CN113372416A

CN113372416A - Mutant of influenza virus HA neck region, recombinant protein and application thereof

Info

Publication number: CN113372416A
Application number: CN202110728963.3A
Authority: CN
Inventors: 仝舟; 邢潇; 成志敏; 杨佳; 王洋; 高山; 高福
Original assignee: Shanxi Institute Of Higher Innovation
Current assignee: Shanxi Institute Of Higher Innovation
Priority date: 2021-06-29
Filing date: 2021-06-29
Publication date: 2021-09-10

Abstract

The invention relates to the field of vaccines, in particular to a mutant and a recombinant protein of an influenza virus HA neck region and application thereof. The invention provides a core amino acid mutation combination of a hydrophobic epitope in a head and neck region of HA, which is a scheme for stably expressing three-point mutation in a hydrophobic core region of the neck region of HA. The binding capacity of the neck region to the neck region of the known anti-influenza group 1-group 2 protective antibodies is remarkably improved, and the binding capacity of a non-broad-spectrum anti-group 1 influenza antibody only to the neck is inhibited. Solves the problem that the protein is difficult to express after the influenza neck hydrophobic region is mutated, and the expression quantity is equal to that of the wild type. Neutralization experiments show that the targeted antibody of the mutation combination can recognize various subtypes of influenza viruses, the neutralization effect is higher than that of an influenza trivalent inactivated vaccine, and in-vivo protection experiments prove that the in-vivo protection combination can effectively protect mice from lethal attack of H3N2 viruses, so that the development of the vaccine has important significance for the development of subsequent influenza universal vaccines.

Description

Mutant of influenza virus HA neck region, recombinant protein and application thereof

Technical Field

The invention relates to the field of vaccines, in particular to a mutant and a recombinant protein of an influenza virus HA neck region and application thereof.

Background

The influenza virus belongs to the family of orthomyxoviridae, the genus of influenza virus, and is a enveloped, segmented, single-stranded, negative-strand RNA virus. The influenza A virus can be divided into types A (A), B (B), C (C) and D (D), the influenza A virus can be divided into 18 HA subtypes and 11 NA subtypes, the influenza A virus HAs quick antigen variation, large infectivity and quick transmission, and the subtypes such as H1N1, H3N2, H5N1, H7N9, H9N2 and the like are easy to be widely epidemic in species such as birds, pigs, people and the like. Seasonal influenza viruses cause a large amount of worldwide population and property losses each year, and in the face of this situation, vaccination with influenza vaccines is the most cost-effective measure for preventing infections. Influenza Hemagglutinin (HA) is the major source of immunity for influenza viruses and is also a major target for host immune responses and an important protective antigen for currently licensed vaccines. HA mediates viral entry by binding to terminal sialic acids on host respiratory epithelial cell glycoproteins or glycolipids, and mediates fusion between the viral envelope and the host cell membrane. However, since the surface glycoprotein of HA head region is very variable, resulting in poor prevention effect of the vaccine against influenza variant strains, influenza vaccine production needs to be performed by newly selecting influenza strains every year, which poses a great challenge to control of influenza pandemics. The conservation degree of the HA neck region among different influenza strains is high, and the vaccine off-target problem caused by the influenza HA head region mutation can be effectively solved. With the progress of antibody studies after 2009, more and more antibodies directed against the conserved neck region of influenza virus HA were discovered, which have been shown to have broad-spectrum protective effects against different influenza strains, even Group1 represented by H1N1 and Group2 represented by H3N2 in the HA classification, and are the main target antigens for broad-spectrum influenza vaccine studies.

However, with the intensive research, more and more data show that the HA neck region hydrophobic core region is used as a main immune source, the stimulating antibody HAs preference, and mainly a class of antibodies utilizing heavy chain VH1-69 is generated, the gene locus of the antibodies is ubiquitous in the human body, but due to the conserved hydrophobic binding characteristic, most of the antibodies of VH1-69 only have effects on Group1 represented by H1N 1. The preference caused by the initial immunization can cause the rapid elimination of the pre-stored antibodies to the subsequent conserved neck antigens due to the existence of immunological memory, so that the new immune antigens can not stimulate the immune system to generate new antibodies, which is also considered as the root cause that broad-spectrum antibodies in the neck region can not be stimulated even if the vaccine is injected repeatedly. It is worth noting that different from experimental animals, humans have preferential pre-existing immunity for influenza infection or vaccine creation, so that antigen modification capable of breaking pre-existing immunity preference of HA neck regions is a necessary design for generating various vaccines of broad-spectrum antibodies by using HA neck regions in the future.

Disclosure of Invention

In view of the above, the invention provides a method for improving the antibody polymorphism generated by the neck region by performing site-specific modification on the neck region to break the immune preference of the core hydrophobic interaction region required for VH1-69 combination; improves the capability of modifying the antigen in the neck region to bypass the pre-existing immunity and stimulate the generation of more broad-spectrum antibodies under the pre-existing immunity background, thereby improving the vaccine with the broad-spectrum influenza protection effect.

In order to achieve the above object, the present invention provides the following technical solutions:

a mutant of influenza virus HA neck region, wherein histidine at position 28 is mutated to serine; and/or histidine at position 48 is mutated to glutamine; tryptophan to leucine at position 267 was mutated to three amino acids.

In some embodiments of the invention, the mutant of the influenza virus HA neck region HAs:

(I) and an amino acid sequence shown as SEQ ID No. 4; or

(II) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence described in (I) and has the same function with the amino acid sequence described in (I); or

(III) an amino acid sequence having 90% or more identity to the amino acid sequence of (I) or (II);

and 5 of the one or more amino acids are substituted, deleted or added are 3.

More importantly, the invention also provides recombinant proteins comprising a mutant of the influenza virus HA neck region and a head region.

In some embodiments of the invention, the head region has:

(I) and an amino acid sequence shown as SEQ ID No. 5; or

and 5 of the one or more amino acids are substituted, deleted or added are 3.

In some embodiments of the invention, the invention also provides nucleic acid molecules encoding the head region.

In some embodiments of the invention, the recombinant protein has:

(I) and an amino acid sequence shown as SEQ ID No. 8; or

and 3 of the substitutions, deletions or additions of one or more amino acids.

The invention also provides nucleic acid molecules encoding said mutants, or nucleic acid molecules encoding said recombinant proteins.

In some embodiments of the invention, the nucleic acid molecule encoding the mutant has:

(I) a nucleotide sequence shown as SEQ ID No. 3; or

(II) a complementary nucleotide sequence of the nucleotide sequence shown as SEQ ID No. 3; or

(III) a nucleotide sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or

(IV) a nucleotide sequence obtained by substituting, deleting or adding one or two nucleotide sequences with the nucleotide sequence shown in the (I), (II) or (III), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in the (I), (II) or (III); or

(V) a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of (I), (II), (III) or (IV).

In some embodiments of the invention, the nucleic acid molecule encoding the recombinant protein has:

(1) a nucleotide sequence shown as SEQ ID No. 9; or

(2) A complementary nucleotide sequence of the nucleotide sequence shown as SEQ ID No. 9; or

(3) A nucleotide sequence which encodes the same protein as the nucleotide sequence of (1) or (2) but differs from the nucleotide sequence of (1) or (2) due to the degeneracy of the genetic code; or

(4) A nucleotide sequence obtained by substituting, deleting or adding one or two nucleotide sequences with the nucleotide sequence shown in (1), (2) or (3), and the nucleotide sequence has the same or similar functions with the nucleotide sequence shown in (1), (2) or (3); or

(5) A nucleotide sequence having at least 90% sequence identity with the nucleotide sequence of (1), (2), (3) or (4)

In addition, the invention also provides an expression vector comprising the nucleic acid molecule.

Based on the above research, the present invention also provides an antigen, including the mutant or the recombinant protein.

More importantly, the invention also provides the use of the mutant, the recombinant protein, the nucleic acid molecule, the expression vector or the antigen for the preparation of any one or more of the following;

(I) preparing an influenza antibody;

(II) preparing a vaccine for preventing influenza; and/or

(III) preparing a medicament for treating influenza; and/or

(IV) preparing a detection reagent or a detection kit for detecting the influenza virus.

The invention further provides an influenza antibody, a vaccine for preventing influenza, a medicament for treating influenza and/or a detection reagent or a detection kit for detecting influenza virus, which is prepared from the mutant, the recombinant protein, the nucleic acid molecule, the expression vector or the antigen.

In some embodiments of the invention, the influenza virus comprises subtypes H1N1, H3N2, H5N1, H7N9, H9N2, and the like, and preferably, the influenza virus is selected from the A/Brisbane/02/2018(H1N1) strain and the A/Kansas/14/2017(H3N2) strain.

The invention also provides a method for preventing and/or treating influenza, and the medicament is administered.

The invention also provides a method for diagnosing influenza, which is used for detecting the influenza by using the antibody, the detection reagent or the kit and judging whether the influenza suffers from diseases or not according to antigen-antibody reaction.

The invention expresses influenza HA neck region point mutation and head region antigen through 293T cell expression system, the antigen can effectively generate neutralization reaction with a plurality of influenza broad-spectrum neutralizing antibodies, and provides basis for further research and development of influenza universal vaccine. A293T cell expression system is used for expressing influenza HA neck region point mutation and head region antigen, and a large amount of easily purified antigen is obtained. The influenza HA neck region site mutation and head region antigen obtained by the invention HAs certain cross protection to each subtype of influenza virus, and particularly, mouse serum obtained by immunizing HA-14900 and HA-14900 SQL-3 protein HAs the capability of neutralizing A/Brisbane/02/2018(H1N1) strain and A/Kansas/14/2017(H3N2) strain. The research has important significance in the aspect of influenza virus prevention and control.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows a molecular sieve and SDS-PAGE profile of HA-14900 protein purification; the Y axis is the absorption value of 280 nm;

FIG. 2 shows a molecular sieve and SDS-PAGE profile of HA-14900 SQL-3 protein purification; the Y axis is the absorption value of 280 nm;

FIG. 3 shows the affinity constants of HA neck region, neck region mutants, recombinant proteins with influenza neutralizing antibodies; wherein, FIG. 3(A) shows the affinity constants of HA neck region, neck region mutant and CR 6261; FIG. 3(B) shows affinity constants of recombinant proteins with F10, 27F3, CR6261, CR 9114;

FIG. 4 shows a protein structure diagram of HA-14900 and HA-14900 SQL-3 mutation sites and a structure diagram of HA-14900 SQL-3/CR9114 complex; wherein, FIG. 4(A) shows a protein structure diagram of the mutation sites of HA-14900 and HA-14900 SQL-3; FIG. 4(B) is a diagram showing the structure of HA-14900 SQL-3/CR9114 complex;

FIG. 5 shows the results of neutralization experiments of the immune group sera against influenza virus H1N 1;

FIG. 6 shows the results of neutralization experiments of the immune group sera against influenza virus H3N 2;

FIG. 7 shows the relative rate of body weight change and survival following challenge in immunized mice; wherein, fig. 7(a) shows the relative rate of change in body weight after challenge; fig. 7(B) shows survival of mice after challenge.

Detailed Description

The invention discloses a mutant of influenza virus HA neck region, recombinant protein and application thereof, and a person skilled in the art can realize the mutant by appropriately improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The invention obtains a vaccine which HAs an HA conservative neck region and an HA head conservative epitope, and improves the antigen with broad-spectrum protection effect by mutating key sites of the HA neck region. Biacore experiments show that the mutant antigen has lower affinity with various influenza V1-69 antibodies than the unmutated antigen. Meanwhile, a neutralization experiment shows that the conserved epitope on the surface of the HA head trimer is reserved, the targeting antibody can recognize various subtypes of influenza viruses and endow mice with heterogenic protection depending on Fc activity, and the neutralization effect of the targeting antibody is higher than that of a TIV influenza trivalent vaccine and influenza neck region protein, so that the development of the vaccine HAs important significance for the development of a follow-up influenza universal vaccine.

In the mutant and the recombinant protein of the influenza virus HA neck region and the application thereof, used raw materials and reagents can be purchased from the market.

The invention is further illustrated by the following examples:

example 1 HA-14900 plasmid construction

1# (1# is HA neck region protein): ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCAACCTACGCCGACACCATTTGCATCGGCTACCACGCCAACAACAGCACCGACACCGTGGACACCGTGCTGGAGAAGAACGTGACCGTGACCCACAGCGTGAATCTGCTGGAGAACGGAGGAGGCGGCAAATACGTCTGCAGCGCCAAACTGAGGATGGTGACCGGACTGAGGAACAAGCCCAGCAAGCAGAGCCAGGGACTGTTCGGAGCCATTGCCGGATTCACCGAGGGAGGTTGGACAGGAATGGTGGACGGTTGGTACGGCTACCACCACCAGAACGAGCAGGGAAGCGGATACGCCGCCGATCAGAAAAGCACCCAGAACGCCATCAACGGCATCACCAACAAGGTCAACAGCGTGATCGAGAAGATGAACACCCAGTACACCGCCATCGGTTGCGAGTACAACAAGAGCGAGCGCTGCATGAAGCAGATCGAGGACAAGATCGAGGAGATCGAGAGCAAGATCTGGTGCTACAACGCCGAACTGCTGGTGCTGCTGGAGAACGAGAGGACCCTGGACTTCCACGACAGCAACGTGAAGAACCTGTACGAGAAGGTCAAGAGCCAGCTGAAGAACAACGCCAAGGAGATCGGCAACGGCTGCTTCGAGTTCTACCACAAGTGCAACGACGAGTGCATGGAGAGCGTGAAGAACGGCACCTACGACTACCCCAAGTACAGCGAGGAGAGCAAGCTGAACCGGGAGAAGATCGACGGCGTGAAGCTGGAGAGCATGGGCGTGTACCAGATCGAGGGCAGACATCACCACCACCACCATCATTAG shown in SEQ ID No.1

1# (1# is HA neck region protein): MYRMQLLSCIALSLALVTNSTYADTICIGYHANNSTDTVDTVLEKNVTVTHSVNLLENGGGGKYVCSAKLRMVTGLRNKPSKQSQGLFGAIAGFTEGGWTGMVDGWYGYHHQNEQGSGYAADQKSTQNAINGITNKVNSVIEKMNTQYTAIGCEYNKSERCMKQIEDKIEEIESKIWCYNAELLVLLENERTLDFHDSNVKNLYEKVKSQLKNNAKEIGNGCFEFYHKCNDECMESVKNGTYDYPKYSEESKLNREKIDGVKLESMGVYQIEGRHHHHHHH shown in SEQ ID No.2

23-2(23-2 is three-point mutein of HA neck region): ATGTACAGGATGCAACTCCTGTCTTGCATTGCACTAAGTCTTGCACTTGTCACGAATTCAACCTACGCCGACACCATTTGCATCGGCTACTCCGCCAACAACAGCACCGACACCGTGGACACCGTGCTGGAGAAGAACGTGACCGTGACCCAGAGCGTGAATCTGCTGGAGAACGGAGGAGGCGGCAAATACGTCTGCAGCGCCAAACTGAGGATGGTGACCGGACTGAGGAACAAGCCCAGCAAGCAGAGCCAGGGACTGTTCGGAGCCATTGCCGGATTCACCGAGGGAGGTTGGACAGGAATGGTGGACGGTCTGTACGGCTACCACCACCAGAACGAGCAGGGAAGCGGATACGCCGCCGATCAGAAAAGCACCCAGAACGCCATCAACGGCATCACCAACAAGGTCAACAGCGTGATCGAGAAGATGAACACCCAGTACACCGCCATCGGTTGCGAGTACAACAAGAGCGAGCGCTGCATGAAGCAGATCGAGGACAAGATCGAGGAGATCGAGAGCAAGATCTGGTGCTACAACGCCGAACTGCTGGTGCTGCTGGAGAACGAGAGGACCCTGGACTTCCACGACAGCAACGTGAAGAACCTGTACGAGAAGGTCAAGAGCCAGCTGAAGAACAACGCCAAGGAGATCGGCAACGGCTGCTTCGAGTTCTACCACAAGTGCAACGACGAGTGCATGGAGAGCGTGAAGAACGGCACCTACGACTACCCCAAGTACAGCGAGGAGAGCAAGCTGAACCGGGAGAAGATCGACGGCGTGAAGCTGGAGAGCATGGGCGTGTACCAGATCGAGGGCAGACATCACCACCACCACCATCATTAG shown in SEQ ID No.3

23-2(23-2 is three-point mutein of HA neck region): MYRMQLLSCIALSLALVTNSTYADTICIGYSANNSTDTVDTVLEKNVTVTQSVNLLENGGGGKYVCSAKLRMVTGLRNKPSKQSQGLFGAIAGFTEGGWTGMVDGLYGYHHQNEQGSGYAADQKSTQNAINGITNKVNSVIEKMNTQYTAIGCEYNKSERCMKQIEDKIEEIESKIWCYNAELLVLLENERTLDFHDSNVKNLYEKVKSQLKNNAKEIGNGCFEFYHKCNDECMESVKNGTYDYPKYSEESKLNREKIDGVKLESMGVYQIEGRHHHHHHH shown in SEQ ID No.4

HA head region amino acid Sequence hemagglutinin [ Influenza A viruses (A/Brisbane/59/2007(H1N1)) ] Sequence ID: ACA 28844.1: shown as SEQ ID No.5

MEKIVLLLAIVSLVKSDTICIGYHANNSTDTVDTVLEKNVTVTHSVNLLENSHNGKLCLLKGIAPLQLGNCSVAGWILGNPECELLISKESWSYIVEKPNPENGTCYPGHFADYEELREQLSSVSSFERFEIFPKESSWPNHTVTGVSASCSHNGESSFYRNLLWLTGKNGLYPNLSKSYANNKEKEVLVLWGVHHPPNIGNQKALYHTENAYVSVVSSHYSRKFTPEIAKRPKVRDQEGRINYYWTLLEPGDTIIFEANGNLIAPRYAFALSRGFGSGIINSNAPMDKCDAKCQTPQGAINSSLPF

HA-14900 is HA neck plus head protein, and HAs the following amino acid sequence (shown in SEQ ID No. 6): MEKIVLLLAIVSLVKSDTICIGYHANNSTDTVDTVLEKNVTVTHSVNLLENSHNGKLCLLKGIAPLQLGNCSVAGWILGNPECELLISKESWSYIVEKPNPENGTCYPGHFADYEELREQLSSVSSFERFEIFPKESSWPNHTVTGVSASCSHNGESSFYRNLLWLTGKNGLYPNLSKSYANNKEKEVLVLWGVHHPPNIGNQKALYHTENAYVSVVSSHYSRKFTPEIAKRPKVRDQEGRINYYWTLLEPGDTIIFEANGNLIAPRYAFALSRGFGSGIINSNAPMDKCDAKCQTPQGAINSSLPFQNVHPVTIGECPKYVRSAKLRMVTGLRNIPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADQKSTQNAINGITNKVNSVIEKMNTQFTAVGKEFNKLERRMENLNKKVDDGFIDIWTYNAELLVLLENERTLDFHDSNVKNLYEKVKSQLKNNAKEIGNGCFEFYHKCNDECMESVKNGTYDYPKYSEESKLNREKIDGPGRLVPRGSPGSGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

HA-14900 is HA neck plus head protein, and the above amino acid sequence is encoded by the following nucleic acid sequence (as shown in SEQ ID No. 7):

GAATTCGCCACCATGGAGAAAATAGTGCTTCTTCTTGCAATAGTCAGTCTTGTTAAAAGTGACACAATATGTATAGGCTACCATGCTAACAACTCGACCGACACTGTTGACACAGTACTTGAAAAGAATGTGACAGTGACACACTCTGTCAACCTGCTTGAGAACAGTCACAATGGAAAACTATGTCTATTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGCGTTGCCGGGTGGATCTTAGGAAACCCAGAATGCGAATTACTGATTTCCAAGGAGTCATGGTCCTACATTGTAGAAAAACCAAATCCTGAGAATGGAACATGTTACCCAGGGCATTTCGCTGACTATGAGGAACTGAGGGAGCAATTGAGTTCAGTATCTTCATTTGAGAGGTTCGAAATATTCCCCAAAGAAAGCTCATGGCCCAACCACACCGTAACCGGAGTGTCAGCATCATGCTCCCATAATGGGGAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGGGAAGAATGGTTTGTACCCAAACCTGAGCAAGTCCTATGCAAACAACAAAGAAAAAGAAGTCCTTGTACTATGGGGTGTTCATCACCCGCCAAACATAGGTAACCAAAAGGCCCTCTATCATACAGAAAATGCTTATGTCTCTGTAGTGTCTTCACATTATAGCAGAAAATTCACCCCAGAAATAGCCAAAAGACCCAAAGTAAGAGATCAAGAAGGAAGAATCAATTACTACTGGACTCTGCTTGAACCCGGGGATACAATAATATTTGAGGCAAATGGAAATCTAATAGCGCCAAGATATGCTTTCGCACTGAGTAGAGGCTTTGGATCAGGAATCATCAACTCAAATGCACCAATGGATAAATGTGATGCGAAGTGCCAAACACCTCAGGGAGCTATAAACAGCAGTCTTCCTTTCCAGAACGTACACCCAGTCACAATAGGAGAGTGTCCAAAGTATGTCAGGAGTGCAAAATTAAGGATGGTTACAGGACTAAGGAACATCCCATCCATTCAATCCAGAGGTTTGTTTGGAGCCATTGCCGGTTTCATTGAAGGGGGGTGGACTGGAATGGTAGATGGTTGGTATGGTTATCATCATCAGAATGAGCAAGGATCTGGCTATGCTGCAGATCAAAAAAGCACACAAAATGCCATTAATGGGATTACAAACAAGGTGAATTCTGTAATTGAGAAAATGAACACTCAATTCACAGCAGTGGGCAAAGAATTCAACAAATTGGAAAGAAGGATGGAAAACTTGAATAAAAAAGTTGATGATGGGTTTATAGACATTTGGACATATAATGCAGAACTGTTGGTTCTACTGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGAATCTGTATGAGAAAGTAAAAAGCCAGTTAAAGAATAATGCTAAAGAAATAGGAAATGGGTGTTTTGAATTCTATCACAAGTGTAACGATGAATGCATGGAGAGTGTAAAGAATGGAACTTATGACTATCCAAAATATTCCGAAGAATCAAAGTTAAACAGGGAGAAAATTGATGGACCCGGGCGACTGGTACCACGAGGTAGTCCAGGATCAGGTTATATTCCTGAAGCTCCAAGAGATGGGCAAGCTTACGTTCGTAAAGATGGCGAATGGGTATTACTTTCTACCTTTTTAGGACATCATCATCATCATCACTAACTCGAG

the coding sequence of HA-14900 gene is inserted into pCAGGS vector, the coding sequence of 6 histidine tag (hexa-His-tag) and translation stop codon are inserted after the coding fragment of protein, a recombinant protein with histidine tag at C-terminal is obtained, which is beneficial to the subsequent protein purification and is named as HA-14900. The recombinant plasmid is verified to be completely correct by PCR, enzyme digestion identification and sequencing.

Then we mutated histidine at position 28 of the HA-14900 amino acid sequence to serine; histidine at position 48 was mutated to glutamine; the 267 th tryptophan is changed into leucine, and three amino acid mutations are obtained, and HA-14900 SQL-3 plasmid construction is obtained.

HA-14900 SQL-3 is three-point mutant protein of HA neck region and head region, and HAs the following amino acid sequence (shown as SEQ ID No. 8):

MEKIVLLLAIVSLVKSDTICIGYSANNSTDTVDTVLEKNVTVTQSVNLLENSHNGKLCLLKGIAPLQLGNCSVAGWILGNPECELLISKESWSYIVEKPNPENGTCYPGHFADYEELREQLSSVSSFERFEIFPKESSWPNHTVTGVSASCSHNGESSFYRNLLWLTGKNGLYPNLSKSYANNKEKEVLVLWGVHHPPNIGNQKALYHTENAYVSVVSSHYSRKFTPEIAKRPKVRDQEGRINYYWTLLEPGDTIIFEANGNLIAPRYAFALSRGFGSGIINSNAPMDKCDAKCQTPQGAINSSLPFQNVHPVTIGECPKYVRSAKLRMVTGLRNIPSIQSQGLFGAIAGFIEGGWTGMVDGLYGYHHQNEQGSGYAADQKSTQNAINGITNKVNSVIEKMNTQFTAVGKEFNKLERRMENLNKKVDDGFIDIWTYNAELLVLLENERTLDFHDSNVKNLYEKVKSQLKNNAKEIGNGCFEFYHKCNDECMESVKNGTYDYPKYSEESKLNREKIDGPGRLVPRGSPGSGYIPEAPRDGQAYVRKDGEWVLLSTFLGHHHHHH

HA-14900 SQL-3 is HA neck region plus head region three-point mutant protein, and the above amino acid sequence is encoded by the following nucleic acid sequence (shown as SEQ ID No. 9):

GAATTCGCCACCATGGAAAAGATCGTGCTGCTGCTGGCCATCGTGTCCCTGGTCAAGAGCGACACCATCTGCATCGGCTACAGCGCCAACAACAGCACCGACACCGTGGATACCGTGCTGGAAAAGAATGTGACCGTGACACAGAGCGTGAACCTGCTCGAAAACAGCCACAACGGCAAGCTGTGCCTGCTGAAGGGAATTGCCCCTCTGCAGCTGGGCAATTGCTCTGTGGCTGGATGGATCCTGGGCAACCCTGAGTGCGAGCTGCTGATCTCCAAAGAGTCCTGGTCCTACATCGTGGAAAAGCCCAATCCTGAGAACGGCACATGCTACCCTGGCCACTTCGCCGACTACGAGGAACTGAGAGAACAGCTGAGCAGCGTGTCCAGCTTCGAGAGATTCGAGATCTTCCCCAAAGAGAGCAGCTGGCCCAACCACACAGTGACAGGCGTGTCCGCCAGCTGTAGCCACAATGGCGAGTCCAGCTTTTACCGGAACCTGCTGTGGCTGACCGGCAAGAACGGCCTGTATCCTAACCTGAGCAAGAGCTACGCTAACAACAAAGAAAAAGAGGTGCTGGTCCTCTGGGGCGTGCACCATCCTCCAAACATCGGCAATCAGAAGGCCCTGTACCACACCGAGAACGCCTATGTGTCCGTGGTGTCCAGCCACTACAGCCGGAAGTTCACACCCGAGATCGCCAAGAGGCCCAAAGTGCGGGATCAAGAGGGCAGAATCAACTACTACTGGACCCTGCTGGAACCCGGCGATACCATCATCTTCGAGGCCAACGGCAACCTGATCGCCCCTAGATACGCCTTCGCTCTGAGCAGAGGCTTTGGCAGCGGCATCATCAACAGCAACGCCCCTATGGACAAGTGCGACGCCAAGTGTCAGACACCTCAGGGCGCTATCAACAGCTCCCTGCCTTTCCAGAACGTGCACCCTGTGACCATCGGCGAGTGCCCTAAATATGTGCGGAGCGCCAAGCTGAGAATGGTCACCGGCCTGAGAAACATCCCCAGCATCCAGTCCCAGGGCCTGTTTGGAGCCATTGCCGGCTTTATCGAAGGCGGCTGGACAGGCATGGTGGATGGCCTGTATGGCTACCACCACCAGAACGAGCAAGGCTCTGGATACGCCGCCGACCAGAAGTCTACACAGAACGCCATCAACGGGATCACCAACAAAGTGAACAGCGTGATCGAGAAGATGAACACCCAGTTCACCGCCGTGGGCAAAGAGTTCAACAAGCTGGAACGGCGGATGGAAAACCTGAACAAGAAGGTGGACGACGGCTTCATCGACATCTGGACCTACAACGCCGAACTGCTGGTGCTCCTGGAAAACGAGAGAACCCTGGACTTCCACGACAGCAACGTGAAGAACCTGTACGAGAAAGTGAAGTCCCAGCTGAAGAACAACGCCAAAGAGATCGGCAACGGCTGCTTCGAGTTCTACCACAAGTGCAACGACGAGTGCATGGAAAGCGTGAAGAATGGCACCTACGACTACCCCAAGTACAGCGAGGAAAGCAAGCTGAACAGAGAGAAGATCGACGGCCCTGGCAGACTGGTGCCTAGAGGATCTCCTGGCTCTGGCTACATCCCCGAGGCTCCTAGAGATGGCCAGGCCTACGTTAGAAAGGACGGCGAATGGGTGCTGCTGAGCACCTTTCTGGGACACCACCATCACCACCACTGACTCGAG

the gene sequence of HA-14900 SQL-3 is inserted into pCAGGS vector, and the coding sequence of 6 histidine tag (hexa-His-tag) and translation stop codon are inserted after the coding fragment of protein, so as to obtain a recombinant protein with histidine tag at C-terminal, which is beneficial to subsequent protein purification and named as HA-14900 SQL-3. The recombinant plasmid is verified to be completely correct by PCR, enzyme digestion identification and sequencing.

The NA-1 plasmid (a plasmid co-transfected with the target protein when the NA is the expression protein) constructs the nucleic acid sequence of the NA-1 (shown as SEQ ID No. 10):

gaattcgccaccatgggggcaggtgccaccggccgcgccatggacgggccgcgcctgctgctgttgctgcttctgggggtgtcccttggaggtgccgattataaggatgatgatgataagagctccagtgattactcggacctacagagggtgaaacaggagcttctggaagaggtgaagaaggaattgcagaaagtgaaagaggaaatcattgaagccttcgtccaggagctgaggaagcggggttctctggtaccacgaggtagtccatcacgatcagtgaaattagcgggcaattcctctctctgccctgttagtggatgggctatatacagtaaagacaacagtgtaagaatcggttccaagggggatgtgtttgtcataagggaaccattcatatcatgctcccccttggaatgcagaaccttcttcttgactcaaggggccttgctaaatgacaaacattccaatggaaccattaaagacaggagcccatatcgaaccctaatgagctgtcctattggtgaagttccctctccatacaactcaagatttgagtcagtcgcttggtcagcaagtgcttgtcatgatggcatcaattggctaacaattggaatttctggcccagacaatggggcagtggctgtgttaaagtacaacggcataataacagacactatcaagagttggagaaacaatatattgagaacacaagagtctgaatgtgcatgtgtaaatggttcttgctttactgtaatgaccgatggaccaagtaatggacaggcctcatacaagatcttcagaatagaaaagggaaagatagtcaaatcagtcgaaatgaatgcccctaattatcactatgaggaatgctcctgttatcctgattctagtgaaatcacatgtgtgtgcagggataactggcatggctcgaatcgaccgtgggtgtctttcaaccagaatctggaatatcagataggatacatatgcagtgggattttcggagacaatccacgccctaatgataagacaggcagttgtggtccagtatcgtctaatggagcaaatggagtaaaagggttttcattcaaatacggcaatggtgtttggatagggagaactaaaagcattagttcaagaaacggttttgagatgatttgggatccgaacggatggactgggacagacaataacttctcaataaagcaagatatcgtaggaataaatgagtggtcaggatatagcgggagttttgttcagcatccagaactaacagggctggattgtataagaccttgcttctgggttgaactaatcagagggcgacccaaagagaacacaatctggactagcgggagcagcatatccttttgtggtgtaaacagtgacactgtgggttggtcttggccagacggtgctgagttgccatttaccattgacaagtaactcgag

example 2 HA-14900 expression purification

Transforming Top10 competent cells with the recombinant plasmid, culturing overnight at 37 ℃, selecting a monoclonal, 5ml of a small shake culture solution, ampicillin resistance, shaking in 300ml overnight, performing endotoxin-free plasmid macroextraction to obtain influenza HA full-length plasmid, and culturing 293T cells with DMEM containing 10% FBS. The plasmid was transfected into 293T cells (4900 HA-1: NA-1 ═ 20. mu.g: 20. mu.g/disc) at a density of 70% by PEI liposome, cells were cultured for 4 to 6 hours in serum-free DMEM for 3 days, the supernatant was collected, DMEM was supplemented, and the cells were cultured for 4 days again to collect the supernatant.

The cell culture supernatant was incubated with HisTrap^TMExcel (GE) was combined overnight at 4 ℃ and protein elution buffer A (20mM Tris,150mM NaCl, pH 8.0) and buffer B (20mM Tris,150mM NaCl, pH 8.0,1M imidazolizole) were prepared. Thereafter, the His column was washed with a buffer solution A (20mM Tris,150mM NaCl, pH 8.0) to remove non-specifically bound proteins, followed by removal of hetero-proteins with a 5% buffer solution B (20mM Tris,150mM NaCl, pH 8.0,50mM imidazole), and finally the objective protein was eluted from the His column with a 30% solution B (20mM Tris,150mM NaCl, pH 8.0,300mM imidazole), and the protein concentrate tube with a 30-cut (30KD cutoff) was exchanged with a buffer solution A (20mM Tris,150mM NaCl, pH 8.0) to remove the imidazole concentration in the protein solution, and finally the protein solution was concentrated to 0.5ML, and then Thrombin enzyme (1mg protein plus 5. mu.l Thrombin enzyme (1KU/ML)) was added to digest it overnight at 4 ℃. The cleaved protein was further purified by molecular sieves using AKTA-purifier (GE) and superdex200 Increate 10/300GL molecular sieves (GE), molecular sieves equilibrated with PBS buffer, 1 mllop loop loading while monitoring the UV absorbance at 280nm, and the protein of interest was recovered and the protein purity was identified by SDS-PAGE. The molecular sieve pattern and SDS-PAGE (FIG. 1) of a typical protein of interest showed that we obtained purified HA-14900 protein.

Example 3 HA-14900 SQL-3 expression purification

Transforming Top10 competent cells with the recombinant plasmid, culturing overnight at 37 ℃, selecting a monoclonal, 5ml of a small shake culture solution, ampicillin resistance, shaking in 300ml overnight, performing endotoxin-free plasmid macroextraction to obtain influenza HA-14900 SQL-3 plasmid, and culturing 293T cells with DMEM containing 10% FBS. The plasmid was transfected into 293T cells (HA-14900 SQL-3: NA-1: 20. mu.g/dish) at a density of 70% by PEI liposome, after 4 to 6 hours, the cells were cultured in serum-free DMEM for 3 days, the supernatant was collected, DMEM was supplemented, and the culture was repeated for 4 days to collect the supernatant.

The cell culture supernatant was incubated with HisTrap^TMExcel (GE) was combined overnight at 4 ℃ and protein elution buffer A (20mM Tris,150mM NaCl, pH 8.0) and buffer B (20mM Tris,150mM NaCl, pH 8.0,1M imidazolizole) were prepared. Thereafter, the His column was washed with buffer solution A to remove non-specifically bound proteins, then with buffer solution 2% B (20mM Tris,150mM NaCl, pH 8.0,20mM imidazolide) to remove foreign proteins, and finally the objective protein was eluted from the His column with 30% B (20mM Tris,150mM NaCl, pH 8.0,300mM imidazolide) and exchanged with 30% KD (30KD cutoff) protein concentrate tube using buffer solution A (20mM Tris,150mM NaCl, pH 8.0) to remove imidazole concentration in the protein solution, and finally the protein solution was concentrated to 0.5ml, and Thrombin enzyme (1mg protein plus 5. mu.l Thrombin enzyme) was added thereto overnight at 4 ℃. The digested protein solution was further purified by molecular sieves equilibrated with PBS buffer using AKTA-purifier (GE) and superdex200 Increate 10/300GL molecular sieves (GE) which were loaded on 1ml loop while monitoring the UV absorbance at 280nm, and the protein of interest was recovered and the protein purity was identified by SDS-PAGE. The molecular sieve pattern and SDS-PAGE (FIG. 2) of a typical protein of interest showed that we obtained purified HA-14900 SQL-3 protein.

Example 4 detection of protein and antibody affinity by surface plasmon resonance (biacore)

In the present study, the surface plasmon resonance phenomenon was used to detect intermolecular interactions, and was performed on biomacromolecule interaction analysis system Biacore 8K produced by GE Healthcare group. Biotin-streptavidin coupling (SA chip) was used to capture proteins # 1, 23-2, HA-14900, HA-14900 SQL-3 as stationary phase and mobile phase as broadly neutralizing antibody protein against influenza to be detected, after which kinetic parameters were analyzed by BIAevaluation software and plotted.

The experimental steps are as follows: by using the coupling effect of biotin-streptavidin, HA-14900, HA-14900 SQL-3 protein and a biotinylation reagent are firstly placed for 30 minutes at room temperature according to the proportion, the protein is biotinylated and labeled, then a concentration tube or a desalting column is used for exchanging liquid to PBST, and the redundant biotinylation reagent is removed. Biotinylated antigenic proteins # 1, 23-2, HA-14900, HA-14900 SQL-3 were immobilized at 20. mu.g/ml on an SA chip (GE), and then antibodies CR6261Fab, F10 Fab, CR9114Fab, 27F3Fab were injected into the chip with a concentration gradient of 6.25nM to 100nM, respectively, and the analysis was performed at a constant temperature of 25 ℃ using 0.005% PBST as a buffer. The regeneration of the chip surface was performed using a 10mM NaOH solution, the binding curve is shown in the figure, and the curves for different concentrations constitute the kinetic curves shown in the figure. The calculation of binding kinetic constants was performed using BIAevaluationsoftware version3.2(Biacore, Inc.). As shown in FIG. 3, the affinity constant of the antibody CR6261Fab and the protein # 1 was 7.19nM, and the affinity constant of the antibody CR6261Fab and the protein # 23-2 was 68.3. mu.M (FIG. 3A). The affinity constant of the antibody F10 Fab and HA-14900 protein is 2.7nM, and the affinity constant of the antibody F10 Fab and HA-14900 SQL-3 protein is 35.9. mu.M; the affinity constant of antibody 27F3Fab and HA-14900 protein is 47nM, and the affinity constant of antibody 27F3Fab and HA-14900 SQL-3 protein is 1.03 μ M; the affinity constant of the antibody CR6261Fab and the HA-14900 protein is 6.97nM, and the affinity constant of the antibody CR6261Fab and the HA-14900 SQL-3 protein is 0.466 nM; the affinity constants for antibody CR9114Fab and HA-14900 protein were 34.9nM and for antibody CR9114Fab and HA-14900 SQL-3 protein 43.3nM (FIG. 3B).

The above data indicate that the affinity of the mutant full-length protein HA-14900 SQL-3 to the antibody of VH1-69 class is much lower than that of the non-mutant full-length protein HA-14900, indicating that the mutation successfully inhibits the antibody of VH1-69 class. We demonstrate that by engineering the neck region, the immune preference of VH1-69 for binding to the core hydrophobic interaction region can be broken, and the antibody polymorphism generated by the neck region can be improved.

Example 5 protein Structure of HA-14900 and HA-14900 SQL-3 mutation sites and HA-14900 SQL-3/CR9114 Complex Structure

As shown in FIG. 4A, the yellow-labeled part shows that the three hydrophobic region mutation sites of HA-14900 and HA-14900 SQL-3 have no physical displacement in the protein structure, and the fixed-point replacement of VH1-69 dependent sites is realized by our design without influencing the overall epitope structure of the hydrophobic regions. The HA-14900 SQL-3 and CR9114 complex structure diagram (FIG. 4B) demonstrates that while the three point mutations in the neck region did not affect the overall protein structure of influenza HA, they did not affect the binding to CR9114, a broad-spectrum antibody against influenza B, which could represent group1 across H1N1 and group2 across H3N 2.

Example 6 mouse immunization experiment

1 laboratory animal

BALB/c female mice of 4-6 weeks old are immunized by intramuscular injection.

2 group arrangement

Negative control (adjuvant MF 59);

positive control (influenza virus split vaccine TIV);

experimental group HA-14900 (influenza head + neck region protein);

experimental group HA-14900 SQL-3 (influenza head + neck region three-point mutant protein);

experimental group 1# (influenza neck region protein)

Experimental group 23-2 (influenza neck three-point mutant protein)

The above groups contain 6.

3, animal immunization:

the immunization dose of the negative group and the experimental group is 100 mul each; the immunization dose of the positive group was 100. mu.l each.

The immunization dose of each animal in the experimental group is 20 mug/100 mug/animal, proteins are diluted by PBS, 6 proteins in each group are mixed with different experimental histones and MF59 adjuvant with the same volume, and the mixture is shaken until the different experimental histones are completely emulsified until bath water is not dissolved for animal immunization. Immunizations were performed every 14 days for a total of three times.

4, separating serum:

after 14 days, mice of the immunization groups are anesthetized and blood is taken to prepare serum, the mouse serum is treated by RED, and according to 1 volume of the serum, 4 volumes of RDE are added, water bath at 37 ℃ is carried out for 18 hours, and inactivation at 56 ℃ is carried out for 30min for subsequent experiments.

TCID was carried out with 5A/Brisbane/02/2018(H1N1) strain and A/Kansas/14/2017(H3N2) strain₅₀Measurement of

a. By 10-fold serial dilution, i.e. 10^-1、10^-2....10^-10A1.5 EP tube, 900. mu.l virus dilution + 100. mu.l virus stock can be used.

b. Laying 96-well plate 18-24h in advance, adding 100 μ l (2 × 10) per well⁵Pieces/ml) MDCK cells. 5% CO at 37 ℃₂Culturing in an incubator.

c. Virus inoculation, cells were washed 1 time with PBS, 150. mu.l per well, and then diluted virus solution according to the first step was added to a 96-well plate, one row was inoculated per dilution, 100. mu.l per well, and dilution control was set in

columns

11 and 12, and cultured in an incubator at 37 ℃.

d. Observing and recording results day by day, and calculating TCID of strain according to Reed-Muench method after 72h₅₀。

6 neutralization experiment:

a. viral dilution

Diluting to 200TCID with virus culture solution₅₀/100μl。

b. Serum negative control (cell maintenance liquid only added)

Serum dilution: the mouse serum was initially diluted 1:20 and the neutralization assay was performed at a 2-fold dilution.

c. Virus incubation

Diluting the virus (100 TCID)₅₀) Mu.l of the mixture was added to 50. mu.l of serum, mixed well, left at 37 ℃ and incubated for 1 hour.

MDCK cell adsorption

MDCK cells were washed once with 150. mu.l PBS, discarded, blotted on absorbent paper, and 100. mu.l of virus dilution was added and placed in a 37 ℃ incubator for use. Mu.l of virus-serum mixture was added to each well, and the wells were paralleled with three wells and placed in a cell incubator for 72 hours.

e. Hemagglutination inhibition assay

And taking supernatant after 72 hours, adding 25 mu l of supernatant per hole into a blood coagulation plate, gently shaking and uniformly mixing, placing at room temperature for 20min, adding 25 mu l of 1% chicken red blood cell suspension, gently shaking and uniformly mixing, standing at room temperature for 20min, and judging the result.

f. The results were observed and the results are as follows.

Results of neutralization experiments with the immunized group sera against influenza virus H1N1 (shown in fig. 5):

the results show that: the mouse sera immunized with HA-14900 and HA-14900 SQL-3 produced more antibodies than the TIV positive group (commercial influenza vaccine) and influenza neck region protein 1#, 23-2 alone, and the negative control MF59 produced no antibodies, indicating that HA-14900 and HA-14900 SQL-3 were able to prevent invasion of the A/Brisbane/02/2018(H1N1) strain.

Results of neutralization experiments with the immunized group sera against influenza virus H3N2 (shown in figure 6):

the mouse sera immunized with HA-14900 and HA-14900 SQL-3 produced more antibodies than the TIV positive group (commercial influenza vaccine) and influenza neck region protein 1#, 23-2 alone, and the negative control group MF59 produced no antibodies, indicating that HA-14900 and HA-14900 SQL-3 can prevent invasion of A/Kansas/14/2017(H3N2) strain.

Example 7 in vivo protection experiments in mice

1 experimental animal: BALB/c female mouse of 4 weeks old, intramuscular injection

2 group arrangement

Negative control PBS;

experimental group HA-14900 (influenza head + neck region protein);

each group comprises 8

3 immunization of animals

See example 6, two immunizations

4 internal attack of toxic substances

Two exempt from8 weeks later, the drug is attacked, and after anesthesia, the drug is attacked by nasal drops H3N2(A/Aichi/2/68), and the dose of the drug is 10⁴TCID₅₀/100μl。

5 weighing, mortality calculation

After challenge, mice were weighed daily and the mortality of mice was counted.

To investigate the in vivo efficacy of HA-14900 and HA-14900 SQL-3, we examined their ability to protect mice from challenge with a lethal strain of H3N2(A/Aichi/2/68) virus. From FIG. 7A, it can be seen that the body weight of the mice injected with HA-14900 SQL-3 protein in advance decreased greatly 6 days after challenge, and then gradually recovered and maintained stably, while the body weight of the mice injected with HA-14900 protein in advance decreased greatly to below 70%; the survival rate of the mice injected with HA-14900 SQL-3 protein in advance after challenge was more than 60%, the survival rate of the mice injected with HA-14900 protein in advance after challenge was less than 20%, and the mice in the control group all died after challenge (FIG. 7B). HA-14900 SQL-3 was shown to be effective in protecting mice against lethal challenge with H3N2(A/Aichi/2/68) virus, indicating that HA-14900 SQL-3 HAs utility in influenza prevention.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of advanced innovation in Shanxi province

<120> influenza virus HA neck region mutant, recombinant protein and application thereof

<130> MP2031605

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 846

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattca 60

acctacgccg acaccatttg catcggctac cacgccaaca acagcaccga caccgtggac 120

accgtgctgg agaagaacgt gaccgtgacc cacagcgtga atctgctgga gaacggagga 180

ggcggcaaat acgtctgcag cgccaaactg aggatggtga ccggactgag gaacaagccc 240

agcaagcaga gccagggact gttcggagcc attgccggat tcaccgaggg aggttggaca 300

ggaatggtgg acggttggta cggctaccac caccagaacg agcagggaag cggatacgcc 360

gccgatcaga aaagcaccca gaacgccatc aacggcatca ccaacaaggt caacagcgtg 420

atcgagaaga tgaacaccca gtacaccgcc atcggttgcg agtacaacaa gagcgagcgc 480

tgcatgaagc agatcgagga caagatcgag gagatcgaga gcaagatctg gtgctacaac 540

gccgaactgc tggtgctgct ggagaacgag aggaccctgg acttccacga cagcaacgtg 600

aagaacctgt acgagaaggt caagagccag ctgaagaaca acgccaagga gatcggcaac 660

ggctgcttcg agttctacca caagtgcaac gacgagtgca tggagagcgt gaagaacggc 720

acctacgact accccaagta cagcgaggag agcaagctga accgggagaa gatcgacggc 780

gtgaagctgg agagcatggg cgtgtaccag atcgagggca gacatcacca ccaccaccat 840

cattag 846

<210> 2

<211> 281

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Thr Tyr Ala Asp Thr Ile Cys Ile Gly Tyr His Ala

20 25 30

Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val Thr

35 40 45

Val Thr His Ser Val Asn Leu Leu Glu Asn Gly Gly Gly Gly Lys Tyr

50 55 60

Val Cys Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Lys Pro

65 70 75 80

Ser Lys Gln Ser Gln Gly Leu Phe Gly Ala Ile Ala Gly Phe Thr Glu

85 90 95

Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His Gln

100 105 110

Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln Asn

115 120 125

Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys Met

130 135 140

Asn Thr Gln Tyr Thr Ala Ile Gly Cys Glu Tyr Asn Lys Ser Glu Arg

145 150 155 160

Cys Met Lys Gln Ile Glu Asp Lys Ile Glu Glu Ile Glu Ser Lys Ile

165 170 175

Trp Cys Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg Thr

180 185 190

Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val Lys

195 200 205

Ser Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe Glu

210 215 220

Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn Gly

225 230 235 240

Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg Glu

245 250 255

Lys Ile Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gln Ile Glu

260 265 270

Gly Arg His His His His His His His

275 280

<210> 3

<211> 846

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattca 60

acctacgccg acaccatttg catcggctac tccgccaaca acagcaccga caccgtggac 120

accgtgctgg agaagaacgt gaccgtgacc cagagcgtga atctgctgga gaacggagga 180

ggcggcaaat acgtctgcag cgccaaactg aggatggtga ccggactgag gaacaagccc 240

agcaagcaga gccagggact gttcggagcc attgccggat tcaccgaggg aggttggaca 300

ggaatggtgg acggtctgta cggctaccac caccagaacg agcagggaag cggatacgcc 360

gccgatcaga aaagcaccca gaacgccatc aacggcatca ccaacaaggt caacagcgtg 420

atcgagaaga tgaacaccca gtacaccgcc atcggttgcg agtacaacaa gagcgagcgc 480

tgcatgaagc agatcgagga caagatcgag gagatcgaga gcaagatctg gtgctacaac 540

gccgaactgc tggtgctgct ggagaacgag aggaccctgg acttccacga cagcaacgtg 600

aagaacctgt acgagaaggt caagagccag ctgaagaaca acgccaagga gatcggcaac 660

ggctgcttcg agttctacca caagtgcaac gacgagtgca tggagagcgt gaagaacggc 720

acctacgact accccaagta cagcgaggag agcaagctga accgggagaa gatcgacggc 780

gtgaagctgg agagcatggg cgtgtaccag atcgagggca gacatcacca ccaccaccat 840

cattag 846

<210> 4

<211> 281

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser Thr Tyr Ala Asp Thr Ile Cys Ile Gly Tyr Ser Ala

20 25 30

Asn Asn Ser Thr Asp Thr Val Asp Thr Val Leu Glu Lys Asn Val Thr

35 40 45

Val Thr Gln Ser Val Asn Leu Leu Glu Asn Gly Gly Gly Gly Lys Tyr

50 55 60

Val Cys Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Lys Pro

65 70 75 80

Ser Lys Gln Ser Gln Gly Leu Phe Gly Ala Ile Ala Gly Phe Thr Glu

85 90 95

Gly Gly Trp Thr Gly Met Val Asp Gly Leu Tyr Gly Tyr His His Gln

100 105 110

Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln Asn

115 120 125

Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys Met

130 135 140

Asn Thr Gln Tyr Thr Ala Ile Gly Cys Glu Tyr Asn Lys Ser Glu Arg

145 150 155 160

Cys Met Lys Gln Ile Glu Asp Lys Ile Glu Glu Ile Glu Ser Lys Ile

165 170 175

Trp Cys Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg Thr

180 185 190

Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val Lys

195 200 205

Ser Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe Glu

210 215 220

Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn Gly

225 230 235 240

Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg Glu

245 250 255

Lys Ile Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr Gln Ile Glu

260 265 270

Gly Arg His His His His His His His

275 280

<210> 5

<211> 307

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser

1 5 10 15

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val

20 25 30

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu

35 40 45

Leu Glu Asn Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly Ile Ala

50 55 60

Pro Leu Gln Leu Gly Asn Cys Ser Val Ala Gly Trp Ile Leu Gly Asn

65 70 75 80

Pro Glu Cys Glu Leu Leu Ile Ser Lys Glu Ser Trp Ser Tyr Ile Val

85 90 95

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala

100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe Glu

115 120 125

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val

130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr

145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu

165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp

180 185 190

Gly Val His His Pro Pro Asn Ile Gly Asn Gln Lys Ala Leu Tyr His

195 200 205

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys

210 215 220

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gln Glu Gly

225 230 235 240

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile

245 250 255

Phe Glu Ala Asn Gly Asn Leu Ile Ala Pro Arg Tyr Ala Phe Ala Leu

260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Ile Asn Ser Asn Ala Pro Met Asp

275 280 285

Lys Cys Asp Ala Lys Cys Gln Thr Pro Gln Gly Ala Ile Asn Ser Ser

290 295 300

Leu Pro Phe

305

<210> 6

<211> 563

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser

1 5 10 15

Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr Val

20 25 30

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn Leu

35 40 45

Leu Glu Asn Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly Ile Ala

50 55 60

Pro Leu Gln Leu Gly Asn Cys Ser Val Ala Gly Trp Ile Leu Gly Asn

65 70 75 80

Pro Glu Cys Glu Leu Leu Ile Ser Lys Glu Ser Trp Ser Tyr Ile Val

85 90 95

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala

100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe Glu

115 120 125

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val

130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr

145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu

165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp

180 185 190

Gly Val His His Pro Pro Asn Ile Gly Asn Gln Lys Ala Leu Tyr His

195 200 205

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys

210 215 220

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gln Glu Gly

225 230 235 240

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile

245 250 255

Phe Glu Ala Asn Gly Asn Leu Ile Ala Pro Arg Tyr Ala Phe Ala Leu

260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Ile Asn Ser Asn Ala Pro Met Asp

275 280 285

Lys Cys Asp Ala Lys Cys Gln Thr Pro Gln Gly Ala Ile Asn Ser Ser

290 295 300

Leu Pro Phe Gln Asn Val His Pro Val Thr Ile Gly Glu Cys Pro Lys

305 310 315 320

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Ile

325 330 335

Pro Ser Ile Gln Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile

340 345 350

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Trp Tyr Gly Tyr His His

355 360 365

Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln

370 375 380

Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys

385 390 395 400

Met Asn Thr Gln Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu

405 410 415

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Ile Asp

420 425 430

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg

435 440 445

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val

450 455 460

Lys Ser Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe

465 470 475 480

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn

485 490 495

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg

500 505 510

Glu Lys Ile Asp Gly Pro Gly Arg Leu Val Pro Arg Gly Ser Pro Gly

515 520 525

Ser Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg

530 535 540

Lys Asp Gly Glu Trp Val Leu Leu Ser Thr Phe Leu Gly His His His

545 550 555 560

His His His

<210> 7

<211> 1710

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaattcgcca ccatggagaa aatagtgctt cttcttgcaa tagtcagtct tgttaaaagt 60

gacacaatat gtataggcta ccatgctaac aactcgaccg acactgttga cacagtactt 120

gaaaagaatg tgacagtgac acactctgtc aacctgcttg agaacagtca caatggaaaa 180

ctatgtctat taaaaggaat agccccacta caattgggta attgcagcgt tgccgggtgg 240

atcttaggaa acccagaatg cgaattactg atttccaagg agtcatggtc ctacattgta 300

gaaaaaccaa atcctgagaa tggaacatgt tacccagggc atttcgctga ctatgaggaa 360

ctgagggagc aattgagttc agtatcttca tttgagaggt tcgaaatatt ccccaaagaa 420

agctcatggc ccaaccacac cgtaaccgga gtgtcagcat catgctccca taatggggaa 480

agcagttttt acagaaattt gctatggctg acggggaaga atggtttgta cccaaacctg 540

agcaagtcct atgcaaacaa caaagaaaaa gaagtccttg tactatgggg tgttcatcac 600

ccgccaaaca taggtaacca aaaggccctc tatcatacag aaaatgctta tgtctctgta 660

gtgtcttcac attatagcag aaaattcacc ccagaaatag ccaaaagacc caaagtaaga 720

gatcaagaag gaagaatcaa ttactactgg actctgcttg aacccgggga tacaataata 780

tttgaggcaa atggaaatct aatagcgcca agatatgctt tcgcactgag tagaggcttt 840

ggatcaggaa tcatcaactc aaatgcacca atggataaat gtgatgcgaa gtgccaaaca 900

cctcagggag ctataaacag cagtcttcct ttccagaacg tacacccagt cacaatagga 960

gagtgtccaa agtatgtcag gagtgcaaaa ttaaggatgg ttacaggact aaggaacatc 1020

ccatccattc aatccagagg tttgtttgga gccattgccg gtttcattga aggggggtgg 1080

actggaatgg tagatggttg gtatggttat catcatcaga atgagcaagg atctggctat 1140

gctgcagatc aaaaaagcac acaaaatgcc attaatggga ttacaaacaa ggtgaattct 1200

gtaattgaga aaatgaacac tcaattcaca gcagtgggca aagaattcaa caaattggaa 1260

agaaggatgg aaaacttgaa taaaaaagtt gatgatgggt ttatagacat ttggacatat 1320

aatgcagaac tgttggttct actggaaaat gaaaggactt tggatttcca tgactccaat 1380

gtgaagaatc tgtatgagaa agtaaaaagc cagttaaaga ataatgctaa agaaatagga 1440

aatgggtgtt ttgaattcta tcacaagtgt aacgatgaat gcatggagag tgtaaagaat 1500

ggaacttatg actatccaaa atattccgaa gaatcaaagt taaacaggga gaaaattgat 1560

ggacccgggc gactggtacc acgaggtagt ccaggatcag gttatattcc tgaagctcca 1620

agagatgggc aagcttacgt tcgtaaagat ggcgaatggg tattactttc taccttttta 1680

ggacatcatc atcatcatca ctaactcgag 1710

<210> 8

<211> 563

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser

1 5 10 15

Asp Thr Ile Cys Ile Gly Tyr Ser Ala Asn Asn Ser Thr Asp Thr Val

20 25 30

Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr Gln Ser Val Asn Leu

35 40 45

Leu Glu Asn Ser His Asn Gly Lys Leu Cys Leu Leu Lys Gly Ile Ala

50 55 60

Pro Leu Gln Leu Gly Asn Cys Ser Val Ala Gly Trp Ile Leu Gly Asn

65 70 75 80

Pro Glu Cys Glu Leu Leu Ile Ser Lys Glu Ser Trp Ser Tyr Ile Val

85 90 95

Glu Lys Pro Asn Pro Glu Asn Gly Thr Cys Tyr Pro Gly His Phe Ala

100 105 110

Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe Glu

115 120 125

Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Thr Val

130 135 140

Thr Gly Val Ser Ala Ser Cys Ser His Asn Gly Glu Ser Ser Phe Tyr

145 150 155 160

Arg Asn Leu Leu Trp Leu Thr Gly Lys Asn Gly Leu Tyr Pro Asn Leu

165 170 175

Ser Lys Ser Tyr Ala Asn Asn Lys Glu Lys Glu Val Leu Val Leu Trp

180 185 190

Gly Val His His Pro Pro Asn Ile Gly Asn Gln Lys Ala Leu Tyr His

195 200 205

Thr Glu Asn Ala Tyr Val Ser Val Val Ser Ser His Tyr Ser Arg Lys

210 215 220

Phe Thr Pro Glu Ile Ala Lys Arg Pro Lys Val Arg Asp Gln Glu Gly

225 230 235 240

Arg Ile Asn Tyr Tyr Trp Thr Leu Leu Glu Pro Gly Asp Thr Ile Ile

245 250 255

Phe Glu Ala Asn Gly Asn Leu Ile Ala Pro Arg Tyr Ala Phe Ala Leu

260 265 270

Ser Arg Gly Phe Gly Ser Gly Ile Ile Asn Ser Asn Ala Pro Met Asp

275 280 285

Lys Cys Asp Ala Lys Cys Gln Thr Pro Gln Gly Ala Ile Asn Ser Ser

290 295 300

Leu Pro Phe Gln Asn Val His Pro Val Thr Ile Gly Glu Cys Pro Lys

305 310 315 320

Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn Ile

325 330 335

Pro Ser Ile Gln Ser Gln Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile

340 345 350

Glu Gly Gly Trp Thr Gly Met Val Asp Gly Leu Tyr Gly Tyr His His

355 360 365

Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr Gln

370 375 380

Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Ser Val Ile Glu Lys

385 390 395 400

Met Asn Thr Gln Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu Glu

405 410 415

Arg Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Ile Asp

420 425 430

Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu Arg

435 440 445

Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys Val

450 455 460

Lys Ser Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys Phe

465 470 475 480

Glu Phe Tyr His Lys Cys Asn Asp Glu Cys Met Glu Ser Val Lys Asn

485 490 495

Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn Arg

500 505 510

Glu Lys Ile Asp Gly Pro Gly Arg Leu Val Pro Arg Gly Ser Pro Gly

515 520 525

Ser Gly Tyr Ile Pro Glu Ala Pro Arg Asp Gly Gln Ala Tyr Val Arg

530 535 540

Lys Asp Gly Glu Trp Val Leu Leu Ser Thr Phe Leu Gly His His His

545 550 555 560

His His His

<210> 9

<211> 1710

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaattcgcca ccatggaaaa gatcgtgctg ctgctggcca tcgtgtccct ggtcaagagc 60

gacaccatct gcatcggcta cagcgccaac aacagcaccg acaccgtgga taccgtgctg 120

gaaaagaatg tgaccgtgac acagagcgtg aacctgctcg aaaacagcca caacggcaag 180

ctgtgcctgc tgaagggaat tgcccctctg cagctgggca attgctctgt ggctggatgg 240

atcctgggca accctgagtg cgagctgctg atctccaaag agtcctggtc ctacatcgtg 300

gaaaagccca atcctgagaa cggcacatgc taccctggcc acttcgccga ctacgaggaa 360

ctgagagaac agctgagcag cgtgtccagc ttcgagagat tcgagatctt ccccaaagag 420

agcagctggc ccaaccacac agtgacaggc gtgtccgcca gctgtagcca caatggcgag 480

tccagctttt accggaacct gctgtggctg accggcaaga acggcctgta tcctaacctg 540

agcaagagct acgctaacaa caaagaaaaa gaggtgctgg tcctctgggg cgtgcaccat 600

cctccaaaca tcggcaatca gaaggccctg taccacaccg agaacgccta tgtgtccgtg 660

gtgtccagcc actacagccg gaagttcaca cccgagatcg ccaagaggcc caaagtgcgg 720

gatcaagagg gcagaatcaa ctactactgg accctgctgg aacccggcga taccatcatc 780

ttcgaggcca acggcaacct gatcgcccct agatacgcct tcgctctgag cagaggcttt 840

ggcagcggca tcatcaacag caacgcccct atggacaagt gcgacgccaa gtgtcagaca 900

cctcagggcg ctatcaacag ctccctgcct ttccagaacg tgcaccctgt gaccatcggc 960

gagtgcccta aatatgtgcg gagcgccaag ctgagaatgg tcaccggcct gagaaacatc 1020

cccagcatcc agtcccaggg cctgtttgga gccattgccg gctttatcga aggcggctgg 1080

acaggcatgg tggatggcct gtatggctac caccaccaga acgagcaagg ctctggatac 1140

gccgccgacc agaagtctac acagaacgcc atcaacggga tcaccaacaa agtgaacagc 1200

gtgatcgaga agatgaacac ccagttcacc gccgtgggca aagagttcaa caagctggaa 1260

cggcggatgg aaaacctgaa caagaaggtg gacgacggct tcatcgacat ctggacctac 1320

aacgccgaac tgctggtgct cctggaaaac gagagaaccc tggacttcca cgacagcaac 1380

gtgaagaacc tgtacgagaa agtgaagtcc cagctgaaga acaacgccaa agagatcggc 1440

aacggctgct tcgagttcta ccacaagtgc aacgacgagt gcatggaaag cgtgaagaat 1500

ggcacctacg actaccccaa gtacagcgag gaaagcaagc tgaacagaga gaagatcgac 1560

ggccctggca gactggtgcc tagaggatct cctggctctg gctacatccc cgaggctcct 1620

agagatggcc aggcctacgt tagaaaggac ggcgaatggg tgctgctgag cacctttctg 1680

ggacaccacc atcaccacca ctgactcgag 1710

<210> 10

<211> 1449

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaattcgcca ccatgggggc aggtgccacc ggccgcgcca tggacgggcc gcgcctgctg 60

ctgttgctgc ttctgggggt gtcccttgga ggtgccgatt ataaggatga tgatgataag 120

agctccagtg attactcgga cctacagagg gtgaaacagg agcttctgga agaggtgaag 180

aaggaattgc agaaagtgaa agaggaaatc attgaagcct tcgtccagga gctgaggaag 240

cggggttctc tggtaccacg aggtagtcca tcacgatcag tgaaattagc gggcaattcc 300

tctctctgcc ctgttagtgg atgggctata tacagtaaag acaacagtgt aagaatcggt 360

tccaaggggg atgtgtttgt cataagggaa ccattcatat catgctcccc cttggaatgc 420

agaaccttct tcttgactca aggggccttg ctaaatgaca aacattccaa tggaaccatt 480

aaagacagga gcccatatcg aaccctaatg agctgtccta ttggtgaagt tccctctcca 540

tacaactcaa gatttgagtc agtcgcttgg tcagcaagtg cttgtcatga tggcatcaat 600

tggctaacaa ttggaatttc tggcccagac aatggggcag tggctgtgtt aaagtacaac 660

ggcataataa cagacactat caagagttgg agaaacaata tattgagaac acaagagtct 720

gaatgtgcat gtgtaaatgg ttcttgcttt actgtaatga ccgatggacc aagtaatgga 780

caggcctcat acaagatctt cagaatagaa aagggaaaga tagtcaaatc agtcgaaatg 840

aatgccccta attatcacta tgaggaatgc tcctgttatc ctgattctag tgaaatcaca 900

tgtgtgtgca gggataactg gcatggctcg aatcgaccgt gggtgtcttt caaccagaat 960

ctggaatatc agataggata catatgcagt gggattttcg gagacaatcc acgccctaat 1020

gataagacag gcagttgtgg tccagtatcg tctaatggag caaatggagt aaaagggttt 1080

tcattcaaat acggcaatgg tgtttggata gggagaacta aaagcattag ttcaagaaac 1140

ggttttgaga tgatttggga tccgaacgga tggactggga cagacaataa cttctcaata 1200

aagcaagata tcgtaggaat aaatgagtgg tcaggatata gcgggagttt tgttcagcat 1260

ccagaactaa cagggctgga ttgtataaga ccttgcttct gggttgaact aatcagaggg 1320

cgacccaaag agaacacaat ctggactagc gggagcagca tatccttttg tggtgtaaac 1380

agtgacactg tgggttggtc ttggccagac ggtgctgagt tgccatttac cattgacaag 1440

taactcgag 1449

Claims

1. A mutant of influenza virus HA neck region, wherein histidine at position 28 is mutated to serine; and/or histidine at position 48 is mutated to glutamine; and/or a mutation of tryptophan to leucine at position 267.

2. The mutant according to claim 1, which has:

(I) and an amino acid sequence shown as SEQ ID No. 4; or

and 5 of the one or more amino acids are substituted, deleted or added are 3.

3. A recombinant protein comprising a mutant of the influenza virus HA neck region of claim 1 and a head region.

4. The recombinant protein of claim 3, having:

(I) and an amino acid sequence shown as SEQ ID No. 8; or

and 3 of the substitutions, deletions or additions of one or more amino acids.

5. A nucleic acid molecule encoding a mutant as claimed in claim 1 or 2, or a recombinant protein as claimed in claim 3 or 4.

6. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule encoding the mutant of claim 1 or 2 has:

(I) a nucleotide sequence shown as SEQ ID No. 3; or

(III) a nucleotide sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (IV), a nucleotide sequence obtained by substituting, deleting or adding one or two nucleotide sequences with the nucleotide sequence shown in the (I), (II) or (III), and a nucleotide sequence which has the same or similar functions with the nucleotide sequence shown in the (I), (II) or (III); or (V), a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of (I), (II), (III) or (IV); and/or

A nucleic acid molecule encoding the recombinant protein of claim 3 or 4 having:

(1) a nucleotide sequence shown as SEQ ID No. 9; or

(5) A nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of (1), (2), (3) or (4).

7. An expression vector comprising the nucleic acid molecule of claim 5 or 6.

8. An antigen comprising a mutant according to claim 1 or 2, or a recombinant protein according to claim 3 or 4.

9. Use of a mutant according to claim 1 or 2, a recombinant protein according to claim 3 or 4, a nucleic acid molecule according to claim 5 or 6, an expression vector according to claim or an antigen according to claim 8, for the preparation of any one or more of the following;

(I) preparing an influenza antibody;

(II) preparing a vaccine for preventing influenza; and/or

(III) preparing a medicament for treating influenza; and/or

10. An influenza antibody, a vaccine for preventing influenza, a drug for treating influenza and/or a detection reagent or a detection kit for detecting influenza virus, which is prepared from the mutant according to claim 1 or 2, the recombinant protein according to claim 3 or 4, the nucleic acid molecule according to claim 5 or 6, the expression vector according to claim or the antigen according to claim 8.