CN113373128A - Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof - Google Patents
Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof Download PDFInfo
- Publication number
- CN113373128A CN113373128A CN202110535876.6A CN202110535876A CN113373128A CN 113373128 A CN113373128 A CN 113373128A CN 202110535876 A CN202110535876 A CN 202110535876A CN 113373128 A CN113373128 A CN 113373128A
- Authority
- CN
- China
- Prior art keywords
- epoxide hydrolase
- hydrolase mutant
- mutant
- culture
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y303/00—Hydrolases acting on ether bonds (3.3)
- C12Y303/02—Ether hydrolases (3.3.2)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses an epoxide hydrolase mutant with improved catalytic efficiency and a preparation method thereof, wherein the epoxide hydrolase mutant is obtained by carrying out single-point mutation on 104 th, 179 th and 232 th amino acid sequences of an amino acid sequence shown as SEQ ID NO. 2. The preparation method comprises the following steps: cloning a gene for coding epoxide hydrolase into a plasmid pET-28a (+), and constructing a recombinant plasmid pET-28a (+) -EHJ; obtaining epoxide hydrolase mutant by using site-directed mutagenesis technology; transforming the recombinant plasmid containing the gene encoding the correct mutant into escherichia coli competence, selecting positive clone and extracting plasmid; e.coli was transformed and expression was induced. Compared with wild epoxide hydrolase, the epoxide hydrolase mutant can improve the thermal stability and the enzymatic activity of the epoxide hydrolase, and can prolong the service life of the epoxide hydrolase in industrial production.
Description
Technical Field
The invention relates to the technical field of enzyme engineering, in particular to an epoxide hydrolase mutant with improved catalytic efficiency and a preparation method thereof.
Background
Epoxide hydrolase (Epoxide hydrolase, EH, EC,3.3.2.-), also known as Epoxide hydratase or epoxy hydratase, is a hydrolase that catalyzes stereoselectively hydrolyzing an addition Epoxide of a water molecule into the corresponding 12-diol, has wide sources, is discovered by Brooks et al more than 40 years ago, and then is found in all types of organisms such as bacteria, yeast, molds, plants, insects, mammals and the like, and researches show that the Epoxide hydrolase participates in catalyzing the hydrolysis of the Epoxide into the chiral Epoxide and the corresponding vicinal diol without coenzyme. By analyzing the sequence information of epoxide hydrolases derived from microorganisms, it is found that most of them belong to the alpha/beta sheet hydrolase family, and the high enantioselectivity of this type of enzymes makes them of great significance for the preparation of various chiral drugs and fine chemicals.
At present, two methods for producing epoxide hydrolase are mainly used, wherein the chemical method has the defects of high cost, more byproducts, large environmental pressure and the like. Although the activity of microorganism EH asymmetric epoxide resolution is improved by the gene cloning expression technology, the effect of the technology on improving the enantioselectivity is not obvious, and the problems of slow reaction speed and low sensitivity are caused in the research and development of production, so that the production period is prolonged, and money and manpower are consumed.
In a word, the epoxide hydrolase group provided by the prior invention has a general effect and low sensitivity, the half-life period at 65 ℃ is shortened compared with that of a wild type, the catalytic efficiency is greatly reduced along with the improvement of thermal stability, the reduction of the catalytic efficiency of the enzyme in industrial production can not normally produce qualified products, the production period can be greatly prolonged for the research and development of production, and considerable loss is caused to manpower and money invisibly. In addition, compared with the methods such as blind-mesh bacteria or artificial (natural) mutagenesis and the like, the existing improvement technology shortens the time for modifying the enzymatic properties, but is stable and reduced in the range of acidic pH environment and medium-low temperature environment. When the environment changes, the quality of the produced product cannot be guaranteed, and the problems of low yield, low qualification rate and the like can be caused.
Disclosure of Invention
In order to solve the problems in the prior art, the invention aims to provide the epoxide hydrolase mutant which has high catalytic efficiency, good thermal stability and strong enzyme activity.
In order to achieve the purpose, the technical scheme of the invention is as follows:
in a first aspect, the present invention provides an epoxide hydrolase mutant obtained by single point mutation of the amino acid sequences at positions 104, 179 and 232 of the amino acid sequence shown in SEQ ID NO. 2.
Further, the epoxide hydrolase mutant is one of the following:
the threonine at the 104 th site of the amino acid sequence shown in SEQ ID NO.2 is mutated into lysine;
isoleucine at the 179 th site of the amino acid sequence shown in SEQ ID NO.2 is mutated into leucine;
mutating aspartic acid at position 232 of the amino acid sequence shown in SEQ ID NO.2 into serine;
the invention also provides a gene for coding the epoxide hydrolase mutant, and the base sequence of the mutant gene is mutated on the basis of SEQ ID NO. 1.
The invention also provides a recombinant vector carrying the epoxide hydrolase mutant gene.
In a second aspect, the present invention also provides a method for preparing an epoxide hydrolase mutant, comprising the following steps:
s1, connecting the sequence shown in SEQ ID NO.1 with pET-28a (+) plasmid to form a recombinant expression vector pET-28a (+) -EHJ;
s2, constructing an epoxide hydrolase mutant recombinant expression vector by using the specific site-directed mutagenesis primer by taking the recombinant vector pET-28a (+) -EHJ as a template;
s3, carrying out heat shock transformation on the recombinant vector pET-28a (+) -EHJ and the mutant vector to obtain competence, coating the competence in a resistant LB solid culture medium, and carrying out colony PCR verification after overnight culture;
and S4, extracting plasmids from the verified positive clones, transforming E.coli BL21(DE3), then screening out the positive clones again, inoculating the positive clones into an LB culture medium containing kanamycin sulfate, carrying out shaking culture at 37 ℃ overnight, inoculating the positive clones into a 500ml triangular flask containing 100ml of LB culture medium according to the inoculation amount of 2% (v/v), placing the flask into a shaking culture at 37 ℃ and 200rpm, and adding IPTG (isopropyl thiogalactoside) as an inducer to carry out induction expression when the OD600 of the culture solution reaches a proper value.
Further, in step S2, the specific site-directed mutagenesis primer is:
Thr104-F：GTAGAGCTTCTCAAGGATGGTTGGGAAC；
Thr104-R：GTTCCCAACCATCCTTGAGAAGCTCTAC；
Lle179-F：GTGCAGCGACTTTATCGGGCATTGCTCCGT；
Lle179-R：ACGGAGCAATGCCCGATAAAGTCGCTGCAC；
Asp232-F：CGACTTTCTGGTTTCAAGTATAAGCGAA；
Asp232-R：TTCGCTTATACTTGAAACCAGAAAGTCG。
further, the competent cells in step S3 are E.coli DH5 alpha competent cells, and the resistant LB solid medium is a LB solid medium containing kanamycin resistance.
Further, the concentration of kanamycin sulfate in the kanamycin sulfate-containing LB medium of step S4 was 50 mg/L.
Further, the OD600 of the culture solution in the step S4 is preferably 0.6 to 0.8.
Further, the concentration of the IPTG inducer is 0.5mM, and the induction condition is 28 ℃ for 10 h. The epoxide hydrolase mutant gene is connected with a pET-28a (+) vector, and E.coli BL21(DE3) is transformed for IPTG induction expression.
Compared with the prior art, the invention has the beneficial effects that:
the epoxide hydrolase mutant is obtained by carrying out single-point mutation on the gene segments of the epoxide hydrolase, and compared with the wild type epoxide hydrolase, the thermal stability and the enzyme activity of the mutant are greatly enhanced, so that the service life of the epoxide hydrolase in industrial production can be prolonged.
Drawings
The invention is further illustrated by means of the attached drawings, but the embodiments in the drawings do not constitute any limitation to the invention, and for a person skilled in the art, other drawings can be obtained on the basis of the following drawings without inventive effort.
FIG. 1 is a recombinant plasmid map of recombinant vector pET-28a (+) -EHJ of an epoxide hydrolase mutant of the present invention;
FIG. 2 is a SDS-PAGE pattern of an epoxide hydrolase mutant of the present invention;
FIG. 3 is a graph showing the changes in stability and enzymatic activity of an epoxide hydrolase mutant according to the present invention.
Detailed Description
The following further describes embodiments of the present invention with reference to the drawings. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.
Example 1
Construction of epoxide hydrolase mutants
Amplifying the nucleotide sequence SEQ ID NO.1 added with the enzyme cutting sites of BamH I and Xho I, carrying out double enzyme cutting with plasmid pET28a (+) by restriction enzymes BamH I and Xho I overnight, carrying out agarose gel electrophoresis purification on the next day, recovering a target fragment by using an agarose recovery kit, connecting the DNA fragment EHJ and pET28a plasmid fragment by using T4 DNA ligase at 16 ℃ overnight to obtain a recombinant expression vector pET-28a (+) -EHJ (as shown in figure 1), carrying out hot shock on the constructed recombinant expression vector pET-28a (+) -EHJ to transform escherichia coli DH5 alpha competence, coating the competent LB solid culture medium containing kanamycin resistance LB, carrying out colony PCR verification after overnight culture, and obtaining the positive clone which is epoxide hydrolase primase.
Specific site-directed mutagenesis primers were designed and synthesized as shown in table 1:
TABLE 1 primer sequences for site-directed mutagenesis
Site-directed mutagenesis was performed using the above-mentioned site-directed mutagenesis primer using plasmid pET-28a (+) -EHJ as a template (refer to current protocols in protein science 2011, 26.6.1-26.6.10; Anal, biochem.2008,375: 376-: 10 Xpyrobest buffer 5ul, dNTP 4ul, template 0.5ul, mutation primer 0.5ul, pyrobest DNA polymerase 0.5ul, supplement sterile water to 50ul, use Dpn I enzyme digestion to remove template plasmid after PCR, enzyme digestion product DH5 alpha transform Escherichia coli DH5 alpha competence, spread in LB solid culture medium containing kanamycin resistance, carry on colony PCR verification after overnight culture, the positive clone is epoxide hydrolase mutant.
Example 2
Inducible expression of epoxide hydrolase Proenzymes and mutant strains
The positive clones of example 1 were picked and inoculated into liquid LB medium, plasmids were extracted, E.coli BL21(DE3) competent cells were transformed, LB solid medium containing kanamycin resistance was spread, positive clones were picked up by overnight culture, inoculated into LB medium with a final kanamycin sulfate concentration of 50mg/L, cultured overnight with shaking at 37 ℃ and then inoculated into a 500ml Erlenmeyer flask containing 100ml of LB medium at an inoculum size of 2% (v/v), cultured with shaking at 37 ℃ and 200rpm, when OD600 of the culture reached 0.6-0.8, IPTG at a final concentration of 0.5mM was added as an inducer, and cells were induced at 28 ℃ for 10 hours and collected by centrifugation.
Example 3
Purification of epoxide hydrolase Proenzymes and mutants
The Ni-NTA is used for purifying the target protein, and the specific purification method comprises the following steps:
putting the thalli in the embodiment 2 in an ice bath, ultrasonically breaking cells for 30min, centrifuging, collecting supernate, and performing membrane filtration for later use;
after the line had been purged, the Ni-NTA column was washed with 10 column volumes of equilibration buffer (20mM Na2HPO4-NaH2PO4,500mM NaCl, 20mM imidazole, pH 8.0);
the crude enzyme solution was applied at a flow rate of 1.5ml/min, and then eluted with 20 column volumes of an equilibration buffer to remove unadsorbed enzyme proteins, and then eluted with an elution buffer (20mM Na2HPO4-NaH2PO4,500mM NaCl, 500mM imidazole, pH 8.0);
collecting target protein, and dialyzing enzyme solution in phosphate buffer (20mM Na2HPO4-NaH2PO4, pH8.0) for 48h in ice bath;
the protein samples collected were examined by SDS-PAGE and shown in FIG. 2, lanes 1-4 are the epoxide hydrolase primase, Thr104 mutant, IIe179 mutant and Asp232 mutant, respectively.
Example 4
Thermostability assay for epoxide hydrolase primases and mutants
Temperature is an important index affecting enzyme stability, wherein the half-life period can reflect the thermal stability of the enzyme, and the specific steps are as follows:
preparing a reaction system 1: 100ul enzyme solution and 900ul phosphate buffer solution (200mM, pH8.0) form a plurality of groups of 1ml reaction systems; preparing a reaction system 2: 100ul of enzyme solution and 900ul of a mixture of phosphate buffer solutions (200mM, pH8.0) containing the corresponding amount of alcohols (methanol, ethanol, v/v) were combined to prepare several groups of 1ml reaction systems.
Keeping the temperature of each group at 50 ℃ for different times, adding 100mM rac-ECH with final concentration, oscillating at 180rpm for 5min, sampling 200ul, extracting in 800ul ethyl acetate, drying the upper organic phase anhydrous sodium sulfate, and performing gas phase detection.
The inactivation of the enzyme follows the equation: ln (E/E0) ═ Kd × t, where E is enzyme activity at time t, E0 is enzyme activity at initial time, and Kd is inactivation rate constant.
The initial enzyme activity was used as a standard, and the relative enzyme activities at different times, RA ═ E ]/[ E0], were calculated, and the results are shown in fig. 3.
It can be seen that the half-lives of the single mutants Thr104, Lle179 and Asp232 are greatly improved compared with the original enzyme, and Thr104 > Lle179 > Asp232 > the original enzyme.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and the scope of protection is still within the scope of the invention.
<110> Shenzhen City droplet science and technology consultant, Inc
<120> epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof
<160>2
<210>1
<211>759
<212>DNA
<213>2 Ambystomalaterale x Ambystomajeffersonianum
<400>1
atgcaattaaataacgctaatgataacactcagtttcgtgccttgcttttcgacgttcaa 60
ggtaccctcacagattttcgctatacgctaattgaacatggcctgtctatcttaggagac 120
cgagtcgattacgagttgtgggaagagcttgtagaccagtggcgggggtgttatagagat 180
gaactcgactccctagtgaaacaagagaagtggaggtcagttcgtgcagtctaccgcgat 240
tcgctgataaatttattggcgaaattcagtgacagcttttgcgctacttctgccgaagta 300
gagcttctcaccgatggttgggaacgactacggtcctggcctgacgtgccctcaggcctg 360
gagcagttaagatcgaagtatttggttgcagcgcttacaaacgctgatttcagtgcccac 420
gtcaatgtaggaaggagcgcaaaactccaatgggacgcggtgctatctgctcagctgttt 480
ggggcctacaagccacatcgttccacgtatgaaggtgcagcgactttattgggcattgct 540
ccgtcagagatccttatggttgcctcgcacgcatacgatctcgaagcggctcgcgaggtc 600
ggagccgggaccgcatatgtacgacggcctctagaatacggtcccacaggcagaacggag 660
gacgtgccagatggaaggttcgactttctggttgatagtataagcgaattagcggaccaa 720
ttggggtgtccgcgtcttggtggcactgctggaattgat 759
<210>2
<211>253
<212>PRT
<213>2 Ambystomalaterale x Ambystomajeffersonianum
<400>2
Met Gln Leu Asn Asn Ala Asn Asp Asn Thr Gln Phe Arg Ala Leu Leu
1 5 10 15
Phe Asp Val Gln Gly Thr Leu Thr Asp Phe Arg Tyr Thr Leu Ile Glu
20 25 30
His Gly Leu Ser Ile Leu Gly Asp Arg Val Asp Tyr Glu Leu Trp Glu
35 40 45
Glu Leu Val Asp Gln Trp Arg Gly Cys Tyr Arg Asp Glu Leu Asp Ser
50 55 60
Leu Val Lys Gln Glu Lys Trp Arg Ser Val Arg Ala Val Tyr Arg Asp
65 70 75 80
Ser Leu Ile Asn Leu Leu Ala Lys Phe Ser Asp Ser Phe Cys Ala Thr
85 90 95
Ser Ala Glu Val Glu Leu Leu Thr Asp Gly Trp Glu Arg Leu Arg Ser
100 105 110
Trp Pro Asp Val Pro Ser Gly Leu Glu Gln Leu Arg Ser Lys Tyr Leu
115 120 125
Val Ala Ala Leu Thr Asn Ala Asp Phe Ser Ala His Val Asn Val Gly
130 135 140
Arg Ser Ala Lys Leu Gln Trp Asp Ala Val Leu Ser Ala Gln Leu Phe
145 150 155 160
Gly Ala Tyr Lys Pro His Arg Ser Thr Tyr Glu Gly Ala Ala Thr Leu
165 170 175
Leu Gly Ile Ala Pro Ser Glu Ile Leu Met Val Ala Ser His Ala Tyr
180 185 190
Asp Leu Glu Ala Ala Arg Glu Val Gly Ala Gly Thr Ala Tyr Val Arg
195 200 205
Arg Pro Leu Glu Tyr Gly Pro Thr Gly Arg Thr Glu Asp Val Pro Asp
210 215 220
Gly Arg Phe Asp Phe Leu Val Asp Ser Ile Ser Glu Leu Ala Asp Gln
225 230 235 240
Leu Gly Cys Pro Arg Leu Gly Gly Thr Ala Gly Ile Asp
245 250
Claims (9)
1. An epoxide hydrolase mutant, characterized by: the epoxide hydrolase mutant is one of the following:
the threonine at the 104 th site of the amino acid sequence shown in SEQ ID NO.2 is mutated into lysine;
isoleucine at the 179 th site of the amino acid sequence shown in SEQ ID NO.2 is mutated into leucine;
the aspartic acid at the 232 th site of the amino acid sequence shown in SEQ ID NO.2 is mutated into serine.
2. A gene encoding the epoxide hydrolase mutant of claim 1.
3. A recombinant vector comprising the gene of claim 2.
4. A method for preparing the epoxide hydrolase mutant according to claim 1, comprising the steps of:
s1, connecting the sequence shown in SEQ ID NO.1 with pET-28a (+) plasmid to form a recombinant expression vector pET-28a (+) -EHJ;
s2, constructing an epoxide hydrolase mutant recombinant expression vector by using the specific site-directed mutagenesis primer by taking the recombinant vector pET-28a (+) -EHJ as a template;
s3, carrying out heat shock transformation on the recombinant vector pET-28a (+) -EHJ and the mutant vector to obtain competence, coating the competence in a resistant LB solid culture medium, and carrying out colony PCR verification after overnight culture;
and S4, extracting plasmids from the verified positive clones, transforming E.coli BL21(DE3), then screening out the positive clones again, inoculating the positive clones into an LB culture medium containing kanamycin sulfate, carrying out shaking culture at 37 ℃ overnight, inoculating the positive clones into a 500ml triangular flask containing 100ml of LB culture medium according to the inoculation amount with the volume fraction of 2%, carrying out shaking culture on a shaking table at 37 ℃ and 200rpm, and adding IPTG (isopropyl thiogalactoside) as an inducer for induction expression when the OD600 of a culture solution reaches a proper value.
5. The method for preparing epoxide hydrolase mutant according to claim 4, wherein the specific site-directed mutagenesis primer of step S2 is:
Thr104-F：GTAGAGCTTCTCAAGGATGGTTGGGAAC；
Thr104-R：GTTCCCAACCATCCTTGAGAAGCTCTAC；
Lle179-F：GTGCAGCGACTTTATCGGGCATTGCTCCGT；
Lle179-R：ACGGAGCAATGCCCGATAAAGTCGCTGCAC；
Asp232-F：CGACTTTCTGGTTTCAAGTATAAGCGAA；
Asp232-R：TTCGCTTATACTTGAAACCAGAAAGTCG。
6. the method of preparing the epoxide hydrolase mutant according to claim 4, wherein the competent cells of step S3 are E.coli DH5 α competent cells, and the resistant LB solid medium is a kanamycin-resistant LB solid medium.
7. The method of producing an epoxide hydrolase mutant according to claim 4, wherein the concentration of kanamycin sulfate in the kanamycin sulfate-containing LB medium of step S4 is 50 mg/L.
8. The method for preparing an epoxide hydrolase mutant according to claim 4, wherein the OD600 of the culture solution obtained in step S4 is preferably 0.6-0.8.
9. The method for preparing epoxide hydrolase mutant according to claim 4, wherein the concentration of IPTG inducer in step S4 is 0.5mmol/L, and the inducing condition is culturing at 28 ℃ for 10 h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110535876.6A CN113373128B (en) | 2021-05-17 | 2021-05-17 | Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110535876.6A CN113373128B (en) | 2021-05-17 | 2021-05-17 | Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113373128A true CN113373128A (en) | 2021-09-10 |
| CN113373128B CN113373128B (en) | 2022-09-16 |
Family
ID=77571156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110535876.6A Active CN113373128B (en) | 2021-05-17 | 2021-05-17 | Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113373128B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103013945A (en) * | 2013-01-11 | 2013-04-03 | 华东理工大学 | Epoxide hydrolase mutant as well as gene and application of epoxide hydrolase mutant |
| CN105018443A (en) * | 2015-07-30 | 2015-11-04 | 浙江大学 | Epoxide hydrolase mutant and preparation method thereof |
| CN107937364A (en) * | 2018-01-15 | 2018-04-20 | 江南大学 | The Kidney bean epoxide hydrolase mutant that a kind of enantioselectivity improves |
| CN110257352A (en) * | 2019-06-30 | 2019-09-20 | 陕西斯戴木生物科技有限公司 | A kind of epoxide hydrolase and application thereof |
-
2021
- 2021-05-17 CN CN202110535876.6A patent/CN113373128B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103013945A (en) * | 2013-01-11 | 2013-04-03 | 华东理工大学 | Epoxide hydrolase mutant as well as gene and application of epoxide hydrolase mutant |
| CN105018443A (en) * | 2015-07-30 | 2015-11-04 | 浙江大学 | Epoxide hydrolase mutant and preparation method thereof |
| CN107937364A (en) * | 2018-01-15 | 2018-04-20 | 江南大学 | The Kidney bean epoxide hydrolase mutant that a kind of enantioselectivity improves |
| CN110257352A (en) * | 2019-06-30 | 2019-09-20 | 陕西斯戴木生物科技有限公司 | A kind of epoxide hydrolase and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| MINH, N. N., & FUKAZAWA, C.: "Production of the soybean epoxide hydrolase mutants at Asp101 (D101) site by the PCR Technique", 《ACADEMIA JOURNAL OF BIOLOGY》 * |
| YAO LI ET AL.: "Using multiple site-directed modification of epoxide hydrolase to significantly improve its enantioselectivity in hydrolysis of rac-glycidyl phenyl ether", 《CHINESE JOURNAL OF CHEMICAL ENGINEERING》 * |
| 苏永君 等: "定点突变提高环氧化物水解酶AuEH2催化对甲基苯基缩水甘油醚的对映选择性", 《中国生物工程杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113373128B (en) | 2022-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110791494B (en) | Aspartic enzyme mutant, recombinant expression vector and recombinant bacterium containing aspartic enzyme mutant and application | |
| CN108623652B (en) | Protein thermal stability modification method and application thereof in pullulanase | |
| CN109777793B (en) | GDSL lipase, genetically engineered bacterium and application thereof | |
| CN109971734B (en) | PH-insensitive high-temperature-tolerant HSL family lipid hydrolase and application thereof | |
| CN112522249B (en) | Fiber small body with improved catalytic activity, and assembly method and application thereof | |
| CN107893060A (en) | A kind of marine bacteria source thermostabilization salt tolerant SGNH family's hydrolases and application | |
| CN114134134B (en) | L-threonine aldolase mutant and application thereof in synthesis of L-syn-p-methylsulfonyl phenylserine | |
| CN111139229B (en) | Novel GDSL family lipid hydrolase EII-2 and encoding gene and application thereof | |
| CN103215238B (en) | Marine bacterial novel esterase, as well as preparation method and application thereof | |
| CN113373128B (en) | Epoxide hydrolase mutant with improved catalytic efficiency and preparation method thereof | |
| CN110004125B (en) | Novel alkali-resistant and organic solvent-resistant esterase from marine bacteria and application thereof | |
| CN112322606A (en) | Nitrile hydratase mutant and application thereof | |
| CN111394374A (en) | Cellulase gene gk2691 for encoding cellulase family GH30 and application thereof | |
| CN115058408B (en) | Metagenome-derived high-specific-activity acid-resistant D-psicose 3-epimerase and encoding gene and application thereof | |
| CN108034646B (en) | PvEH3 mutant with improved catalytic activity and improved enantiotropic normalization | |
| CN112481320B (en) | Method for preparing (-) gamma-lactam with high catalytic efficiency | |
| CN110577941A (en) | amine dehydrogenase and application thereof | |
| CN112301014B (en) | Esterase mutant with improved thermal stability and application thereof | |
| CN110951711B (en) | Esterase with activity of degrading chiral ester and coding gene and application thereof | |
| CN114752583A (en) | Heat-resistant beta-1, 3-1, 4-glucanase mutant and preparation method and application thereof | |
| CN109762801B (en) | Halogen alcohol dehalogenase mutant and application thereof in synthesizing chiral drug intermediate | |
| CN111518791B (en) | Sucrose hydrolase mutant and preparation method and application thereof | |
| CN111019921B (en) | High-tolerance lipid hydrolase E93 and encoding gene and application thereof | |
| CN113621629A (en) | Naringenin in-vitro enzymatic synthesis method based on malonyl coenzyme A regeneration | |
| CN108220268B (en) | Fusarium graminearum lipase mutant and coding gene and engineering bacterium thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230707 Address after: Room 313, Floor 3, No. 1128, Weiliu Road, Linjiang Street, Qiantang District, Hangzhou City, Zhejiang Province 310000 Patentee after: Hangzhou Zhongke Future Biomedical Technology Co.,Ltd. Address before: 518000 room 6015, 6 / F, building 2, Yongxin Times Square, intersection of Dongbin Road and Nanguang Road, Dengliang community, Nanshan street, Nanshan District, Shenzhen, Guangdong Patentee before: Shenzhen Weidi Technology Consulting Co.,Ltd. |
|
| TR01 | Transfer of patent right |