagac caactaccac 3120

gacaagctgg ccgctatcga gaaggaccgc gattccgctc gcaaggattg gaagaagatc 3180

aacaacatca aggaaatgaa ggaaggctac ctctcccagg tggtccacga aatcgctaag 3240

ctggtgatcg agtacaacgc aatcgtggtc ttcgaagacc tgaacttcgg cttcaagcgc 3300

ggccgcttca aggtggagaa gcaggtctac cagaagctgg aaaagatgct catcgagaag 3360

ctgaactacc tcgtgttcaa ggacaacgaa ttcgataaga ccggcggcgt cctccgtgca 3420

taccagctga ccgccccatt cgagaccttc aagaagatgg gcaagcagac cggcatcatc 3480

tactacgtgc cagctggctt cacctctaag atctgcccag tgaccggctt cgtcaaccag 3540

ctctacccaa agtacgaatc cgtctccaag tcccaggagt tcttctccaa gttcgacaag 3600

atctgctaca acctggataa gggctacttc gaattctcct tcgactacaa gaacttcggc 3660

gataaggcag ccaagggcaa gtggaccatc gcatccttcg gctcccgcct catcaacttc 3720

cgcaactccg acaagaacca caactgggat acccgcgaag tgtacccaac caaggaactg 3780

gagaagctcc tgaaggatta ctccatcgaa tacggccacg gcgagtgcat caaggctgca 3840

atctgcggcg aatccgacaa gaagttcttc gcaaagctga cctctgtgct caacaccatc 3900

ctgcagatgc gcaactccaa gaccggcacc gagctggatt acctcatctc cccagtggcc 3960

gacgtcaacg gcaacttctt cgattcccgc caggctccaa agaacatgcc acaggacgct 4020

gatgcaaacg gcgcctacca catcggtctg aagggtctca tgctcctggg tcgcatcaag 4080

aacaaccagg aaggcaagaa gctgaatctc gtcattaaga acgaagaata ctttgaattt 4140

gtccagaacc gcaataacta agtcgacctg caggcatgc 4179

<210> 8

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 8

gagacaataa ccctggatcc gggcttatcg actgcacg 38

<210> 9

<211> 32

<212> DNA

<213> Artificial Sequence

<400> 9

tgggcataaa gttgcgcatg cctgcaggtc ga 32

<210> 10

<211> 186

<212> DNA

<213> Artificial Sequence

<400> 10

ttgacagcta gctcagtcct aggtataata ctagtaattt ctactgttgt agatcgagac 60

cattggtctc aggccggcat ggtcccagcc tcctcgctgg cgccggctgg gcaacatgct 120

tcggcatggc gaatgggacc caattattga acaccctaac gggtgttttt ttgtttctgg 180

tctacc 186

<210> 11

<211> 37

<212> DNA

<213> Artificial Sequence

<400> 11

ataaagttgc aagcttgaca gctagctcag tcctagg 37

<210> 12

<211> 41

<212> DNA

<213> Artificial Sequence

<400> 12

cgggctgcag gaattcggta gaccagaaac aaaaaaacac c 41

<210> 13

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 13

caggaaacag ctatgacc 18

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 14

agatcattta catgaagctc aaagt 25

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 15

ggccactttg agcttcatgt aaatg 25

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 16

agatcatgaa gctcaaagtg agaag 25

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 17

ggcccttctc actttgagct tcatg 25

<210> 18

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 18

agattccttg ccctaccttt tgaca 25

<210> 19

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 19

ggcctgtcaa aaggtagggc aagga 25

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 20

agatccctac cttttgacac aagaa 25

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 21

ggccttcttg tgtcaaaagg taggg 25

<210> 22

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 22

agatgacaca agaagtttaa aagta 25

<210> 23

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 23

ggcctacttt taaacttctt gtgtc 25

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 24

agataaagtg agaagattgt agagc 25

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 25

ggccgctcta caatcttctc acttt 25

<210> 26

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 26

agatgaacat ggtaatttgg acatg 25

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 27

ggcccatgtc caaattacca tgttc 25

<210> 28

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 28

agatgcccta ccttttgaca caaga 25

<210> 29

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 29

ggcctcttgt gtcaaaaggt agggc 25

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 30

agatcatggt aatttggaca tgatt 25

<210> 31

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 31

ggccaatcat gtccaaatta ccatg 25

<210> 32

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 32

agatcaatga tggtgatctt tttag 25

<210> 33

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 33

ggccctaaaa agatcaccat cattg 25

<210> 34

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 34

agatccggaa tgaaatattg gccaa 25

<210> 35

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 35

ggccttggcc aatatttcat tccgg 25

<210> 36

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 36

agatccggta ttacctttgc cggaa 25

<210> 37

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 37

ggccttccgg caaaggtaat accgg 25

<210> 38

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 38

agataaatca tcaaacatac agttc 25

<210> 39

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 39

ggccgaactg tatgtttgat gattt 25

<210> 40

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 40

agatagtaat taccggtatt acctt 25

<210> 41

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 41

ggccaaggta ataccggtaa ttact 25

<210> 42

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 42

agatcttaaa atcatcaaac ataca 25

<210> 43

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 43

ggcctgtatg tttgatgatt ttaag 25

<210> 44

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 44

agattgccgg aatgaaatat tggcc 25

<210> 45

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 45

ggccggccaa tatttcattc cggca 25

<210> 46

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 46

agatcgttcc agctaccttc agatg 25

<210> 47

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 47

ggcccatctg aaggtagctg gaacg 25

<210> 48

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 48

agatcataca gttccaatga tggtg 25

<210> 49

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 49

ggcccaccat cattggaact gtatg 25

<210> 50

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 50

agatgaacat ggtaatttg 19

<210> 51

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 51

ggcccaaatt accatgttc 19

<210> 52

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 52

agatgaacat ggtaatttgg a 21

<210> 53

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 53

ggcctccaaa ttaccatgtt c 21

<210> 54

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 54

agatgaacat ggtaatttgg aca 23

<210> 55

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 55

ggcctgtcca aattaccatg ttc 23

<210> 56

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 56

agatgaacat ggtaatttgg acat 24

<210> 57

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 57

ggccatgtcc aaattaccat gttc 24

<210> 58

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 58

agatgaacat ggtaatttgg acatga 26

<210> 59

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 59

ggcctcatgt ccaaattacc atgttc 26

<210> 60

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 60

agatgaacat ggtaatttgg acatgat 27

<210> 61

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 61

ggccatcatg tccaaattac catgttc 27

<210> 62

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 62

agatgaacat ggtaatttgg acatgattg 29

<210> 63

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 63

ggcccaatca tgtccaaatt accatgttc 29

<210> 64

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 64

agatgaacat ggtaatttgg acatgattgt cctt 34

<210> 65

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 65

ggccaaggac aatcatgtcc aaattaccat gttc 34

<210> 66

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 66

agattacaat ccgctttag 19

<210> 67

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 67

ggccctaaag cggattgta 19

<210> 68

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 68

agattacaat ccgctttaga a 21

<210> 69

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 69

ggccttctaa agcggattgt a 21

<210> 70

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 70

agattacaat ccgctttaga act 23

<210> 71

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 71

ggccagttct aaagcggatt gta 23

<210> 72

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 72

agattacaat ccgctttaga actt 24

<210> 73

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 73

ggccaagttc taaagcggat tgta 24

<210> 74

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 74

agattacaat ccgctttaga acttc 25

<210> 75

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 75

ggccgaagtt ctaaagcgga ttgta 25

<210> 76

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 76

agattacaat ccgctttaga acttcg 26

<210> 77

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 77

ggcccgaagt tctaaagcgg attgta 26

<210> 78

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 78

agattacaat ccgctttaga acttcgt 27

<210> 79

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 79

ggccacgaag ttctaaagcg gattgta 27

<210> 80

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 80

agattacaat ccgctttaga acttcgtga 29

<210> 81

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 81

ggcctcacga agttctaaag cggattgta 29

<210> 82

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 82

agattacaat ccgctttaga acttcgtgaa caac 34

<210> 83

<211> 34

<212> DNA

<213> Artificial Sequence

<400> 83

ggccgttgtt cacgaagttc taaagcggat tgta 34

<210> 84

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 84

agacggggca aaccaatga 19

<210> 85

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 85

agatagacgg ggcaaaccaa tga 23

<210> 86

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 86

ggcctcattg gtttgccccg tct 23

<210> 87

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 87

attcttgtac caattgacgg ttctgaaact tctatggttg 40

<210> 88

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 88

ggacttagtg tagaaaccaa attacttgaa ggttttgttg 40

<210> 89

<211> 80

<212> DNA

<213> Artificial Sequence

<400> 89

attcttgtac caattgacgg ttctgaaact tctatggttg ggacttagtg tagaaaccaa 60

attacttgaa ggttttgttg 80

<210> 90

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 90

attgttggtg gcgtacctg 19

<210> 91

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 91

taattgcctg ccttgctgt 19

Claims

1. A pFnCpfAb/pCrAb dual plasmid system comprising the sequence of SEQ ID NO: 1 and the plasmid having the sequence of SEQ ID NO: 2, the pFnCpfAb-apr plasmid is capable of expressing FnCpf1 nuclease and RecAb recombinase, and the pCrAb-km plasmid is capable of expressing crRNA.

2. The pFnCpfAb/pCrAb two plasmid system of claim 1, wherein the pFnCpfAb-apr plasmid comprises a FnCpf1 gene fragment, a RecAb recombinase expression gene, a lacI galactose-inducible promoter repressor protein, and a gram-negative bacterially-tube host replicon RSF 1010; the pCrAb-km plasmid contains a crRNA gene fragment, a ribozyme HDV with self-cleavage activity, a site BsaI _ spacer for subsequent insertion of a target sequence, an Escherichia coli plasmid replicon rep and an Acinetobacter baumannii plasmid replicon WH1266\ origin.

3. The pFnCpfAb/pCrAb dual plasmid system of claim 1, wherein the pFnCpfAb-apr plasmid and the pCrAb-km plasmid each comprise the sucrose sensitive selection marker gene sacB.

4. Use of the pFNPfAb/pCrAb two-plasmid system of any of claims 1 to 3 for genome editing in A.baumannii.

5. Use according to claim 4, comprising use in the preparation of a genome editing tool and/or a genome editing kit.

6. The use according to claim 4, wherein the genome editing comprises knocking out the uspA gene.

7. The use according to claim 4, wherein the sequence of the genome-edited PAM site is a TTN sequence and/or a CTV sequence, wherein N in the TTN sequence is any base, V in the CTV sequence is any base except base T, and the length of the genome-edited target sequence is 19-25 nt.

8. A cell comprising either or both of the pFnCpfAb/pCrAb biplasmid systems of any one of claims 1 to 3.

9. A strain comprising either or both plasmids of the pFNPcfAb/pCrAb two-plasmid system of any of claims 1 to 3.

10. The strain of claim 9, wherein the strain is escherichia coli TOP10 strain, wherein escherichia coli TOP10 strain comprises pFnCpfAb-apr plasmid and pCrAb-km plasmid, with a deposit number of: CCTCC M2021056.